4.1. Cell Culture and treatments
The human keratinocyte cell line (HaCaT cells) was purchased from the National Centre for Cell Sciences (NCCS) in Pune, India, and cultured in DMEM F-12 media supplemented with 10% (v/v) fetal bovine serum, 100 Units/ml penicillin, and 100 mg/ml streptomycin at 37°C in a humidified atmosphere with 5% CO2. Cells were seeded in either 6-well or 12-well plates for subsequent growth and treatments. Reverse transfections were performed at 70–80% confluency using a miR-718 mimic (miR-718) and a miR-718 inhibitor (assay ID MC16440, THERMO Fisher Scientific, MA, USA) (AM-718) at 40 nM, with transfection reagent Fugene HD, and compared with their respective negative controls, miR negative control (M-NC) or anti-miR negative control (AM-NC). Cells were trypsinized and harvested 24 hours after transfection, then stored at -80°C until further use.
4.2. Total RNA isolation and Real-time quantitative PCR
Total RNA was extracted from HaCaT cells transfected with either 40nM of miR-718 or AM-718, or their respective negative controls, using TRIzol reagent (Invitrogen, Paris, France) according to the manufacturer’s protocol. RNA quantification was performed on a NanoDrop spectrophotometer (ND1000, NanoDrop Technologies, Inc., Wilmington, USA). Total RNA (1 µg) was reverse transcribed using RevertAid H Minus Reverse Transcriptase (Fermentas, Glen Burnie, MD), and qRT-PCR was carried out in a 10 µL reaction volume using 2X SYBR Green master mix (Applied Biosystems-ABI, Foster City, CA) following the manufacturer’s instructions. The real-time PCR data were analyzed using Pfaffl’s method. The sequences of primers used for detecting the expression levels of STAT1 and 18S rRNA are listed in Table 1.
Table 1
List of Primer sequences used for experiments in the study.
Gene | Forward Primer 5’-3’ | Reverse Primer 5’-3’ |
STAT1 | ATGGCAGTCTGGCGGCTGAATT | CCAAACCAGGCTGGCACAATTG |
18S | AGAAACGGCTACCACATCCA | CCCTCCAATGGATCCTCGTT |
PHB 3’UTR | AGTTCACACACACCTGTTTCATCTGGTCACACAGTTAAAGAG | CTCTTTAACTGTGTGACCAGATGAAACAGGTGTGTGTGAACT |
4.3. Mice and treatment
All animal protocols were approved by the Institutional Animal Ethics Committee of CSIR-Institute of Genomics and Integrative Biology, New Delhi, India. We developed an IMQ-induced psoriasis mice model using male C57BL/6 mice. The mice were fed a high-fat diet (HFD; D12492, Research Diets. Inc., NJ, USA) for 7 weeks, as HFD mice are more susceptible to developing severe psoriasis than chow diet-fed mice upon topical treatment with IMQ. Four-week-old male C57BL/6 mice were purchased from Livon Biolabs (Bengaluru, India) and housed in cages under a 12-hour alternating dark and light period. The mice were randomly divided into the following groups (5 mice in each group): Untreated mice group, IMQ mice group, vaseline mice group, miR-718 mice group, Scramble control mice group, and Tofacitinib mice group. Except for the untreated and vaseline groups, 62.5 mg of 5% IMQ cream was evenly applied to the exposed skin on the back of the mice. Synthetic miR-718 or scramble oligonucleotides (7 µg [Dharmacon Inc. (CO, USA)]) packed in the in vivo transfecting agent (Max Suppressor-In Vivo RNA-LANCEr II, Bioo Scientific, Austin, Tex) were injected intradermally into the shaved back skin of the mice once a day. Tofacitinib was administered in two doses 6 hours apart for a total dose of 30 mg/kg. Digital photography was used to record the changes in skin lesions at the same time every day. On the 5th day, mice were sacrificed 24 hours after the last treatment. The spleen and back skin of the mice were collected, fixed with 4% formalin, and stored at room temperature, while other tissues were stored at -80 ºC. The spleen was used to calculate the spleen index using the formula: Spleen index = spleen weight (mg)/body weight (g).
4.4. Protein preparation and western blotting
The user lysed transfected cells with RIPA lysis buffer (50 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1% NP40, 0.25% Na-deoxycholate, 1 mM EDTA) containing protease and phosphatase inhibitors (G-Biosciences, MO, USA) for 30 min on ice. The lysates were centrifuged at 16,000 g for 30 min at 4°C, and the supernatant was obtained. Protein concentration was estimated by the BCA method (Sigma, USA). Equal amounts of proteins (50–100 µg) were separated on 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a PVDF membrane (Mdi; Advanced Microdevices, India). The membrane was blocked using 5% Bovine serum albumin (BSA) or 5% Skim milk (SM) for 2h at room temperature and then incubated with the respective antibodies in 2.5% BSA/ for 16 h at 4°C. The blot was washed three times using TBST and further incubated with the suitable secondary antibody for 1 h at room temperature. Antibodies used included STAT1, STAT2, STAT3, pSTAT1(Ser 727), and pSTAT1(Tyr727) from Affinity Biosciences (1:1000); PHB, NF-kB, pNF-kB, and cytokeratine 17 (K17) from Santa Cruz (1:200); MMP7 and MMP9 from Elabscience (1:1000); MFN1, MFN2, DRP1, and OPA1 from Cell Signaling Technology (CST) (1:1000); JAK1, JAK2, JAK3, pJAK1, and pJAK2&3 from Thermo Fisher Scientific (1:1000); Loading control β-actin from Abcam (Cambridge, UK) and GAPDH from CST (1:5000). The secondary antibodies were HRP-linked and used at 1:5000 concentration, and blots were developed using enhanced chemiluminescence (Thermo Fisher Scientific, CA, USA). Image Lab software was used to acquire and analyze images from specific Bio-Rad imaging systems.
4.5. Immunohistochemistry
The Ultra-Vision Quanto Detection Kit (Thermo Scientific, Waltham, MA, USA) was used according to the manufacturer's instructions. Skin biopsies were fixed in 10% formalin, dehydrated, and embedded in paraffin. Sections 0.5 µm thick were placed on poly-Lysine coated slides, deparaffinized, hydrated, and underwent antigen retrieval with 10 mM citrate buffer pH 6.0. They were then blocked with protein block for 10 minutes and incubated with antibodies against Vinculin (1:200), Ki67 (1:200), VEGF (1:100), and CD4 (1:100) at 4°C. Slides were incubated with HRP-polymer quanto for 30 minutes at room temperature and developed using DAB quanto substrate. Counterstaining with hematoxylin followed, and images were captured using an upright Nikon E1 microscope (Nikon Corporation, Tokyo, Japan).
Ki67 and VEGF expression were determined by the optical density of DAB-labeled cells, where DAB-positive staining indicates brown-colored cells. Staining intensity quantification utilized the image processing software Fiji (ImageJ version 2.0) as described by Patera et al. The color deconvolution function was applied to microphotographs, yielding three independent digital images (H&E, DAB, and a complementary image). Stain-specific optical density values were determined, collecting mean grey values from image 2 (DAB). Optical density was then calculated using the formula optical density = log (max grey intensity/mean grey intensity).
4.6. Cloning of luciferase reporter construct and luciferase assay
The 3’UTR sequence of the PHB transcript was obtained from the Ensemble genome browser. The region containing the target site of miR-718 was then amplified from the human genome using primers listed in Table 1. This amplified region was inserted downstream of the renilla luciferase gene, between the Xho1 and Not1 cut sites of the psiCHECK-2 vector (Promega Corporation, Madison, WI), to generate the luciferase reporter construct. The plasmid was verified by sequencing and PCR analysis. For the luciferase assay, HaCaT cells were co-transfected in a 12-well plate. Co-transfection of the luciferase reporter construct (200ng) was performed along with a 40nM dose of either miR-718 or AM-718 or their respective controls. After 24 hours of transfection, a dual luciferase assay (Promega Corporation, MD, USA) was conducted, and luminescence was measured using an Infinite M200 Pro Multimode Reader (TECAN, Männedorf, Switzerland). Renilla luciferase values were normalized to those of firefly luciferase.
4.7. Mitochondrial potential measurement
The mitochondrial membrane potential was assessed following the manufacturer’s protocol (Invitrogen, Oregon, USA). HaCaT cells were cultured in twelve-well plates and transfected with miR-718, M-NC, AM-718, or AM-NC (40 nM). A positive control for depolarization, CCCP (50uM), was included. After 24 hours, the cells were trypsinized, washed with 1X PBS, and stained with JC-1 dye (5 nM) (Invitrogen, Oregon, USA) for 15 minutes at 37°C. Following incubation, the cells were washed, and the fluorescence was measured using a flow cytometer (BD FACS Accuri C6 Plus, NJ, USA). The results are reported as the ratio of red to green fluorescence per 10,000 cells.
4.8. Statistical analysis
All results are expressed as mean ± SEM. The differences between the two groups were analyzed using Student’s two-tailed t-test, with p-values less than 0.05 considered statistically significant.