CRISPR/Cas9 was applied on C57BL/6N and CD1 (ICR) mice to generate knockout kat2-/- mice, and Taqman allelic discrimination was used to prove that the gene had been deleted. The emotional domain, including depression-like and anxiety-like behaviors, was evaluated with the modified forced swim test (FST), tail suspension test (TST), elevated plus maze (EPM), open field (OF) test, and light dark box (LDB) test; the cognitive domain was evaluated with the passive avoidance test (PAT); and the motor domain was evaluated with the OF test. Furthermore, the levels of Trp and its major metabolites, as well as enzyme activities in plasma and urine samples, were determined, and oxidative stress and excitotoxicity indices were calculated.
2.1. Ethical approval
The Department of Nature Conservation of the Ministry of Agriculture has authorized us to use genetically modified organisms in a closed system of the second security isolation level (TMF/43-20/2015). The import of genetically modified animals has been approved by the Department of Biodiversity and Gene Conservation of the Ministry of Agriculture (BGMF/37-5/2020). In accordance with the guidelines of the 8th Edition of the Guide for the Care and Use of Laboratory Animals, the Use of Animals in Research of the International Association for the Study of Pain, and the directive of the European Economic Community (86/609/ECC), the experiments conducted in this study received ethical approval from two committees. The Scientific Ethics Committee for Animal Research of the Protection of Animals Advisory Board (XI./95/2020) and the Committee of Animal Research at the University of Szeged (I-74-10/2019, I-74-1/2022) both approved the experiments. Furthermore, Directive 2010/63/EU on the protection of animals used for scientific purposes provides guidance for the ethical evaluation of animal use proposals. The directive allows individual institutions to make determinations based on the recommendations of their ethical review committees. These ethical guidelines and regulations ensure that the experiments conducted on animals adhere to the highest standards of animal welfare and scientific integrity. The approval from the Scientific Ethics Committee for Animal Research of the Protection of Animals Advisory Board and the Committee of Animal Research at the University of Szeged demonstrates that the study was conducted in compliance with these ethical principles and regulations.
2.2. Animals
C57BL/6N and CD1 (ICR) mice were purchased from Japan SLC, Inc. (Hamamatsu, Japan) and Charles River Laboratories International, Inc. (Yokohama, Japan), respectively, in order to generate kat2−/− mice utilizing the CRISPR/Cas9 technique. After genetic modifications, breeding, and transport from Japan to Hungary, the animals were housed in groups of 4-5 in polycarbonate cages (530 cm2 floor space) under pathogen-free conditions in the Animal House of the Department of Neurology, University of Szeged, maintained at 24 ± 1°C and 45–55% relative humidity under a 12:12-h light:dark cycle. Throughout the duration of the investigation, mice had unrestricted access to standard rodent food and water. Animal experiments were conducted humanely in accordance with the Regulations for Animal Experiments of Kyushu University and the Fundamental Guidelines for Proper Conduct of Animal Experiments and Related Activities in Academic Research Institutions governed by the Ministry of Education, Culture, Sports, Science, and Technology of Japan, and with the approval of the Institutional Animal Experiment Committees of Kyushu University. After the transport of the animals, the studies complied with the Ethical Codex of Animal Experiments, were approved by the Committee of the Animal Research of the University of Szeged (I-74-10/2019, I-74-1/2022), were authorized by the National Food Chain Safety Office with permission number XI./95/2020, and complied with the guidelines for the Use of Animals in Research of the International Association for the Study of Pain and the directive of the European Parliament (2010/63/EU).
The deletion was introduced into the KATs gene using the CRISPR/Cas9 method. The single guide RNAs (sgRNA) were selected using the CRISPRdirect software. Artificially synthesized the sgRNA were purchased from FASMAC (Atsugi, Japan). The Female C57BL/6N mice were injected with pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG) with a 48-h interval, and mated with male C57BL/6N mice. The fertilized one-cell embryos were collected from the oviducts. Then, 25 ng/µl of the sgRNA and 75 ng/µl Guide-it™ Recombinant Cas9 protein (TaKaRa, Japan) were injected into the cytoplasm of these one-cell-stage embryos. The injected two-cell embryos were then transferred into pseudopregnant ICR mice (Figure 2).
The kat2−/− mouse line expresses a carboxy-terminal truncated polypeptide consisting of the first 47 amino acids of the intact KAT II with a 2-nucleotide deletion (CCDS nucleotide sequence 32-33) in the mRNA.
2.3. DNA extraction and Sequencing
Genomic DNA of tails collected from mice was extracted using NucleoSpin Tissue (MACHEREY-NAGEL GmbH&Co, KG, Germany). Each targeted fragment around the sgRNA targeting site from the extracted genomic DNA as a part of the KATs genes was amplified with TAKARA Ex Taq (Takara Bio, Japan) and the 1st primers pair and subsequently with 2nd primers pair (Table 1). The polymerase chain reaction (PCR) product was purified with a Fast Gene Gel/PCR Extraction Kit (Nippon Genetics Co., Ltd., Tokyo, Japan), and the PCR products were purified by agarose gel electrophoresis and Monarch Gel Extraction Kit (NEW ENGLAND BioLabs Inc.). Then, the PCR products were sequenced with M-KAT II_2nd_R (Table 1).
Table 1. Properties of sgRNA, primers and KAT gene. sgRNA: single guide RNA; KAT: kynurenine aminotransferase; KAT II: aminoadipate aminotransferase; CCDS: Consensus Coding Sequence
Name of sgRNA
|
Sequence
|
M-KAT II-2
|
GTTCCTCACTGCAACGAGCCguuuuagagcuagaaauagcaaguuaaaaaaggcuaguccguuaucaacuugaaaaaguggcacggacucggugcuuuu
|
|
Name of primer
|
Sequence
|
M-KAT II_1st_F
|
CCCTCTGTGGATGGACTTTG
|
M-KAT II_1st _R
|
TTGAAAGATGTGCCTCATGC
|
M-KAT II_2nd_F
|
GGATGGACTTTGTCCCTTCT
|
M-KAT II_2nd_R
|
ATGTGCCTCATGCTTGGCCC
|
|
Name of KAT gene
|
Transcript ID
|
CCDS
|
CCDS Nucleotide Sequence
|
Aadat-201
|
ENSMUST00000079472.4
|
CCDS22320
|
32-33 (2 nucleotide deletion)
|
2.4. Western blotting
For Western blotting, tissue extracts from the liver (20 mg) of the knockout and wild-type (WT) mice were prepared by the Total Protein Extraction Kit for Animal Cultured Cells and Tissues (Invent Biotechnologies, Minnesota, USA) according to the manufacturer’s instructions. Subsequently, the tissue extracts were passed through Protein G HP SpinTrapTM (Cytiva, Buckinghamshire, UK) to remove immunoglobulin G. 14 µl of each sample were mixed with 7 µl of 3X SDS Blue Loading Buffer (New England BioLabs) and separated on a 12% SDS-polyacrylamide gel. Subsequently, the protein was transferred to the membranes. The membranes were blocked and incubated with anti-human KAT II rabbit polyclonal antibody (1:500, Invitrogen, Thermo Fisher Scientific, Massachusetts, USA) at room temperature for 2 h, followed by combination with alkaline phosphatase-labeled secondary goat anti-rabbit IgG FC antibody (1:10000, Sigma-Aldrich) at room temperature for 2 h, followed by visualization of dystrophin and utrophin using Western Blue® Stabilized Substrate for Alkaline Phosphatase (Promega, Madison, WI, USA).
2.5. Phenotype analysis with modified SHIRPA test
The RIKEN modified SHIRPA test was conducted to ascertain the comprehensive phenotypic traits of the mutant rodents. The assessment included the evaluation of diverse behaviors and physical attributes such as motion, bowel movements, urination, locomotor activity, startle response, tactile escape, pinna reflex, trunk curling, limb grasping, contact-righting reflex, grip strength, wire maneuver test, corneal reflex, toe pinching, and overall appearance. The animals were also monitored for vocalization, aggression, head bobbing, jumping, circling, retropulsion, grooming, and tail-wagging (Mandillo et al., 2008; Masuya et al., 2005).
2.6. Behavioral tests
8-week-old male C57BL/6N and kat2-/- mice (n=10-13) were tested. In order to make the results comparable, all behavioral experiments were performed between 8 a.m. and 12 p.m. The animals were transferred to the laboratory, where the measurements were made, one hour before the start of the experiment, thus they had time to acclimatize to the environmental conditions.
2.6.1. Modified forced swim test (FST)
The modified FST was performed as reported previously. The mice were placed individually in a glass cylinder of 12 cm in diameter and 30 cm in height. Water (25±1 °C) was filled to a height of 20 cm. Fresh water was used for each mouse. A 15-min pretest was carried out 24 hours before the 3-min test session. A time-sampling technique was conducted to count the duration of time spent with climbing, swimming, and immobility (Detke et al., 1995; Khisti et al., 2000).
2.6.2. Tail suspension test (TST)
The mice were placed in a 28x28x23.5 cm wooden box with three side walls and a clip hanging from the top of the box. The animals were suspended by their tails from the base to the middle two-thirds using a clip and allowed to hang for 6 minutes. We measure the duration of immobility. A cotton swab was pre-attached to the clip's interior to prevent the mice's tails from injuring or severely restricting blood circulation. If the animal is able to climb or falls off the clip, it is removed from the experiment and its results are discarded (Cryan et al., 2005; Steru et al., 1985).
2.6.3. Elevated plus maze (EPM) test
The animals were positioned in a plus-shaped apparatus with four arms measuring 35x10 cm. Two of the opposite arms are open, while the other two are closed, forming an angle of 90 degrees. The open arms have no side walls, while the closed arms have walls that are 20 cm tall. The entire apparatus is situated 50 cm off the ground. The device is surrounded by a screen that does not display any visual signals. The mouse was placed in the device's center with its nose facing an open arm and allow it to explore for 5 minutes. We measure the time spent in each part (open arms, closed arms, and central part). The experiment was captured on video using a camera and software (EthoVision XT14). Between each animal, the apparatus was disinfected with 70% ethanol and left exposed to the air for 5 minutes (Lister, 1987; Pellow et al., 1985).
2.6.4. Light Dark Box (LDB) test
The LDB apparatus is comprised of larger illuminated (2/3 of the box) and smaller dark (1/3 of the box) compartments that are connected by a 5x5 cm door. The length of time a mouse spent in the lighted compartment during the 5-minute session was determined 5 seconds after a mouse was placed in the bright area. After each session, the box was cleaned with 70% ethanol and allowed to air for 5 minutes (Costall et al., 1989; Onaivi and Martin, 1989; Pellow et al., 1985).
2.6.5. Passive avoidance test (PAT)
Each mouse was individually placed in a box containing two apparatuses with distinct lighting. The animals began in the bright compartment and had 5 minutes to pass through the 5x5 cm door into the dark, smaller portion of the box. As soon as the animals entered the dark compartment, they received a 0.3 mA electroshock through their paws, and the door shut. After 10 seconds, the animals were removed, and the experiment was repeated 24 hours later. Those animals that did not enter the dark area within 5 minutes during the pre-testing phase were omitted from the measurement. The box was cleaned with 70% ethanol and left to air for 5 minutes between mice (van der Poel, 1967).
2.6.6. Open field (OF) test
A standard table lamp illuminated the center of the 48x40 cm OF box, while the Conducta 1.0 system (Experimetria Ltd.) monitored the mouse's movements. Each mouse was placed individually in the center of the box. Ambulation distance, time spent in the center zone, and number of entries to the center zone were measured for 10 minutes. After each session, the box was wiped down with 70% ethanol and allowed to for 5 minutes (Stanford, 2007; Walsh and Cummins, 1976).
2.7. Ultra-high-performance liquid chromatography with tandem mass spectrometry
Trp and its metabolites were measured in plasma and urine using previously published protocols (Galla et al., 2021a; Galla et al., 2021b) using ultra-high performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS). Picolinic acid multiple reaction monitoring (MRM) showed a change from 124.0 to 106.0 over 1.21 minutes, with 75 V acting as the declustering potential and 13 V acting as the collision energy.
2.8. The enzyme activities of Trptophan (Trp) metabolism
The enzyme activities of each Trp metabolism were determined by dividing the concentration of the product by the concentration of the substrate.
2.9. Oxidative stress and excitotoxicity indices
The oxidative stress index was calculated as the ratios of putative prooxidant metabolite 3-HK concentrations to the sums of putative antioxidant metabolite concentrations (KYNA, AA, and XA) (1) (Juchnowicz et al., 2021; Polat et al., 2023; Sahin et al., 2019).
Oxidative stress index = [3-Hydroxykynurenine]/{[Kynurenic acid] + [Anthranilic acid] + [Xanthurenic acid]}
|
(1)
|
The excitotoxicity index is calculated by dividing the concentration of NMDA receptor agonist QA by that of NMDA receptor antagonist KYNA (2)(Barone, 2019; Globus et al., 1991; Savitz et al., 2015).
Excitotoxicity index = [Quinolinic acid]/[Kynurenic acid]
|
(2)
|
3.0. Statistical analysis
We used IBM SPSS Statistics 28.0.0.0 for the statistical analysis. The Shapiro–Wilk test was used to determine the distribution of data. In addition, we used a Q-Q plot to find out if two sets of data come from the same distribution. Our data followed a normal distribution. One-way ANOVA test was used to evaluate the results of the TST, OF, FST, and EPM followed by the Tamhane post hoc test. Values p <0.05 were considered statistically significant. Our data are reported as means ± SEM for all parameters and groups.