Cell culture and transfections
Human HCT116, HeLa, 293T and U2OS cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, Euroclone) high glucose supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific), 2 mM glutamine (Thermo Fisher Scientific) and 40 µg/ml gentamicin. All cell lines were cultured at 37°C, in a humidified atmosphere with 5% CO2. Mycoplasma contamination was periodically tested by RT–PCR analysis, using the following primers:
Forward: 5’ - ACT CCT ACG GGA GGC AGC AGT A − 3’
Reverse: 5’ - TCG ACC ATC TGT CAC TCT GTT AAC − 3’
Transfection experiments were carried out by using Lipofectamine 3000 Transfection System (Thermo Fisher Scientific) following the manufacturer's instructions. Cells were analysed 48 h after transfection by western blot (WB) or immunofluorescence. Cell number and viability were assessed by Trypan Blue staining using Countess automated cell counter (Thermo Fisher Scientific).
Recombinant plasmids and reagents
Myc-Che-1 has already been described (11, 26). pCI-HDAC 1 was a kind gift from Dr. Sartorelli, while pSG5 Large T (pSG5 SV40 LT) plasmid was a gift from William Hahn (Addgene plasmid #9053; http://n2t.net/addgene:9053; RRID: Addgene_9053). Myc-Che-1 3S and pSG5 SV40 LT 3S were generated by in vitro mutagenesis using the QuikChange site-directed Mutagenesis system (Agilent Technologies) following the manufacturer’s instructions. PCR reactions were achieved using the following primers:
Myc- Che-1 3S:
Forward 5’ - GCCCAATGCGGGAGGTGAGGAGATTGCTGGTGAAGATGATGAGC − 3’
Reverse 5’ - GCTCATCATCTTCACCAGCAATCTCCTCACCTCCCGCATTGGGC − 3’
pSG5 SV 40 LT 3S:
Forward 5’ - AACCTGTTTTGCGCAGAAGAAATGCCAGCTGGTGATGATGAGGCT − 3’
Reverse 5’ - AGCCTCATCATCACCAGCTGGCATTTCTTCTGCGCAAAACAGGTT − 3’
All mutations were confirmed by sequencing realized by Eurofins Genomics.
Stealth siRNA oligonucleotides targeting Che-1 (siChe-1), CSNK2A (siCK2), control sequence (siControl) and custom Che-1 3’UTR (sense 5’-CCCGCCUUUAAACGCCACAAAUAAA-3’; antisense 5’-UUUAUUUGUGGCGUUUAAAGGCGGG-3’) were purchased from Thermo Fisher Scientific. TBB (4,5,6,7 – Tetrabromobenzotriazole) was purchased from SelleckChem. Casein kinase II (CK2 - P60105) recombinant protein and Adenosine 5’-triphosphate (ATP - P07565) were purchased from New England BioLabs.
Cell extracts, immunoprecipitation and RNA isolation
Total, cytoplasmic and nuclear extracts were prepared as previously described (12, 27, 28). For immunoprecipitation (IP) experiments, nuclear extracts were resuspended in dilution buffer (50 mM TRIS pH 7.4, 150 mM NaCl, 5 mM EDTA, 10 mM NaF, 0.5% NP40, protease and phosphatase inhibitors). Dynabeads magnetic beads (Thermo Fisher Scientific) were incubated for 1 h at room temperature on a rotating wheel with the indicated antibodies. Nuclear extracts were then added to the beads and the incubation was continued for 2 additional hours. Immuno-complexes were purified by using a magnet (DynaMag-2, Thermo Fisher Scientific), the beads were washed five times with dilution buffer and eluted in 4X lithium dodecyl sulphate (LDS) sample buffer (Thermo Fisher Scientific) for WB analysis. Detailed information for all antibodies is provided in Supplementary Table S1. Total RNA was isolated from cells using EuroGOLD TriFast reagent (Euroclone) according to the manufacturer's instructions. The amount of RNA was measured by using NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific).
Western blot analysis
Samples were prepared as previously described (27), resolved on Bolt pre-cast 4–12% gels (Thermo Fisher Scientific), run using Bolt MES SDS running buffer (Thermo Fisher Scientific) and transferred onto nitrocellulose membranes. After a blocking step in 5% non fat-dried milk in phosphate-buffered saline (PBS)-0.1% Tween, membranes were incubated with primary antibodies overnight at 4°C. After three washes in PBS − 0.1% Tween, membranes were incubated with the appropriate HRP-linked secondary antibodies (Bio-Rad Laboratories) for 45 min at room temperature, washed with PBS-0.1% Tween and analysed by chemi-luminescence (GE Healthcare Life Science). Images were acquired and quantified using Alliance Mini HD6 system by UVITEC Ltd, Cambridge, equipped with UVI1D Software (UVITEC, 14–630275). Detailed information for all antibodies is provided in the Supplementary Table S1.
Immunofluorescence
Detection of both heterochromatic foci and chromatin modifications was performed as described in Bruno et al. (14). Briefly, HCT116 cells were grown on cover-lips, washed twice in PBS, fixed in 100% methanol for 5 min and then permeabilized for one hour with 1% BSA, 10% normal goat serum, 0.3 M glycine in 0.1% PBS-Tween. Cells were incubated with anti-H3K9me3 overnight at 4°C and stained 45 min with Alexa-Fluor-594-conjugated anti-rabbit secondary antibody (Thermo Fisher Scientific). For anti-Myc tag and anti-Che-1 immunofluorescences, cells were fixed in 4% formaldehyde for 10 min and then permeabilized with PBS − 0.2% Triton X-100 for 5 min at room temperature. Cells were stained for two hours with the primary antibody, rinsed three times with PBS and stained respectively with Alexa-Fluor-594-conjugated anti-mouse or with Alexa-Fluor-488-conjugated anti-rabbit secondary antibodies (Thermo Fisher Scientific) 45 min at room temperature. Nuclei were visualized by staining with 1 µg/ml Hoechst dye 33258 (Sigma-Aldrich) for 10 min. Images were acquired using a fluorescence microscope with a 40X objective (Zeiss, Germany) and processed with AxioVision 4.7.1 software.
In vitro kinase assay
GST-Che-1 fusion protein was cloned into pGEX-4T-3 vector as already described (12). For in vitro kinase assay, GST-Che-1 was incubated with or without CK2 constitutively active for 1 h at 30°C in slowly rotation on a rotating wheel in CK2 Reaction buffer (New England Biolabs) in presence of 200 µM ATP. Adding 4X LDS stopped reactions and the proteins were resolved by Bolt pre-cast 4–12% gels. The gel was stained with SimplyBlue SafeStain (Thermo Fisher Scientific) for three hours at room temperature, and bands of interest were cut and then analysed by Nano - LC Mass spectrometry (MS).
Nano - LC Mass spectrometry
After kinase assay the bands of interest were cut from the gel, de-stained, reduced, alkylated and digested with trypsin following the procedure described by Shevchenko et al. (29). The analysis of tryptic peptides was carried out by mean of nano-HPLC-MS/MS using an Ultimate 3000 nano-HPLC system and the obtained data were processed using an in-house software. The peptide pellets were re-suspended immediately before analysis and firstly loaded, from the sample loop, onto a trapping column (Acclaim PepMap C18; 2 cm × 100 µm × 5 µm, 100 Å- Thermo Fisher Scientific) using the loading eluents composition (95 − 5% ACN/H2O + 0.05% trifluoroacetic acid). The separation of peptides was performed at the flow rate of 300 nL/min and at a temperature of 35°C using an Easy spray column (15 cm x75 µm PepMap C18 3 µm, Thermo Fisher Scientific). A linear gradient of solution B (95 − 5% ACN/H2O + 0.08% formic acid) from 4–95% in 55 min was applied. All the analyses were performed in the positive ion mode. Single MS survey scans were performed in the Orbitrap, recording a mass window between 395 and 2000 m/z using a maximal ion injection time of 100 ms. The resolution was set to 70,000 and the automatic gain control was set to 3x106 ions. The experiments were performed in data-dependent acquisition mode with alternating MS and MS/MS experiments. For MS/MS analysis an isolation window of 2Da was used. CID was done with a target value of 5000 ions, a maximal ion injection time of 50ms, normalized collision energy of 35%. Raw MS files were processed with the Thermo Scientific Proteome Discoverer software version 1.4. Peak list files were obtained by the SEQUEST search engine against the Human protein database containing both forward and reversed protein sequences. The resulting peptide hits were filtered for a maximum 1% FDR (false discovery rate) using the percolator tool. The database search parameters were: mass tolerance precursor 20ppm, mass tolerance fragment CID 0.8Da, dynamic modification of deamidation (N, Q), oxidation (M) and static modification of alkylation with IAM (C). Phosphorylation of Ser were set as variable modifications. The software phosphoRS was used to validate the correct assignment of the phosphorylation sites. In any case, the option trypsin with two missed cleavages was selected (30).
Identification by nano–HPLC–ESI-MS/MS
The data obtained by the HPLC separation and MS/MS analyses, carried out on digested samples, were submitted to the SEQUEST search engine against Uniprot Human protein database using the phosphoRS tool. This approach allowed the specific identification of Tau-F of Apoptosis-antagonizing transcription factor (AATF/Che-1). Fifty-three high confidence peptides, corresponding to sequence coverage of 65.36% and high sequest score of 2391.39, were identified. From the MS/MS analysis it was possible to identify four phosphopeptides derived from Che-1, three of which were unambiguously assigned as phosphopeptides (Table 1). In a few cases it was not possible to assign the phosphate to specific serine residue(s), thus hindering the precise localization of the phospho-residue(s). The analysis of peptides obtained from Che-1 protein untreated allowed the identification fifty-four high confidence peptides corresponding to sequence coverage of 64.64% and high sequest score of 2082.81. As expected no phosphopeptides were found in this sample.
2D Gel electrophoresis
For 2D-Gel, cell pellets were resuspended in 2-D lysis buffer (2 M thiourea, 7 M urea, 4% CHAPS, 1% DTT, protease inhibitors cocktail) and sonicated. Total extracts were treated, where indicated, with Lambda Protein Phosphatase (ʎ-PP) (New England BioLabs) following the protocol described in Yagamata et al., with minor modifications (31). In short, cells pellets were re-suspended and 20 mM MnCl2 was added to 150 µg of protein extract in order to obtain a final concentration of 2 mM ʎ-PP buffer and brought to a final volume of 20 µl with deionized water. The mixture was divided into two aliquots and 200 units of ʎ-PP were added to one of the aliquots. After mixing, aliquots were incubated overnight at 30°C under constant shaking and subsequently 100 µl of 2-D lysis buffer was added togheter with 1% sulfobetaine SB 4–7.
Isoelectric focusing was performed using 70 mm 4.0–7.0 linear Immobilized pH Gradient gel strips (IPG strips) (Bio-Rad Laboratories) on an electrophoresis unit (Ettan IPGphor 3; GE Healthcare Life Science). Equal amounts of proteins (70 µg) were loaded by passive in-gel rehydration for 12 hours then run as follows: 1 hour at 50 V, 30 min at 200 V, voltage gradient 30 min up to 1,000 V, 20 min at 1,000 V, voltage gradient 30 min up to 5,000 V and 1hour at 5,000 V. Before performing the 2nd electrophoresis dimension, IPG strips were equilibrated for 15 min at room temperature in 1% DTT to reduce the proteins, and sulfhydryl groups were subsequently derivatized using 4% iodoacetamide (both solutions were prepared in 50 mM Tris, pH 8.8, 6 M urea, 30% glycerol, 2% SDS, and 2% bromophenol blue) for 15 min. Strips were transferred to 1.0-mm-thick 4–12% pre-casted polyacrylamide mini-gels (Thermo Fisher Scientific) for the 2nd electrophoresis dimension and then gels were run at 130 V for 2 h. 2D gels were then transferred onto PVDF filters.
In vitro GST pull down assay
Full length H3 open reading frame was cloned into EcoRI/XhoI sites of pGEX-4T-1 in order to generate GST-H3 fusion protein. GST-H3 or GST control proteins were prepared following standard procedures and used for in vitro binding assay. Briefly, GST proteins were pre-incubated with Che-1 308–325, Che-1 3S or control peptides (Biomatik Corporation) for 1 h at 4°C on a rotating wheel in interaction buffer (20 mM Tris pH 7.9, 300 mM NaCl, 0.2 mM EDTA, 0.1% NP40, 10 µg/ml BSA). Total extracts from HCT116 cells over-expressing pCI-HDAC 1 were then added to the GST/peptides complexes and the incubation was continued for three additional hours. Samples were eluted in 4X LDS sample buffer by heating for 10 min at 70°C and then subjected to WB analysis. Peptides sequence commercially synthesized are:
Control: LKGAKPIRPVVVKAPPA
Che-1 308–325: DGTKPNAGSEEISSEDDEL
Che-1 3S: DGTKPNAGAEEIAAEDDEL
Micrococcal nuclease assay
Micrococcal nuclease (MNase) assay was performed using the protocol described in Zaret et al. (32). Briefly, HCT116 cells were seeded in 100mm plate and transiently transfected with Myc-Che-1 wt, Myc-Che-1 3S or empty vector. 24 h post transfection cells were subjected to the protocol described in Bruno et al. (14).
Quantification and Statistical Analysis
Data are presented as the mean of three independent experiments ± standard deviation (SD). Statistical analyses were performed using R software. Two-tailed Student's t-tests with Benjamini–Hochberg correction were performed to compare one parameter between two groups. For the multiple group comparison, one-way ANOVA with Tukey HSD test was used. P < 0.05 was considered significant.
Statistical significance is indicated by asterisks as follows: *P < 0.05, **P < 0.01, ***P < 0.005, ****P < 0.001, n.s. = not significant.