Experimental animals.
Animal experiments were conducted in accordance with the ARRIVE guidelines and approved by the Dutch Central Committee for Animal Experimentation and the Animal Ethical Committee of the University of Groningen (permit number IVD199001-02-002). ATPIF-1 KO mice were generated as previously described (13). These mice, along with their WT littermates, were maintained under standard conditions with ad libitum access to food and water and monitored weekly. In vivo procedures were conducted under continuous isoflurane anesthesia (2%, TEVA Pharmachemie, Haarlem, The Netherlands). Sample sizes for both WT and ATPIF-1 KO groups were determined through power analysis for infarct size and mitochondrial Ca2+ retention capacity, with 11 animals per group for infarct size and 6 animals per group for mitochondrial Ca2+ retention capacity, assuming a desired power of 0.8 and an alpha level of 0.05. Animals were randomly allocated to experimental groups by investigators who were blinded to ensure unbiased assignment.
Myocardial infarction induced by I/R injury.
In vivo I/R injury was performed according to Booij et al. (14). In brief, 8 to 12-week-old mice underwent a 45-minute ligation of the left anterior descending (LAD) coronary artery, followed by 48 hours of reperfusion. The untied suture was left for later ex vivo cardiac blue staining.
MI induced by permanent ligation of the LAC.
In vivo, permanent ligation of the LCA was performed under identical surgical conditions as the I/R injury model, with the exception that tied sutures were retained for 5 weeks. At this time, the animals were sacrificed to evaluate chronic cardiac remodeling.
Echocardiography.
Transaortic echocardiography was performed at baseline and 24 hours after I/R surgery and at 5 weeks after PL surgery using a Vevo imaging station (FUJIFILM VisualSonics, Toronto, Canada) as previously described (15). Briefly, animals were anesthetized and placed in supine position in a heating pad. Parasternal LV short-axis M-mode recordings were obtained at the mid-papillary level and used to determine heart rate, cardiac output, LV end-diastolic internal diameter, anterior wall thickness, posterior wall thickness, and fractional shortening. Long-axis B-mode recordings were used to determine global longitudinal strain (GLS). Images deemed of insufficient quality were excluded from the analysis. The data were processed and analyzed in the Vevo Lab 3.2.6 software (FUJIFILM VisualSonics).
Phthalo blue preparation and combined Phthalo blue and Triphenyltetrazolium chloride (TTC) cardiac staining.
A 10% solution of Copper(II) Phthalocyanine (Phthalo Blue) (Sigma Aldrich, Cat number: 252980) was prepared following the method described by Bohl et al. (16) with some modifications. In brief, 10% Phthalo Blue was dispersed in 25 mL of NaCl 0.9% solution supplemented with 1 mL of Tween80. The stain was visually monitored under a microscope after vigorous mixing and decanting for 1 to 2 hours. Additional Tween80 was added if aggregates were observed in the solution. Cardiac ex vivo staining was conducted following the method described by Bohl et al. (16). Briefly, hearts were excised and cannulated with a blunt needle. After priming with a saline solution, the loose suture placed during I/R injury was re-ligated. Subsequently, the Phthalo blue staining solution was injected until the heart became uniformly blue. Following staining, hearts were frozen and sliced into 5 sections with a thickness of 1 mm using surgical blades in a 3D slicing mold. Each slice was then incubated in 1% TTC (Sigma Aldrich, Cat number: T8877) in phosphate saline buffer for 15 minutes at 37°C. Finally, cardiac slices were incubated in 4% paraformaldehyde at room temperature for 1 hour and subsequently weighed.
Determination of remote area, area at risk, and necrotic area.
The cardiac slices were photographed using a digital camera to capture both sides of each slice, distinguishing the ischemic in red, the infarcted area in white, and the remote area in blue. Subsequently, the total area of the slice, excluding the lumen of the right and left ventricle, was manually selected and stored in the ROI manager utilizing the ImageJ software. Then, the summary red and white areas (representing the areas at risk) were selected and stored in the ROI manager, followed by the selection of the white area alone, representing the infarcted area. This process was repeated for both sides of the slice, and the total area, area at risk, and infarcted area were averaged using data from both sides of the slide. Afterwards, the averaged areas were corrected for the weight of the slice. Area at risk below 15% were excluded from the analysis.
Histological processing, embedding, and deparaffinization.
Standard histological procedures were carried out following the protocol outlined in Booij et al. (14). In brief, transverse mid-papillary slices of the heart were fixed overnight in 10% paraformaldehyde (Klinipath, Duiven, The Netherlands). Subsequently, they were dehydrated and infiltrated with histological paraffin wax (Klinipath) using a Leica TP1020 automated tissue processor (Leica Microsystems, Wetzlar, Germany). Tissue specimens were then embedded in histological paraffin and sectioned into 4-µm thick slices using a Leica RM2255 microtome (Leica Microsystems). Prior to tissue staining, slides underwent deparaffinization by overnight heating at 60°C, followed by sequential incubations in xylene and ethanol dilutions.
Quantification of cardiac fibrosis.
Deparaffinized tissues underwent staining with Masson's trichrome stain to assess collagen deposition (stained in blue). Whole tissue image acquisition was conducted using the NanoZoomer 2.0-HT digital slide scanner. The percentage of fibrosis was determined utilizing the positive Pixel Count v9 algorithm of Aperio’s ImageScope 12.4.0 software (Leica Microsystems), employing default settings with a hue value of 0.66 and a hue width of 0.2.
Determination of cardiomyocyte cross-sectional area.
Cardiomyocyte cross-sectional area was determined by staining the deparaffinized tissues with fluorescein isothiocyanate (FITC)-conjugated wheat germ agglutinin (WGA) and 4’,6-diamidino-2-phenylindole (DAPI). Imaging of the fluorescent signals was conducted using a Leica AF6000 fluorescent imaging system (Leica Microsystems, Wetzlar, Germany), and the cell area was quantified using ImageJ.
Mitochondrial isolation.
According to Nijholt et al. (17), fresh cardiac mitochondrial isolation was carried out. In brief, hearts were kept on ice in 0.9% KCL directly after sacrifice and cut into smaller pieces in medium A (220 mM mannitol, 70 mM sucrose, 5 mM TES, 0.1 mM EGTA, pH 7.3 at 4°C with 1N KOH) with added proteinase (P8038, Sigma-Aldrich) for five minutes. Subsequently, 20 mL of medium A supplemented with 1 mg/mL bovine serum albumin was introduced, and the contents were transferred to a Potter-Elvehjem homogenizer for complete homogenization. Next, 3 centrifugation steps were conducted at 4°C for 10 minutes, resulting in a mitochondrial pellet. The pellet was finally resuspended in 150 to 300 µL of medium A and stored at 4°C for subsequent use.
Mitochondrial Ca 2+ retention capacity.
Mitochondrial Ca2+ retention capacity was assessed according to Maxwell et al. (18). In summary, 200 µg of freshly isolated mitochondria were incubated in 197 µL of KCL buffer (composed of 125 mM KCl, 20 mM HEPES, 1 mM KH2PO4, 2 mM MgCl2, 40 µM EGTA, pH adjusted to 7.2 with KOH), along with 1 µL of 1 M pyruvate, 1 µL of 500 mM malate and 1 µL of 1 mM calcium green-5N (a non-permeant fluorescent Ca2+ sensor, Thermo Fischer). Additionally, either 1 µM cyclosporine A (CsA, Merck KGaA, Darmstadt, Germany) or 10 µM ru360 (Sigma-Aldrich) was included to respectively inhibit the opening of the mPTP or the mitochondrial Ca2+ uniporter. Fluorescence intensity was monitored using the Biotech Synergy H1 plate reader (Agilent Technologies, Santa Clara, CA, USA), while automated injectors delivered 6x 1 mM and 8x 1.2 mM CaCl2. mPTP opening was defined as the rise in fluorescence intensity during the decay phase of the curve, indicative of mitochondrial Ca2+ release.
RNA isolation, reverse transcription, and quantitative PCR.
Frozen left ventricular (LV) samples underwent pulverization at -60°C and subsequent homogenization utilizing a Tissuelyser LT (Qiagen N.V., Hilden, Germany) in 1 mL of TRI Reagent solution (Thermo Fischer Scientific). mRNA extraction followed standard protocols, with quantification performed using a NanoDrop spectrophotometer (Thermo Fischer Scientific). Synthesis of cDNA was achieved employing the QuantiTect RT kit (Qiagen) according to the manufacturer’s instructions. Atpif-1 (Forward: 5’ GGAGCCTTCGGAAAACGAGA 3’; Reverse: 5’ ATGGTGTTTCCTCAGGGCAG 3’) and Nppa (Forward: 5’ GCTTCCAGGCCATATTGGAG 3’; Reverse: 5’ GGTGGTCTAGCAGGTTCTTG 3’) were designed utilizing Primer-Blast software (NCBI, Bethesda, MD, USA) and internally validated. Quantitative PCR (qPCR) was conducted employing the SYBR® Green Master Mix (Bio-Rad, Hercules, CA, USA) in the CFX384 Touch Real-Time PCR Detection System (Bio-Rad).
Statistical analysis.
All results were presented as mean ± SE derived from a minimum of three independent assays. For data with normal distribution and equal variances, a two-sided t-test or one-way ANOVA followed by the Tukey post-hoc test or mixed-effects analysis were employed for multiple comparisons. Conversely, non-normally distributed data were analyzed using the U Mann-Whitney test or the Kruskal–Wallis test, followed by the Dunn post-hoc test for multiple comparisons. Statistical significance was established at p < 0.05. Data analysis and visualization were performed using GraphPad Prism 9 software (GraphPad Software Inc., San Diego, CA, United States).