Database analysis
The mRNA expression profiles and clinical data of 510 LUAD samples and 58 normal samples were downloaded from TCGA database. The expression of NMES1 between LUAD and normal tissue was analyzed using R software. According to the NMES1 expression level, LUAD patients were divided into the high expression group and the low expression group. Then, the survival curve was painted using the Kaplan–Meier method. Besides, the relationship between the immune cell expression and two groups was also analyzed. Genes associated with NMES1 were excavated using the online String database. The Database for Annotation Visualization and Integrated Discovery (DAVID) was utilized to investigate the function of these genes.
Clinical specimens
LUAD tissues were collected, and adjacent normal tissues from patients who had been pathologically diagnosed from the department of thoracic surgery, Second Hospital of Shandong university (Jinan, China) were paired. Patients who received chemotherapy or radiotherapy were excluded. Among these patients, 14 pairs of LUAD specimens and normal specimens were used to detect the mRNA level of NMES1 with the help of real-time PCR. Then, 5 pairs of LUAD cancer tissues and adjacent tissues were chosen to examine the protein level of NMES1 by western blot. Additionally, immunohistochemical analysis was also carried out to evaluate NMES1 protein expression and localization.
Cell culture
The human LUAD cell lines A549, H1299 and the normal lung cell line HBE were purchased from Procell Life Science & Technology Co. Ltd. (Wuhan, China). A549 and H1299 cell lines were cultured in RPMI-1640 medium, and HBE cells were cultivated in DMEM medium. The medium contained 10% FBS and 1% penicillin and streptomycin. All the cells were fostered in a humidified cell culture incubator at 37°C with 5% CO2.
siRNA transfection
The siRNA target sequences designed by GenePharma (Shanghai) to silence NMES1 mRNA were the followings:
NMES1 siRNA1(5′-3′): CUUCGCUGUAUUCUCUTT; AGAGAAUACACAGCGAAAGTT.
NMES1 siRNA2(5′-3′): CAAUCAACCAACAAUGGAATT; UUCCAUUGUUGGUUGAUUGTT
Negative control siRNA (5′-3′): UUCUCCGAACGUGUCACGUTT; ACCUGACACGUUCGGAGAATT.
The transfection efficiency was evaluated using qRT-PCR and western blot.
qRT-PCR
Trizol (AG) was used to extract the total RNA from cells, and cDNA was synthesized by ReverTra Ace qPCR RT Master Mix (TOYOBO). Real-time PCR was conducted with SYBR Green Fast qPCR Mix (Abclonal) in accordance with the protocol on a Real-Time PCR System. GADPH was viewed as endogenous control, and the expression levels was calculated utilizing the 2–ΔΔCT method. The primer sequences used for PCR are shown in Table 1.
Table 1
Primer sequences for PCR are as follows:
Primer | Sequences (5′-3′) |
---|
NMES1-F | GGTTCAAATGTATTTTTCTCCCAT |
NMES1-R | TTTGGGCTCTGGATAAGGAAT |
GPX4-F | CAGTGAGGCAAGACCGAAGT |
GPX4-R | CCGAACTGGTTACACGGGAA |
ACSL4-F | AATACCTGGACTGGGACCGA |
ACSL4-R | GCTGGACTGGTCAGAGAGTG |
BCL2-F | GTGAACTGGGGGAGGATTGT |
BCL2-R | GCCCAGACTCACATCACCAAG |
BAX-F | GAGGTCTTTTTCCGAGTGGCA |
BAX-R | GGCAAAGTAGAAAAGGGCGAC |
GADPH-F | GCACCGTCAAGGCTGGAAC |
GADPH-R | TGGTGAAGACGCCAGTGGA |
Western blot
Cells (HBE, A549 and H1299) were cultured in 6-well plates, lysed with RIPA buffer containing 1% PMSF, and their total protein concentration was quantified using a BCA Kit. The proteins were then denatured at 100°C for 5 min. Subsequently, 20 µg of each protein sample was loaded onto 10% SDS-PAGE gels and electrophoresed for 60 min. Next, gels having undergone constant current of 200 mA for 90 min were transformed into 0.45µm PVDF membranes. Following blocking with non-fat milk at room temperature for 1 h, the membrane was incubated with primary antibodies [anti-NMES1(1:1000, rabbit. biomatik), anti-pPI3K (1:1000, rabbit. Affinity), anti-pAKT (1:1000, rabbit. Affinity), anti-PI3K (1:1000, rabbit. Cohesion), anti-AKT (1:1000, rabbit. Cohesion), anti-GPX4 (1:1000, rabbit. ABclonal), and anti-β-actin (1:1000, mouse. ABclonal)] at 4°C overnight and was then washed three times. Finally, the membrane was placed in the secondary antibody for 60 min, and the protein bands were captured using the ECL solution.
Immunohistochemical analysis
Tissue samples were paraffin-embedded and sliced into 5 µm sections. These sections were incubated overnight at 4°C with NMES1 antibody (1:1000). The next day, secondary antibody was applied at room temperature for 30 min. Hematoxylin was used to counterstain the nuclei, followed by dehydration. Finally, visualization and photography were conducted under a microscope.
Wound-healing assay
Firstly, A549 and H1299 cells with or without NMES1 knockdown were added into 6-well plates. When the cells were maintained at 37°C for 24h, 200-µL pipette tips were employed to scrape the cells. Next, cells were continued to be cultured in fresh RPMI-1640 medium, and pictures were captured at 0 and 24h.
CCK8 assay
A549 and H1299 were seeded in 96-well plates with a density of 2×104 cells/well for 24h. Then, siRNA was transfected into these cells. Cell Counting Kit-8 (CCK8) was added into each well at 24, 48, 72 and 96h. The OD value was evaluated at 450 nm after incubating for one additional hour.
Transwell assay
An 8-µm pore size chamber was inserted into a 24-well culture plate, dividing it into upper and lower chambers. To assess cell migration, serum-starved cells (1×105 cells/well) were seeded in the upper chamber with serum-free medium, while 10% FBS-containing medium was added to the lower chamber. After 24 h, cells in the lower chamber were fixed in 4% paraformaldehyde and stained with crystal violet for 10 min. Visualization was conducted using a microscope.
Cell cycle assay
Treated cells were collected, washed with PBS, and fixed in 70% ethanol at 4°C for 1 h. After RNase treatment and a 30-minute incubation at 37°C, propidium iodide was added and cells were incubated in the dark. Cell cycle analysis was then conducted using a flow cytometer.
Mitochondrial membrane potential detection
As a fluorescent probe, the change of JC-1 from red to green fluorescence indicated a decrease in mitochondrial membrane potential. Cells were planted in 6-well plates the day before. JC-1 dye working fluid was added into wells for 20 min at 37°C followed by 3 washes with JC-1 dye buffer. Flow cytometer and confocal microscopy were used to detect mitochondrial membrane potential, respectively.
Reactive oxygen species (ROS) assay
Reactive Oxygen Species Assay Kit (Beyotime, China) was used to detect the reactive oxygen species (ROS) level of cells. A549 and H1299 cells were cultured in 15mm petri dish. Cells were treated with probe DCFH-DA at 37°C for 20 minutes and then washed with PBS. The fluorescence intensities of DCF were measured using excitation at 488 nm and emission at 525 nm to quantify ROS levels.
Intracellular Fe2+ content assay
A549 and H1299 cells, with or without NMES1 knockdown, were seeded into 15 mm petri dishes 24h prior to treatment. Fe2+ fluorescence probe was loaded into dishes, followed by incubating in 37°C for 1h and washing with PBS for 3 times. Finally, fluorescence was detected using confocal microscopy.
Apoptosis assay
Cells were collected post-treatment with transfection, washed with PBS, and incubated with an Annexin V-FITC/PI Apoptosis Detection Kit according to the manufacturer’s protocols. Subsequently, flow cytometric analysis was conducted to assess cell apoptosis.
Lentivirus transfection and xenograft tumor model
Lentiviruses provided by Shanghai GeneChem were used for transfection. Stable A549 cell lines were generated by transfecting with lentiviruses at an MOI of 10 and culturing with puromycin (2 mg/ml) for one week. The transfection efficiency was validated through Western blotting. Five-week-old female nude mice were obtained from HFK Bio-Technology. The animal protocol was approved by Ethics Committee of the Second Hospital of Shandong University. Besides, 12 nude mice were randomly allocated to 2 groups. A549 cells (1×107cells) transfected with shNC or shNMES1 were injected into right underarm of mice (n = 6 mice each). Tumor size was measured every 5 days, and tumor volume was calculated using the following formula: volume = length × width2/2(mm3). Finally, the mice were killed, and the tumor tissue was stripped for HE and IHC.
Statements
All experiments were performed in accordance with relevant guidelines and regulations. All studies were performed under supervised and approved by Ethics Committee of the Second Hospital of Shandong University. Registration No. of the patient study and the animal study is “KYLL-2023(LW)077”. Informed consent was obtained from all subjects and/or their legal guardian(s). All methods are reported in accordance with ARRIVE guidelines (https://arriveguidelines.org) for the reporting of animal experiments.
Statistical analysis
GraphPad Prism software was applied for statistical analyzing and data mapping. The results of immunohistochemistry, wound healing and transwell assay were quantified using image J software. Every experiment was repeated for 3 times. Student’s t-test for significant differences or one-way ANOVA for multiple comparisons was used for data analysis. A p value less than 0.05 was considered statistically significant.