Sampling sites
The sampling was conducted in the municipality of Comapa, Department of Jutiapa, in southeastern Guatemala (Fig. 1) from June-August 2022. There are 56 communities in Comapa with a population of > 27,000, of which over 80% live in rural areas and almost 90% live in poverty (11). A total of five communities were randomly selected from a subset of 18 communities from a previous study in the region related to peridomestic animal management for Chagas disease control (11–14). Households surveyed were the same as the ones selected in the previous studies (24 households per community), providing us with information regarding the presence of dogs in the household. Additionally, investigators form UVG have had extensive community engagement activities with these community members. The selected communities were Buena Vista (BV), El Anonito (EA), El Comalito (EC), San Antonio (SA), and Santa Barbara (SB).
Questionnaire
A questionnaire was designed to survey the house conditions, domiciliary and semi-domiciliary animals, vector presence, pesticide use, and awareness of vector and vector-borne disease. In this study, we focused on the frequency of house animals and ectoparasites in dogs. Therefore, based on the relevance, two variables from the survey were used to analyze their relationship with tick and flea presence and abundance in this study which are 1) Do you use something to protect your dog’s health; 2) Do you use any approaches in your home to prevent or eliminate insects.
Ectoparasite collection
Dogs owned by the household residents were leashed, muzzled, and restrained with the owners' permission. Attached ticks were removed using fine-tipped forceps, and a flea comb was used to sample fleas. Households were also inspected for tick infestations by using flashlights to inspect cracks and crevices throughout the home. All collected ectoparasites were immediately stored in 70% ethanol until further examination.
Ectoparasites were morphologically identified to species or genus using taxonomical keys (15, 16). A subset of ticks and fleas were randomly selected and subjected to a molecular identification process (see below).
DNA extraction and PCRs for arthropod identification and pathogen detection
The DNA of individual ticks and fleas was extracted using the whole body with the exception of eight ticks from which we used only half body and two fleas that were submitted as voucher specimens to the Texas A&M University Entomology Collection (TAMUIC-767). Each ectoparasite was sliced into at least four pieces using a sterile scalpel blade and subjected to DNA extraction using the E.Z.N.A. Tissue DNA Kit (Omega Bio-Tek, GA, USA) following manufacturer's instructions with overnight lysis (Salomon et al. 2022). A final elution volume of 50 uL was obtained for each sample.
Molecular identification of ectoparasites was performed via PCR with primers targeting the 12S rRNA gene for ticks and the cytochrome c oxidase subunit 1 (COI) gene for ticks and fleas. To amplify a fragment of the 12S rRNA gene, 1.5–3 µL of DNA was used in a 15 µL reaction containing 7.5 uL of FailSafe™ 2x PreMix E, 0.25 µL of FailSafe™ enzyme (Lucigen, Middleton, WI, USA), 0.5 µL of each primer (5 µM), and molecular grade water and the thermal cycle conditions described in Beati and Keirans (17). Two pairs of COI primers were used to amplify the COI gene: LCO1490 and HCO2198 (18); and LCO1490 and Cff_R (19). With LCO1490 and HCO2198 primers, the reaction consisted of 12.5 µL of FailSafe™ 2x PreMix E, 1 µL of each primer (10uM), 0.5 µL of FailSafe™ enzyme, 1 µL of DNA sample, and molecular grade water, resulting in a total volume of 25 µL. The thermal cycling condition had an initial denaturation at 94°C for 3 min followed by 35 cycles of 94°C for 30 sec, 50°C for 30 sec, and 72°C for 30 sec, with a final elongation at 72°C for 8 min. Using the LCO1490 and Cff_R primers, reactions of 25 µL contained 12.5 µL of FailSafe™ 2X PreMix E, 1 µL of each primer (10 uM), 0.5 µL of FailSafe™ enzyme, 2 µL of DNA sample, and molecular grade water. The reaction condition followed the protocol from Lawrence et al. (19).
A quantitative PCR (qPCR) was used to detect the presence of Rickettsia species using primers and a probe targeting the citrate synthase protein gene (gltA) (20). The reaction consisted of 12.5 µL of iTaq Universal Probes Supermix (Bio-Rad, Hercules, CA), 1.125 µL of each primer (10 uM), 0.375 µL of probe, 5 µL of DNA sample, and PCR water, resulting in a final volume of 25 µL. Positive samples from qPCR were subject to conventional PCR with primers also targeting the gltA gene (21). Molecular grade water and a Rickettsia-positive tick sample ( (22)) were included as negative and positive controls, respectively, and produced expected outcomes.
A conventional PCR was used to detect Bartonella species with primers targeting the pap31 gene (23). The 25 µL reaction contained 12.5 µL of Premix E, 1.6 µL of each primer (10 µM), 0.25 µL of enzyme, 2.5 µL of DNA template, and PCR water. The reaction was started with a 3 min pre-denature at 95°C, and followed by 44 cycles of 30 sec at 95°C, 30 sec at 58°C, 45 sec at 72°C, then finished with 7 min at 72°C. The DNA from a B. henselae-positive flea (24) was used as a positive control and molecular grade water was added as a negative control. All primers used in this study are presented in Table 1.
Table 1
Oligonucleotides used in the study for ectoparasite identification and pathogen detection and sequencing.
Gene | Primers | Size | PCR assay | Reference |
12S rRNA | T1B F: AAACTAGGATTAGATACCCT | 360 | Tick identification | (17) |
T2A R: AATGAGAGCGACGGGCGATGT |
COI | LCO1490: GGTCAACAAATCATAAAGATATTGG | 710 | Tick and flea identification | (18) |
HCO2198: TAAACTTCAGGGTGACCAAAAAATCA |
| LCO1490: GGTCAACAAATCATAAAGATATTGG | 601 | Flea identification | (19) |
| Cff-R [S0368]: GAAGGGTCAAAGAATGATGT |
Citrate Synthase | CS-5: GAGAGAAAATTATATATCCAAATGTTGAT | 147 | Rickettsia screening | (20) |
CS-6: AGGGTCTTCGTGCATTTCTT |
CS-FAM: CATTGTGCCATCCAGCCTACGGT |
| RrCS 372: TTTGTAGCTCTTCTCATCCTATGGC | 617 | Rickettsia screening | (21) |
| RrCS 989: CCCAAGTTCCTTTAATACTTCTTTGC |
Pap31 | PAPn1:TTCTAGGAGTTGAAACCGAT | 269 | Bartonella screening | (23) |
| PAPn2: GAAACACCACCAGCAACATA |
Amplicons from conventional PCRs were examined using 1% agarose gel electrophoresis, samples producing bands of the expected sizes were purified with ExoSAP-IT (USB Corporation, OH, USA) following the manufacturer’s protocol, and were submitted to bi-directional Sanger sequencing (Eton Biosciences, San Diego, CA). Sequences were examined using UGENE (Unipro LLC, Novosibirsk, Russia) and the consensus was compared to sequences in GenBank using the Basic Local Alignment Search Tool (BLAST) (25). Representative tick, flea, and pathogen sequences were deposited on GenBank (Accession Nos. PP940107-09; PP940828-30; PP952311-14).
Statistics
Mean intensities of fleas and ticks were calculated by dividing the total number of ectoparasite by the number of infested hosts. Logistic regression was used to explore the effect of four explanatory variables including dog number in the household, dog protection, pesticide uses, and repellent uses, with fleas and tick presence as response variables. When quasi-complete separation occurs, Firth's bias-reduced logistic regression was used instead. All analyses were conducted using R (version 4.2.2; R Foundation for Statistical Computing, Vienna).