2.1 Target prediction of effective active ingredients
Using Epimedium as the keyword, the composition information of Epimedium was obtained by searching the TCMSP database, and the structural information of the components of Epimedium was obtained from the PubChem database. Next, the SwissTargetPrediction platform was searched to identify the target information required for the study.
2.2 Prediction of PH-related targets
The GeneCards database was used to search for PH-related target information with “pulmonary artery hypertension”, “pulmonary hypertension”, and “PH” as the search terms. The target information of TFE and PH was compared and analyzed, and it was determined that the intersection of the two was the target of TFE in the treatment of PH.
2.3 Protein-Protein Interaction (PPI) network construction
The target information obtained in the previous step was imported into the String platform. “Multiple Proteins” was selected, “Organism” was set to “Homo Sapiens” and the obtained information was imported into the Cytoscape version 3.8.2 tool to construct and analyze the network. Finally, the PPI relationship diagram required for the study was obtained, and the top five core targets by MCC score were calculated through the plug-in CytoHubba.
2.4 GO enrichment and KEGG pathway annotation analysis
R language software was used to analyze the co-targets of TFE and PH, and the bubble chart and bar chart required for GO and KEGG enrichment analysis were obtained. Finally, the corresponding original gene targets were obtained by conversion.
2.5 Reagents, instruments, and cell culture
The TFE used in this study was a gift from Jiangsu Kangyuan Pharmaceutical Co., Ltd. (the compound contained 55% TFE, the preparation method of TFE from Epimedium is in Supplementary file.), monocrotaline (MCT, MedChem Express (MCE), Cat. No. HY-0750), PDGF-BB, (MCE, Cat. No. HY-P7278), pifithrin-α (p53 inhibitor, Aladdin, Cat. No. BD389208), UC2288 (p21 inhibitor, MCE, Cat. No. HY-112780), aaptamine (p21 agonist, MCE, Cat. No. HY-N4225) and α-SMA were purchased from Abcam, and Bicinchoninic Acid (BCA) Protein Assay Kit (Cat. No.: KGP902), EDU Kit (KeyGen Biotech, Cat. No.: KGA331-100) and TUNEL Kit (KeyGen Biotech, Cat. No.: KGA7071) were obtained. For this study, a rat was connected to PowerLab using a ventilator (ALC-V8D; Shanghai Alcott Biotechnology Co., Ltd.), 1.4-F (rat) microtip pressure sensor catheter (Millar Instruments, Houston, TX, USA) and data acquisition system (AD Instruments, Sydney, Australia). According to the previous protocol of the laboratory, the distal pulmonary artery of the rat was isolated from anesthetized male Wistar rats, and the primary generation of rat pulmonary artery smooth muscle cells (PASMCs) was extracted. After the cells grew to 80–90% confluence with passage every 3–5 days, 4–8 passages of cells were used for subsequent experiments.[20]
2.6 Rat experiment design
Male SD rats (180–220 g, 6–8 weeks, healthy and energetic) were provided by the Guangdong Animal Experimental Center. The experiment was approved by the First Affiliated Hospital of Guangzhou Medical University (Ethics Review No.: 20211265).
In the first week, the rats were subjected to standard conditions of 23 ± 2°C and given free access to drinking water and food to allow them to adapt to the environmental conditions. The rats were randomly selected and divided into four groups: (1) control group; (2) MCT group; (3) MCT + low-dose TFE group (L-TFE 60 mg/kg); and (4) MCT + high-dose TFE group (H-TFE 180 mg/kg). On day 0, the MCT group and MCT + TFE groups were intraperitoneally injected with 50 mg/kg of MCT solution to induce PH, and the control group was injected with the same amount of normal saline. From day 1, the rats in the MCT + L-TFE group were given 60 mg/kg of TFE (0.5% carboxymethyl cellulose sodium to promote dissolution) at the same time every day, and the rats in the MCT + H-TFE group were given 180 mg/kg of TFE. The control group and MCT group were treated intragastrically with 0.5% sodium carboxymethyl cellulose solution. After four weeks of TFE treatment, samples were collected for further analysis.
2.7 Hemodynamic measurements
The rats were anesthetized with 3% sodium pentobarbital (30 mg kg− 1, i.p.). Right Ventricular Systolic Pressure (RVSP) was measured using a 1.4-F (rat) microtip pressure transducer catheter connected to the PowerLab data acquisition system. Right ventricular hypertrophy was assessed using the Fulton index (right ventricular weight/left ventricular plus septal weight [RV/LV + S]).
2.8 Lung histological evaluation
Left lungs were collected after hemodynamic measurements and fixed with 10% paraformaldehyde for 24 hours. After paraffin embedding, 5 µm thick sections were cut and stained with hematoxylin-eosin (HE). Pulmonary artery remodeling was assessed by observing pulmonary arteries with diameters of 50–150 µm under a 200× microscope.
2.9 Determination of optimal concentration of TFE
The CCK-8 method was used to determine the optimal concentration of TFE. When PASMCs were grown to 70–80% density, cells were starved for 24 hours in serum-free DMEM/F12 medium. TFE drug concentration gradients were set at 0, 0.06, 0.6, 6, 12, 24 and 48 µg/ml, then PDGF-BB 20 ng/ml (Follow the recommended doses in the instructions) was added to each group for 48 hours. 110 µl of complete medium containing 10 µl of CCK-8 solution was added to each well and the plate was placed in the incubator for 4 hours. The optimal dose-dependent inhibition of PDGF-BB PASMC proliferation was calculated by measuring the absorbance at 450 nm using a microplate reader.
2.10 Wound healing assay
When the cell density reached 90%, starvation was performed for 24 hours. A 200-mL pipette tip was used to draw a straight line on a six-well plate, and the cells were rinsed three times with PBS. The cell scratch area at 0 h was recorded by photography. The first part of the experiment was divided into the normal control group, PDGF-BB group, normal + TFE group and PDGF-BB + TFE group, and the second part of the experiment was divided into the PDGF-BB group, PDGF-BB + TFE group, PDGF-BB + TFE + p53 inhibitor group (pifithrin-α), PDGF-BB + TFE + P21 inhibitor group (UC2288) and PDGF-BB + TFE + p53 inhibitor (pifithrin-α) + P21 agonist group (aaptamine). After 48 hours of incubation at 37°C and 5% CO2, cell densities were again photographed and analyzed. Cell mobility was analyzed using Image J software = (0 hour scratch area − 48 hour scratch area)/0 hour scratch area.
2.11 Cell proliferation assay
When PASMCs were grown to 70–80% density, cells were starved in a serum-free DMEM/F12 medium for 24 hours. The first part of the experiment was divided into the normal control group, PDGF-BB group, normal control + TFE group and PDGF-BB + TFE group, and the second part of the experiment was divided into the PDGF-BB group, PDGF-BB + TFE group, PDGF-BB + TFE group + p53 inhibitor group, PDGF-BB + TFE + P21 inhibitor group and PDGF-BB + TFE + p53 inhibitor + P21 agonist group. Cells were treated in groups for 48 hours. The experiment was carried out according to the kit instructions; then the three areas were randomly photographed using a laser confocal microscope. The positive rate of EDU was calculated using Image J software = EDU positive/total number of cells.
2.12 Apoptosis assay
PASMCs were grown to 70% density and starved for 24 hours. The first part of the experiment was divided into the normal control group, PDGF-BB group, normal control + TFE group and PDGF-BB + TFE group, and the second part of the experiment was divided into the PDGF-BB group, PDGF-BB + TFE group, PDGF-BB + TFE group + p53 inhibitor group, PDGF-BB + TFE + p21 inhibitor group and PDGF-BB + TFE + p53 inhibitor + p21 agonist group. Cells were treated in groups for 48 hours, then nuclear DNA fragmentation during apoptosis was detected using a TUNEL kit. All the steps were carried out in accordance with the kit instructions. The ratio of TUNEL positive cells = TUNEL positive cells/total amount of cells was analyzed using Image J software.
2.13 qPCR
Total RNA was isolated from the lung tissues of control rats, MCT-PH rats, low-dose TFE-treated MCT-PH rats and high-dose TFE-treated MCT-PH rats using QIAzol lysis reagent (20874, QIAGEN Sciences, Maryland, USA), and quantified using a spectrophotometer (DeNovix DS-11, Wilmington, USA). Total RNA was reverse transcribed to cDNA using a PrimeScript™ RT Kit (RR047A, Takara). Quantitative PCR was performed on QuatiStudio 5 (Applied Biosystem®, Life Technology) using Hieff UNICON® Power qPCR SYBR Green Master Mix (11196ES03, YEASAN, Shanghai, China). Each sample was normalized to the expression value of β-actin. The relative transcript levels of the target genes were quantified using the 2^-ΔΔCt equation. The primer sequences (rat) were as follows: TNF-α-forward: GAAGCCCCTCCCAGTTCTAGTTC, reverse: CACTCCCCATCCTCCCTGGTC; p53-forward: GACTTCTTGTAGATGGCCATGG, reverse: ATGGAGGATTCACAGTCGGATA; AKT1 forward: ACCTCTGAGACCGACACCAG, reverse: AGGAGAACTGGGGAAAGTGC; EGFR-forward: AAACTCTTCGGGACGCCCAATC, reverse: TGGCGATGGATGGGATCTTTG; RelA-forward CTGGCCATGGACGATCTGTT, reverse: TCCACATATGGCCCAGAAGC; β-actin-forward: CCCATCTATGAGGGTTACGC, reverse: TTTAATGTCACGCACGATTTC.
2.14 Molecular docking of TFE monomer components with main targets of PH
The UniProt database was searched for the receptor protein encoded by the selected gene; the protein structure with the highest score was predicted using SWISS-MODEL and the 3D structure of the protein was downloaded from UniProt; the 3D structure and free energy surface was created, and the receptor protein was dehydrated using PyMOL. Hydrogenation and charge calculations were performed on the protein using AutoDock software, and AutoDockVina was used for docking to find the optimal conformation.
2.15 Statistical analysis
The data was expressed as mean ± standard error. Statistical analysis was performed using SPSS version 26 (IBM Corp.). Differences between the groups were compared using one-way ANOVA followed by a post hoc LSD test. P < 0.05 was considered to indicate a statistically significant difference.
2.16 Institutional Review Board Statement
The study was approved by the Ethics Committee of the First Affiliated Hospital of Guangzhou Medical University (No.20211265).The study was conducted in strict accordance with the guidelines in the National Institutes of Health Guide for the Care and Use of Laboratory Animals. And we confirmed that the authors strictly complied with the ARRIVE guidelines.