Isolation of PBMC and T-cell culture
Informed consent was obtained from five healthy donors prior to blood collection and the study and the use of human material were approved by the institutional review boards at the Isfahan University of Medical Science (IR.MUI.RESEARCH.REC.1398.788). Peripheral blood mononuclear cells were isolated from heparinized blood using the Ficoll density gradient. Cells were incubated for 24 hours in complete RPMI-1640 medium (BioIdea-Iran) containing 10% FBS (BioIdea-Iran) at 37 ° C and 5% CO2 in order to isolate monocytes in a T-75 cell culture flask.
Activation and expansion of T lymphocytes
Monocyte-depleted PBMC were centrifuged at 500 × g for 5 minutes and lymphocytes were collected and suspended in complete RPMI-1640 medium containing 1 µg / ml phytohemagglutinin (Sigma-Aldrich-USA), then cells were incubated for 24 h at 37 ° C and 5% CO2. The cells were incubated with anti-CD3 antibody (BD Bioscience-USA) at 3.3 μg/mL final concentration for 48 h in order to isolate untouched mature T cells.
Isolated T cells seeded in a 0.5×103 cells/mL cell concentration in 24 well cell culture plate and then treated with different concentrations of exogenously added IL-2 (Sigma-Aldrich-USA) (100 IU/mL, 200 IU/mL and 300 IU/mL), phytohemagglutinin (0.5 µg/mL, 1.5 µg/mL and 2 µg/mL), and insulin (Sigma-Aldrich-USA) (1 µg/mL, 2 µg/mL and 3 µg/mL) in separate triplicate groups for 7 days. From the third day onward, culture media was replaced with the aforementioned-supplemented culture media every 2–3 days.
The cells were also treated using a combination of different concentrations of these reagents to examine their combined effect. From day 2 the cells were counted daily, and cell viability was assessed by Trypan Blue (Gibco, Invitrogen, CA) staining. Cell morphology and T-cell cluster formation were examined by phase-contrast microscopy for 7 days after treatment in different groups.
After 7 days of treatment, MTT assay was performed to determine the cell toxicity in each treated group compared to untreated cells as a control group.
For this purpose, MTT (3-(4,5-dimethylthiazolyl-2)-2,5-diphenyl2H-tetrazolium bromide, Sigma-Aldrich, 5mg MTT/ml PBS) solution (10 μL/well) was added to the cells and incubated for 4 h in a 37˚C incubator protected from light, giving rise to insoluble (purple) formazan crystals in living cells. Next, 100 μL/well of dimethylsulfoxide (DMSO) was added to solubilize the crystals. Absorbance (570 nm with 650 nm background correction) was measured using Microplate Reader (Eppendorf, Germany). All experiments were performed in triplicate. The cell viability (%) was calculated using the following equation:
Cell proliferation assay using Quantitative real-time RT-PCR
Total RNA isolation from 1×106 cells was performed by RNA extraction kit according to the manufacturer's instructions (Yektatajhiz-Iran) and RNA was eluted with 100 μl elution buffer and then stored at −80 °C until use. The concentration of total RNA was assessed using a spectrophotometer and the quality was checked by agarose gel electrophoresis. First-strand cDNA synthesis was carried out following the manufacturer’s protocol (Biofact-south Korea). Quantitative real-time RT-PCR reaction was performed to evaluate the expression level of cell proliferation marker Ki-67 and β-actin housekeeping gene using the following specific primers: Ki-67 forward, 5'-TCTGACCCTGATGAGAAAGCTC-3', Ki-67 reverse, 5'-TTGAGTCATCTGCGGTACTG-3' and β-actin forward, 5'-ATGTGTGACGAAGAAGCAT-CAGCC-3', and β-actin reverse, 5'- TCATCCCAGTTGGTGATAATGCCG -3'.
All qRT-PCR reactions were prepared in triplicate by mixing 10 μL of SYBR green master mix (Ampliqon kit, Denmark), 0.5 μL of each primer (10 μM), 2 μL of synthesized cDNA, and 7 μL RNase free water. ABI Applied Biosystems™ Thermal cycler (Thermo Scientific, USA) was used with the cycling conditions comprised an initial 10 min incubation at 95 °C, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Relative expression was determined using the 2-ΔΔCT method.
Flow cytometry
The composition of CD8+ and CD4+ cells in isolated T cells was evaluated by flow cytometry. The fluorochrome-conjugated mouse anti-human antibodies: Fluorescein isothiocyanate (FITC)-CD8 and phycoerythrin (PE)-CD4 were purchased from BioLegend, Inc. (San Diego, CA, USA). For surface staining, cells were washed once with PBS, incubation was conducted with antibodies in cell staining buffer (3% FBS in PBS) in dark for 25 min at 4°C. Appropriates isotype antibodies were used as negative controls. Cell fluorescence analyzed by the flow cytometry with a BD flow cytometer (BD Bioscience, USA). FlowJo (version 10, TreeStar) software was used for flow cytometric data analysis.
Cytotoxicity assay
To evaluate the antitumor activity of expanded T lymphocytes, MCF-7 breast cancer cell lines as target cells were co-cultured with isolated T lymphocytes in different effector-target (E:T) ratio of 1:1, 3:1, 5:1, 10:1, in 96-well cell culture plate in triplicates and incubated at 37 ° C and 5% CO2 for 24 hours.
A quantitative assessment of apoptosis was performed using FITC Annexin V Apoptosis Detection Kit (BD Biosciences, San Jose, CA, USA). Briefly, T lymphocytes were removed from the co-culture medium, and the supernatant was collected for further assays. Target cells were detached using 0.025% trypsin, washed twice with cold PBS, and resuspended in binding buffer. Cell staining was performed according to the manufacturer’s instructions. Cell fluorescence immediately analyzed by the flow cytometry with a BD flow cytometer (BD Bioscience, USA) by accumulating up to 100,000 cells per tube and the obtained data were analyzed. The percentage cytotoxicity in the MCF-7 cells was measured in appropriate control without effector cells. Cellular debris was omitted from the analysis. In addition, MTT assay was performed to confirm the cytotoxicity power of expanded T cells.
Evaluation of T-cell degranulation
The expression level of lysosomal-associated membrane protein-1 (LAMP-1 or CD107a), as a sensitive marker for the cytotoxic activity and T-cell degranulation following stimulation, was accessed using flow cytometry. For this purpose, expanded T cells co-cultured with MCF-7 cells as target cells in 10:1 E/T ratio for 4 h. After incubation, T lymphocytes were removed from the co-culture medium and stained with PECy5-conjugated anti-CD107a (BD Bioscience, San Jose, CA) and cell fluorescence was measured by flow cytometry. FlowJo (version 10, TreeStar) software was used for flow cytometric data analysis.
Also, monocyte-depleted untreated PBMC were co-cultured with target cells in the same E:T ratio as control.
Statistical analysis
Statistical analyzes were performed with GraphPad Prism 5.0 (GraphPad Software, Inc., San Diego, CA). Results are shown as mean ± SD. Comparison of results was carried out using the two-tailed unpaired t –test and one-way ANOVA. P < 0.05 was considered statistically significant.