Cell lines and reagents
Unless stated otherwise, MCF7, MDAMB231, HCC1569 and LentiX cells were cultured in DMEM high glucose (Lonza) + 10% Fetal Bovine Serum (Gibco), 1% Penicillin/Streptomycin (Lonza). T47D cell were cultured in RPMI (BioWest) + 10% FBS, 1% Penicillin/Streptomycin. hTERT-RPE1 retinal cells were cultured in DMEM/F12 (Gibco) + 10% FBS, 1% Penicillin/Streptomycin. All cells were maintained in a 37°C incubator in 95% humidity and 5% CO2.
For estrogens (E2) treatments, control and STARD7-depleted MCF7 or T47D cells on D4 post transduction were first seeded in 6 well plates in DMEM:F12 without phenol red (Gibco), supplemented with 5% of charcoal/dextran treated FBS (HyClone) and 1% of Penicillin/Streptomycin for 48 hours as a pre-treatment to deplete hormones. Afterwards, the medium was changed to a medium with β-Estradiol (E2) (10 nM) (Sigma-Aldrich, E2257) and cells were harvested at the indicated time points (for protein lysates, 30, 60 minutes, 24 and 48 hours), RNA extraction (6 hours) and EDU proliferation analysis (24 and 48 hours). For EGF treatments, cells were first serum-starved overnight or for 24 hours in a medium with 0% FBS before the addition of EGF (100 nM) (Cell Signaling, #9908). Treatments with Chloroquine (25 µM) (Sigma-Aldrich), C6628-25) and Rapamycin (20 nM) (LC Laboratories, R-5000) were carried out for 24 hours with cells cultured in DMEM high glucose (Lonza) + 10% Fetal Bovine Serum (Gibco), 1% Penicillin/Streptomycin (Lonza).
Lentiviral vector production and cell transduction
Transfection mixture was prepared in 800 µL OptiMEM (Gibco) by adding following plasmids: 12 µg of psPAX2 (AddGene #12260), 5 µg of pVSV-G (AddGene #138479) and 12 µg of expression vector carrying shRNA sequence, in the presence of 80 µL of TransIT-LT1 Transfection Reagent (Mirus, Mir2360). Expression vectors were: pLVshCtrl (Sigma, SHC002), pLVshSTARD7#2 (Sigma, TRCN000028081) and pLVshSTARD7#4 (Sigma, TRCN0000155648). After 15 minutes of incubation at room temperature, the transfection mixture was added dropwise on top of the 50–60% confluent LentiX cells on T75 cm3. Medium was changed within 6–16 hours, with 8 mL of a complete culture medium. After 72 hours of viral particle production, medium with LV was collected, centrifuged at 800 x g for 10 minutes, 0.22 µL filtered and either added directly to cells to be transduced or frozen in -80°C.
For cell transduction, on day 0 (D0), cells were transduced using the medium containing lentiviral particles in the presence of 8 µg/mL of Polybrene transfection reagent (Millipore). After 24 hours (D1), the medium was changed to the selection medium with 1 µg/mL Puromycin (InVivoGen) for 48 hours. Afterwards (D3-D4), cells were split using the Trypsin/EDTA solution (BioWest) and seeded for experiments. All experiments were done on D5-D6 post transduction.
Real-Time PCR analyses
Total RNAs were extracted from cultured cells using the column based extraction E.Z.N.A.® Total RNA Kit I (Omega Biotek) according to manufacturer’s protocol. cDNAs were obtained using the RevertAid H Minus First Strand cDNA Synthesis Kit using oligo(dT)18 primers and 1 µg of total RNAs as a template. Real-time PCR reactions were carried out on Light Cycler480 (Roche) with TB Green Premix Ex Taq II Tli RNase H Plus (Takara Bio) and specific primers designed with the PrimerBlast software (NCBI). Primer sequences can be found in Table 1. Ct values were used to calculate fold change of expression using the 2− Δ ΔCt method. HSP90B1, GAPDH, and β-Actin were used as housekeeping controls.
Table 1
GAPDH | F : GCATCTTCTTTTGCGTCGC R : CCAAATGCGTTGACTCCGA |
HSP90B1 | F : CTGTATTCAGGCCCTTCCCG R : ACCACAGCCTTTTCAATCTTGT |
ACTB | F : AGAGCTACGAGCTGCCTGAC R : AGCACTGTGTTGGCGTACAG |
STARD7 | F : ATTCAGAGGGCAAAGAGCAA R : AAGGTGGGTGCCTGTAATTG |
ESR1 | F : GATCAACTGGGCGAAGAGGG R : CATTTTCCCTGGTTCCTGTCC |
CCND1 | F : ATCAAGTGTGACCCGGACTG R : CTTGGGGTCCATGTTCTGCT |
CCNB1 | F : CTGCTGGGTGTAGGTCCTTG R : AGCTGAAGGTTTTGCTTCCTTC |
PLK1 | F : CCGCAATTACATGAGCGAGC R : GCTTGGTGTGATCCTGGAAGA |
IGFBP4 | F : GCAGAAGCACTTCGCCAAAA R : CTCTCGAAAGCTGTCAGCCA |
RARA | F : CACACACCTGAGCAGCATCAC R : CGGTCCTTTGGTCAAGCAGT |
AURKA | F : GTGGGGGATATCTCAGTGGC R : ATGGAGTGAGACCCTCTAGC |
PTGS2 | F : TGCGCCTTTTCAAGGATGGA R : ACATCATCAGACCAGGCACC |
MYBL2 | F : CAGCCACTTCCCTAACCGCA R : TGTCCACTGCTTTGTGCCAT |
MYC | F: CCGCTTCTCTGAAAGGCTCT R: CTAACGTTGAGGGGCATCGT |
ERBB2 | F : AGCTCATCTACCAGGAGTGG R : GGTCACCATCAAATACATCGGA |
ERBB3 | F : TCAGAGTCATCAGAGGGGCA R : CCACTGAAGAAAGGGTGCCT |
MMP9 | F : CGACGTCTTCCAGTACCGAG R : TTGTATCCGGCAAACTGGCT |
CFAP69 | F : AACTGTGTGGCTTGCCATTT R : GCTTCTTTGGTGGTTCTGCAT |
DNAH1 | F : AGATGGCCGTTATCTGGCTC R : CACGCTTTATCCAGTGTCGC |
WDR19 | F : TCCGCTTGTACATGGCTCTG R : GGCCATCTCGGAGGGAATTT |
IFT43 | F : ACAGCTGGATCTGAACGCAT R : TCCAGGTCACGGTAGGTCAT |
PLA2G3 | F : GGCCTAAAACCTCAGGGTGC R : AGCATGTTGGTAACCTCGGG |
IFT22 | F : TGTGGTGGCGATGCTAAGTT R : TTCAAGGGTGGCGACAAAGA |
DNAAF4 | F : GGCACATGTACGACGTGGA R : TTCATAATCCTGTAGGCCTTCTAC |
EGFR | F : CTGTGCCATCCAAACTGCAC R : CGATGGACGGGATCTTAGGC |
SRC | F : TCACCGCAAGAGCTACCATT R : TCCTGGGAAGGTTGGAACTG |
CBL | F : AGCTCGGCTCCAGAAATTCA R : CCAATAGCCCACTGACCCAG |
RB1 | F : AGGTCTGCCAACACCAACAA R : GCATTCGTGTTCGAGTAGAAGTC |
Transcriptomic analyses by RNA sequencing
RNA sequencing was performed on libraries prepared from total RNA samples from MCF7 cells (shControl, shSTARD7#2, shSTARD7#4). Three biological replicates were analysed for each condition. Total RNAs were extracted by using the E.Z.N.A.® Total RNA Kit (Omega Bio-tek) according to the manufacturer’s protocol. Total RNAs before elution were treated with TURBO™ DNase (ThermoFisher Scientific, AM2238). RNA integrity was verified on a Bioanalyser 2100 with RNA 6000 Nano chips (Agilent technologies). RNA integrity number score was above 9 for every sample. Libraries were prepared using Truseq® stranded mRNA Sample Preparation Kits (Illumina) following manufacturer’s instructions. Libraries were validated using QIAxcel Advanced System and quantified by qPCR using the KAPA library quantification kit. Libraries were multiplexed and sequenced on an Illumina NextSeq500 sequencer to generate more than ~ 25,000,000 paired-end reads (2 × 150 bases) per library. Raw reads were demultiplexed and adapter-trimmed using Illumina bcl2fastq conversion software v2.20. Reads were processed within the nf-core/rnaseq-1.4.2 pipeline 17 using STAR aligner, the human reference genome GRCh38 and the gene annotations from Ensembl release 97. Quality of the sequencing data was successfully controlled using QC modules of the pipeline and a report has been compiled with MultiQC. The data has been deposited to the Genomic Expression Omnibus (GEO) with the following accession number : GSE251873.
SDS-PAGE and western blot analyses
Cells were washed twice in ice-cold PBS and scrapped in an ice-cold RIPA lysis buffer (50 mM Tris-HCl pH 7.4, 2 mM EDTA, 50 mM NaF, 150 mM NaCl, 0.1% SDS, 0.5% sodium deoxycholate, 1% NP40) supplemented with cOmplete Protease Inhibitor (Roche) and PhosStop (Roche). Lysates were cleared by centrifugation 15 minutes, 15 000 x g at 4°C and protein concentrations were measured using the Pierce BCA Protein Assay Kit (Thermo Scientific) according to manufacturer’s instructions. Samples were denaturated by boiling for 7 minutes in a Laemmli Buffer with β-mercaptoethanol and 20 µg of total proteins were loaded per well of SDS-PAGE gel (8–14%). Samples were separated under reducing conditions and transferred to PVDF membrane (Immobilion-P, Millipore), using wet transfer chambers. Membranes were blocked in 5% skimmed milk for 45 minutes, cut and incubated with primary antibodies overnight on rotor at 4°C. A list of primary antibodies is available in Table 2. The following day, membranes were washed five times in TBS-T and incubated for 1 hour at room temperature with HRP conjugated secondary antibodies donkey anti-rabbit (GE Healthcare, NA934V) or sheep anti-mouse (GE Healthcare, NA931V). After subsequent five washing steps, membranes were visualized with the Pierce ECL Western (Thermo Scientific) or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific) on the ImageQuant LAS 4000 mini (GE Healthcare).
Table 2
Name of antibody | Reference number | Company |
GAPDH (D16H11) | #5174 | Cell Signaling Technologies |
STARD7 | PAS-30772 | Invitrogen |
ACTIN-HRP (AC-15) | A3854 | Sigma |
Mitofusin2 (D2D10) | #9482 | Cell Signaling Technologies |
FIS1 | HPA017430 | Sigma |
DRP1 (C-5) | sc-271583 | Santa Cruz |
Tri-Methyl-Histone H3 (Lys27) (C36B11) | #9733 | Cell Signaling Technologies |
Tri-Met-H3K4 | Ab12209 | Abcam |
Ac-H3K27 | A7253 | AbClonal |
Met-H3K9 Trimethyl Histone H3 (6F12-H4) | sc-130356 | Santa Cruz |
Histone H3 | ab1791 | Abcam |
Cyclin A (B-8) | sc-271682 | Santa Cruz |
Cyclin B1 | A305-000A | Bethyl Laboratories Inc. Montgomery, TX, USA |
Cyclin B2 | A304-509A | Bethyl Laboratories Inc. Montgomery, TX, USA |
Cyclin D1 (92G2) | #2978 | Cell Signaling Technologies |
Cyclin E (E-4) | sc- 377100 | Santa Cruz |
P21 Waf/Cip1 (12D1) | #2947 | Cell Signaling Technologies |
P27 Kip1 (D69C12) | #3686 | Cell Signaling Technologies |
MYC (D84C12) | #5605 | Cell Signaling Technologies |
ERalpha (HC-20) | sc-543 | Santa Cruz |
SOX9 | AB5535 | |
EGFR (A-10) | Sc-373746 | Santa Cruz |
Phospho-ERalpha (S118) | #16J4 | Cell Signaling Technologies |
HER2/ErbB2 (29D8) | #2165S | Cell Signaling Technologies |
HER3/ErbB3 (D22C5) | #12708S | Cell Signaling Technologies |
Phospho-EGFR (Y1068) | #3777 | Cell Signaling Technologies |
TrxR1 (B-2) | sc-28321 | Santa Cruz |
TXNIP (D5F3E) | #14715 | Cell Signaling Technologies |
LAMP1 (D401S) | #15665 | Cell Signaling Technologies |
LAMP2 (H4B4) | sc18822 | Santa Cruz |
PERK (C33E10) | #5683 | Cell Signaling Technologies |
pAKT (S473) (D9E) | #4060 | Cell Signaling Technologies |
LC3B (D11) | #3868 | Cell Signaling Technologies |
p62 | NBP1-48320 | Novus |
Rab11 | #3539 | Cell Signaling Technologies |
Immunofluorescence analyses
To measure the length of the primary cilium, hTERT-RPE1 cells were kept in DMEM/F12 medium supplemented with 10% FBS and 1% pen/strep in an incubator with a 5% CO2 and 95% humidified atmosphere. hTERT-RPE1 cells were transduced with the LV-sh Control (CTRL), LV-sh STARD7#2 or LV-sh STARD7#4 construct and the medium was changed to medium containing 1 µg/ml of puromycin for 48 hours. After that, cells were split and seeded for experiments. Three days after transduction, cells were seeded on coverslips. Four days after transduction, cells were starved with no serum Optimem for 48 hours. Cells were fixed in 4% PFA on day six after transduction, blocked, permeabilized and stained with a mouse anti-Arl13b antibody overnight. The next day, coverslips were incubated with a secondary goat anti-mouse IgG AlexaFluor568 antibody and DAPI and mounted. Samples were visualized using a Zeiss HR LSM 880 confocal microscope. A Z stack of 4 µm was taken for each condition. Data was analysed using the Imaris software. 6 images of cells transduced with the LV-sh CTRL construct were analysed (measurements: n = 12) and 9 images of cells transduced with the LV-shRNA STARD7 construct (3 images of with cells transduced with the shRNA STARD7#2 construct, measurements: n = 10, 6 images of cells transduced with the shRNA STARD7#4 construct, measurements: n = 15). Statistical significance was determined with the unpaired Student T-test, ** = p < 0.01.
To assess EGFR trafficking upon EGF stimulation, control or STARD7-depleted MDA-MB231 cells were seeded on coverslips in 6-well plates and serum-starved for 24 hours. Cells were subsequently untreated or stimulated with EGF (Alexa Fluor® 488 EGF complex, Life Technologies, Grand Island, NY). Cells were kept for 45 minutes at 4°C in the dark, put back at 37°C for 10 minutes, washed with some fresh medium to remove EGF and incubated again at 37°C for 15 or 30 minutes. Cell were then fixed with paraformaldehyde 4% and preimmobilized with Triton X 0.3% for 10 minutes at room temperature. They were subsequently incubated with an anti-EEA1 antibody for 2 hours at room temperature followed by 45 minutes of incubation at room temperature with an Alexa Fluor 594-conjugated antibody (Dako, Glostrup, Germany). Images were acquired with the confocal system of Leica SP5 inverted microscope.
To assess autophagy, cells were seeded on coverslips in 6-well plates. After transfection or treatment, cells were washed in PBS, fixed with 4% paraformaldehyde (PFA) in PBS for 15 minutes and pre-immobilized with 0.2% Triton-X100/PBS for 10 minutes at room temperature. Cells were then washed and blocked for 1 hour (5% BSA + 5% normal goat serum in PBS) followed by overnight incubation at 4°C with primary antibodies in a blocking solution. The next day after 1 hour incubation with appropriate goat secondary antibodies coupled to Alexa Fluor 488 or 568 fluorophores (Life Technologies), coverslips were washed and incubated 10 minutes with DAPI (Life Technologies). ProLong (Life Technologies) was used for mounting on glass slides and images were acquired with the Leica TCS SP5 II confocal system (Leica Microsystems, Wetzlar, Germany).
Proliferation analyses
Cell proliferation was measured by the incorporation of thymidine analogue EdU into newly synthesized DNAs by using the Click-iT™ EdU Alexa Fluor™ 488 Flow Cytometry Assay Kit (Invitrogen ref: C10420) according to manufacturer’s protocol. Briefly, cells were incubated with 10 µM EdU in complete medium for 2 hours. Following washing and harvesting by trypsinization, cells were fixed in Click-iT® fixative for 15 minutes and permeabilized by the saponin-based buffer. Cells were incubated with Click-iT® reaction cocktail for 30 minutes at room temperature. Following washing steps, samples were analysed on the FACS Canto (BD Biosciences) at the 488 nm excitation laser with a green emission filter. Results were analyzed with the FlowJo software.
Targeted LC-MS metabolomics analyses
MCF7 cells were transduced with lentiviral vectors (shControl, shSTARD7#2 and shSTARD7#4) in 6-well plates and after selection in a Puromycin-containing medium for 5 days, cells were washed with cold PBS, scrapped, centrifuged and pellets were kept frozen in liquid nitrogen. For metabolomic analyses, the extraction solution was composed of 50% methanol, 30% acetonitrile (ACN) and 20% water. The volume of the extraction solution was adjusted to cell number (1 ml per 106 cells). After addition of the extraction solution, samples were vortexed for 5 minutes at 4°C and centrifuged at 16,000g for 15 minutes at 4°C. The supernatants were collected and stored at -80°C until analysis. LC/MS analyses were conducted on a QExactive Plus Orbitrap mass spectrometer equipped with an Ion Max source and a HESI II probe coupled to a Dionex UltiMate 3000 uHPLC system (Thermo). External mass calibration was performed using a standard calibration mixture every seven days, as recommended by the manufacturer. The 5 µl samples were injected onto a ZIC-pHILIC column (150 mm × 2.1 mm; i.d. 5 µm) with a guard column (20 mm × 2.1 mm; i.d. 5 µm) (Millipore) for LC separation. Buffer A was 20 mM ammonium carbonate, 0.1% ammonium hydroxide (pH 9.2) and buffer B was ACN. The chromatographic gradient was run at a flow rate of 0.200 µl min− 1 as follows: 0–20 min, linear gradient from 80–20% of buffer B; 20–20.5 min, linear gradient from 20–80% of buffer B; 20.5–28 min, 80% buffer B. The mass spectrometer was operated in full scan, polarity switching mode with the spray voltage set to 2.5 kV and the heated capillary held at 320°C. The sheath gas flow was set to 20 units, the auxiliary gas flow to 5 units and the sweep gas flow to 0 units. The metabolites were detected across a mass range of 75–1,000 m/z at a resolution of 35,000 (at 200 m/z) with the automatic gain control target at 106 and the maximum injection time at 250 ms. Lock masses were used to ensure mass accuracy below 5 ppm. Data was acquired with Thermo Xcalibur software (Thermo). The peak areas of metabolites were determined using Thermo TraceFinder software (Thermo), identified by the exact mass of each singly charged ion and by the known retention time on the HPLC column.
Subcellular Fractionations
Cytoplasmic and crude mitochondrial fractions were separated using the Mitochondrial Isolation Kit for Cultured Cells (Thermo Scientific) according to manufacturer’s protocol. Briefly, cells from 15 cm culture dishes were scrapped on ice and pelleted by centrifugation 850 x g for 2 minutes. 800 µL of Reagent A with protease inhibitors was added, samples were vortexed for 5seconds and incubated on ice for 2 minutes. Afterwards, 10 µL of reagent B was added and samples were vortexed at max speed for 5 seconds and incubated on ice for 5 minutes with vortexing every minute. 800 µL of reagent C was added, and after centrifugation steps, supernatants - cytosolic fractions -were transferred to a fresh tube. 500 µL of reagent C was added to the remaining pellet and after centrifugation, the crude mitochondrial fraction was obtained. For western blot analyses, mitochondrial pellets were suspended in 2% CHAPS in TBS. For MAMs isolation, all subsequent steps were carried out as previously described 18.
Transmission Electron Microscopy
Cells were fixed for 1 hour at 4°C in a solution composed of 2.5% glutaraldehyde in 0.1 M Sorensen’s buffer (0.2 M NaH2PO4, 0.2 M Na2HPO4, pH 7.4). After several washes in the same buffer, the samples were post-fixed for 60 minutes with 2% osmium tetroxide, washed in deionised water, dehydrated through graded ethanol (70, 95, and 100%) and embedded in epon for 48 hours at 60°C. Ultrathin sections (700-A thick) were obtained by means of an ultramicrotome (Reichert Ultracut E) equipped with a diamond knife. The ultrathin sections were mounted on palladium/copper grids coated with collodion and contrasted with uranyl acetate and lead citrate for 5 minutes each before being examined under a Jeol JEM1400 transmission electron microscope at 80 kV. Random fields were photographed using an 11-megapixel camera system (Quemesa, Olympus). Morphometric measurements were performed with iTEM v5.2 (Olympus, Tokyo, Japan) and analyzed using Image J v1.52a software.
To evaluate the area occupied by mitochondria in control or STARD7-depleted cells, we randomly took 22 images of whole cells from each sample with a JEOL 1400 TEM at × 2,500 magnification. In each image, we counted the number of mitochondria (651 in control cells and 393 in STARD7-depleted cells for a total of 1044 mitochondria) and calculated the average number of mitochondria on the cytoplasmic area examined on each cell incidence and the average area occupied by the mitochondria on each cell incidence. In addition, we assessed the configuration of 5 mitochondria in 21 control cells and in 22 STARD7-depleted cells, respectively.
To evaluate the frequency of contact between the mitochondria and the ER in control or STARD7-depleted cells, we randomly took 20 images of cytoplasmic area from 21 different cells in each sample with a JEOL 1400 TEM at ×10,000 magnification. In each image, we counted the number of mitochondria (488 in control cells and 347 in STARD7-depleted cells for a total of 835 mitochondria) and calculated the proportion of mitochondria in close contact with ER (< 30 nm). Moreover, the perimeter of each mitochondria and the proportion of the mitochondrial surface closely associated with ER were calculated.
Proteomic analyses
Pellets were resuspended in 50 µl 6 M guanidine hydrochloride 100 mM Tris pH8 .5 containing 1.5 mg/mL TCEP and 1 mg/mL chloroacetamide and digested with 1 µg LysC (FUJIFILM Wako Pure Chemicals U.S.A. Corporation) for 4 hours at 37°C. Subsequently, samples were diluted to 300 µl with LC-MS Water and digested overnight using 1 µg of porcine Trypsin (Thermo Scientific) followed by desalting using stage-tips before MS analyses. Peptides were resuspended in 0.1% TFA in Water and peptide content was estimated 280nm Absorption using a Nanodrop 2000 (Thermo Scientific). 1 µg was then injected and separated on an Ultimate 3000 Nano using a C18 packed emitter (Aurora, IonOptiks, Australia), with a gradient from 4–29% acetonitrile in 90 minutes, with a 10 minutes 80% wash. 0.5% acetic acid was present throughout. Peptides were analysed in data-independent acquisition (DIA) mode on a Thermo Fusion Lumos. The mass spectrometer was operated in DIA mode, acquiring a MS 350–1650 Da at 120 k resolution followed by MS/MS on 45 windows with 0.5 Da overlap (200–2000 Da) at 30 k with a NCE setting of 27. Data was searched using DIA-NN (1.8.1) against the Uniprot Human database using the default setting for library-free search. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE [1] partner repository with the dataset identifier PXD046984.
H3K27Me3 ChIP Sequencing analyses
Samples for chromatin immunoprecipitation were prepared using an iDeal ChIP-seq Kit for Transcription Factors (Diagenode, Belgium) and according to manufacturer’s instructions. Briefly, 3 x 106 cells (MCF7 shControl and shSTARD7#2) were fixed by directly adding the crosslinking reagent to the medium on the cell culture plate. After 15 minutes of fixation at room temperature, the reaction was stopped with Glycine. Cells were washed with PBS on ice and scrapped in the lysis buffer (1 x 106 cells /mL). After subsequent lysis steps, samples were immediately subjected to chromatin shearing using Bioraptor Plus (Diagenode) for 20 cycles (30 seconds “ON”, 30 seconds “OFF”) each at High power setting. ChIP of H3K27Me3 (Cell Signaling Technology (C36B11) Rabbit mAb #9733) was conducted on sheared protein from three independent experiments using the magnetic beads system. After elution, de-crosslinking and DNA purification, the library for sequencing was prepared. Next-generation sequencing was performed on all immunoprecipitated DNA samples and their respective inputs, with a depth of 50 mln clusters per sample. For data analysis, clean reads were aligned to the hg38 human genome using Bowtie2 version 2.4.4 and SAMtools version 1.13 was used to index and sort binary alignment map (BAM) files 19,20. Heatmaps were generated using the deepTools2 plotHeatmap function 21. Peak calling was performed for all samples using MACS2 version 2.2.7.1 22 with the following parameter: callpeak -t file_merged.bam -c file_inp.sorted.bam -f BAMPE -g hs -n file_merged --broad --outdir peaks; peaks were annotated, and pathway analysis performed using ChIPseeker and clusterProfiler, respectively 23,24 in R v4 1.2 (http://www.r-project.org/foundation/).
FACS analyses
For the analysis of the lysosomal compartment, a cell-permeable fluorescent dye LysoTracker Red DND-99 (Invitrogen) was used. On day 5 post transduction, cells were washed with PBS, and detached from a 6 well culture plate using trypsin-EDTA solution. Trypsin was inactivated by the addition of a culture medium with FBS. Cells were spinned down and suspended in a full culture medium containing Lysotracker dye in final concentration of 100 nM and incubated at 37°C for 30 minutes. Afterwards, cells were centrifuged and suspended in PBS for the analysis on the FACS Fortessa (BD). Analysis was performed using an excitation laser 561 nm and fluorescence was collected on the PE channel. Data was analysed using the FlowJo software.
Statistical Analysis
For all analyses in which three groups were compared (sh Control, sh STARD7#2 and sh STARD7#4), statistical significance was measured by one-way ANOVA for repeated measures, using the Dunnett’s multiple comparison test, unless stated otherwise. When only two groups were compared (sh Control, sh STARD7#2), a student’s t-test was employed. All analyses were done using the Prism software. Significance: * = p < 0.05, ** = p < 0.01, *** = p < 0.001, **** = p < 0.0001.