Reagents.
Mouse pulmonary artery endothelial cells (MPAECs) were purchased from Shanghai Fuyu Biotechnology Co., Ltd. Transwell chambers, DMEM, and RPMI1640 serum-free and complete media were purchased from Gibco (Thermo Fisher Scientific, Inc. (cat. no. FY22FN2097). Fetal bovine serum (cat. no. 10099-141) was purchased from Gibco (Thermo Fisher Scientific, Inc.). Sterile PBS and trypsin were purchased from Shanghai Biyuntian Biotechnology Co., Ltd. Formaldehyde fixative and 0.1% crystal violet staining solution were purchased from Wuhan Xavier Biotechnology Co., LTD. Total RNA extraction and reverse transcription kits were purchased from Takara. Quantitative PCR (qPCR) primers were designed and synthesized by Takara Bio, Inc. Anti-VEGF and anti-HIF-1α antibodies were purchased from Abcam, while anti-β-actin antibody was purchased from Peprotech, Inc.
Cell experiments. After reaching ~ 50% confluence, MPAECs were incubated for 12 h in medium with a serum concentration of 0.02%. Subsequently, the cells were grouped according to the purpose of the experiment as follows: i) Normoxic group (Normal): Cells were placed in a normoxic cell culture incubator for 24, 48 and 72 h; ii) hypoxia group (Hypoxia): Cells were placed in a hypoxic cell culture incubator (3% O2) for 24, 48 and 72 h; iii) knockdown negative control (NC) group [small hairpin (sh)NC]: 12 h after shNC transfection of cells, cells were cultured in 3% O2 for 48 h; iv) knockdown experimental group (shRNA-lncRNA H19): 12 h after shRNA-lncRNA H19 transfection, cells were cultured in 3% O2 for 48 h; v) overexpression (OE)-NC group (OE-NC): 12 h after OE-NC transfection, cells were cultured in 3% O2 for 48 h; vi) OE experimental group (OE-lncRNA H19): 12 h after OE-lncRNA H19 transfection, cells were cultured in 3% O2 for 48 h; vii) NC group of small interfering RNA (NC): 12 h after NC transfection, cells were incubated in 3% O2 for 48 h; and viii) small interfering RNA (siRNA) experimental group (siRNA-miR-20a-5p): Following transfection of siRNA-miR-20a-5p for 12 h, the cells were cultured in 3% O2 for 48 h.
Cell transfection. For the cell transfection group, adenovirus was added directly into complete medium at a multiplicity of infection of 100. After 24 h of transfection, the medium was changed to normal complete medium. Subsequent analysis was performed after the appropriate time of infection according to the instructions.
Cell migration assay. Transwell chambers (8µm pores, Corning Inc., Corning NY) were pre-coated with 1% matrigel incubated at 37℃for 30 min. Next, the gelatin was aspirated off and the chambers were washed three times with PBS. Serum-free medium was then used to culture MPAECs Cells in logarithmic growth phase were employed and washed with PBS, and trypsin was then added to digest the cells. Cells were then centrifuged at 1,000 rpm at room temperature for 5 min. The supernatant was subsequently discarded, and the cells were resuspended by adding 1 ml serum-free culture medium. Next, 100–150 µl cell suspension was added to the upper chamber of the Transwell plate, while 700 µl complete medium containing 20% FBS was added to the lower chamber of the Transwell plate. Cells were incubated for 5 h. Next, the cells were gently wiped off from the upper chamber with a cotton swab, while the upper layer of liquid was discarded from the Transwell plate, which was then soaked in 4% paraformaldehyde for 15 min. The chambers were then washed three times with PBS (each time with slow shaking for 5 min). After staining with 0.1% crystal violet for 15 min at room temperature, the chambers were washed three times with PBS.
Flow cytometry analysis. In the cell transfection group, adenovirus was added directly to complete medium at a multiplicity of infection (MOI) of 100. After 24 h of transfection, the medium was changed to complete medium. Flow cytometry was performed 48 h after infection to detect apoptosis or cell cycle.
For apoptosis analysis, the apoptosis rate was detected by annexin V and PI double staining (cat. no. 640932; BioLegend, Inc.) according to the manufacturer’s instructions. Briefly, cells were collected and washed once with PBS. Next, 100 µl Annexin V Binding Buffer was added to each tube to resuspend the cells. In total, 5 µl Annexin V-APC and 10 µl PI were added to stain the cells at room temperature in the dark for 15 min. Finally, the samples were transferred to flow-through sampling tubes after adding 400 µl buffer.
For cell cycle assay, a DNA content assay kit to evaluate the cell cycle (cat. no. CA1510; Beijing Solarbio Science & Technology Co., Ltd.) was used after collection of each group of cells, following the instructions of the kit’s manufacturer. CytoFLEX S flow cytometer (Beckman Coulter, Inc.) was used to perform the assay.
Cell Counting Kit-8 (CCK-8) assay. After cell counting, cells were washed twice with PBS. Next, the supernatant was discarded, and the cells were inoculated at 5x 103 cells per well in 96-well plates. After mixing, cells were incubated overnight. CCK-8 assay was carried out the next day at 0, 6, 24, 48 and 72 h after the addition of adenovirus at a MOI of 50 and incubation with the cells for 48 h. A total of 10 µl CCK-8 solution was added to each well, and the plates were incubated in an incubator for 0.5-4 h [optical density (OD) ≤ 2.0]. Absorbance was detected at 450nm
qPCR detection. Total RNA from MPAECs was extracted according to the RNAiso plus manufacturer’s instructions (Invitrogen). Total RNA was reverse transcribed into cDNA according to the instructions of the reverse transcription kit (cat. no. RR037Q; Takara Biomedical Technology Co., Ltd.) and stored at -20˚C. The sequence of the primers were as follows: GAPDH, which was used as the internal reference gene (upstream sequence 5’-3’: GGCACAGTCAAGGCTGAGAATG, downstream sequence 5’-3’: ATGGTGGGTGAAGACGCCAGTA); target gene lncRNA H19 gene (upstream sequence 5’-3’: TCGCTCCACTGACCTTCTAAAC, downstream sequence 5’-3’: CCTGCCTTTCTATGTGCCATTC); HIF-1α gene (upstream sequence 5’-3’: CCACCACAACTGCCACCACTG, downstream sequence 5’-3’: TGCCACTGTATGCTGATGCCTTAG); and VEGF gene (upstream sequence 5’-3’: GGTGAGAGGTCTAGTTCCCGA, downstream sequence 5’-3’: CCATGAACTTTCTGCTCTTC). qPCR detection was performed using SYBR Green Mixture (cat. no. RR820Q; Takara Biomedical Technology Co., Ltd.). The reaction system and reaction conditions were prepared according to the instructions. Three biological replicates were conducted for each group. The relative expression (RQ) of the target genes was calculated using the ΔΔCq method (23): RQ = 2− ΔΔCq.
Western blot detection. RIPA buffer was used to lyse MPAECs at the end of the treatment period. Sonication was used to fully lyse the cells. The cells were then centrifuged at 12,000 rpm for 10 min at 4˚C. Next, the supernatant was separated and analyzed with BCA Protein Quantification Kit (cat. no. P0010S; Shanghai Biyuntian Biotechnology Co., Ltd) to adjust the total cellular protein concentration. Samples were then incubated at 100˚C for 5 min after adding 5X sampling buffer. Proteins were separated by SDS-PAGE and then transferred to PVDF membranes, which were then blocked with skimmed milk. After three washes with TBS-Tween 20 (TBST) buffer, the primary antibody was added and incubated overnight on a shaker at 4˚C, anti-HIF-1α (1:1000; cat. no. PA3-16521; Thermo Fisher Scientific Inc.), anti-VEGF (1:1000; cat. no. MA5-13182; Thermo Fisher Scientific Inc.), anti-β-actin (1:1000; cat. no. AC026; ABclonal Technology Co.Ltd.). After three washes with TBST buffer, the secondary antibody was added and incubated at room temperature for 1 -1.5 h. Subsequently, the proteins were visualized using ECL system (cat. no.WBULP; Merck Pty. Ltd.). Finally, ImageJ software (version 2022) was used for semiquantitative analysis of protein expression. β-actin was used as internal reference.
Statistical analysis. Experimental data were statistically analyzed using SPSS 23. 0 software (IBM Corp.). Results were expressed as the mean ± standard deviation. GraphPad software (Version 9.0) was used to draw statistical analysis-related graphs. Independent samples Student’s t-tests were used for comparisons between two groups, while one-way ANOVA test was used between for comparisons multiple groups, followed by Bonferroni as a post hoc test. P < 0.05 was considered to indicate a statistically significant difference.