Mice
C57BL/6J mice (male, 6–8 weeks) were purchased from Gempharmatech Co., Ltd. (Nanjing, Jiangsu, China). All mice experiments were conducted following the Guide for the Care and Use of Laboratory Animals (Ministry of Science and Technology of China, 2006) and were approved by the Animal Ethics Committee of Nanjing University of Chinese Medicine.
Cell culture
Human Peripheral Blood Mononuclear Cell (PBMCs) were isolated from healthy volunteers this study were approved by the Institutional Research Ethics Committee of Jiangsu Provincial Hospital of Chinese Medicine (Approved Number: 2021NL-095-02). Bone marrow-derived macrophages (BMDMs) were cultured in RPMI 1640 medium supplemented with 20% L929 supernatant. PBMCs, L929 cells (ATCC), THP-1 cells (ATCC) were cultured in RPMI 1640 and HEK293T cells (ATCC) were cultured in DMEM, all medium were supplemented with 10% fetal bovine serum, and 1% Penicillin/Streptomycin. And cells were cultured in a constant humidity incubator with 5% CO2 at 37°C.
Antibodies and reagents
Anti-NLRP3 (Adipogen, AG-20B-0014-c100), Anti-Caspase-1 + p10 + p12 (Abcam, ab179515), Anti-IL-1β + p17 (Abcam, ab234437), Anti-Asc (Adipogen, AG-25B-0006-c100), Anti-Phospho-NF-kappaB p65 (Abmart, TP56372F), Anti-NF-кB p65 (Abmart, T55034F), Anti-β-actin (Abmart, T401045), Anti-GAPDH (Abmart, P60037), Anti-β-tublin (Abmart, M20005), Anti-FLAG (Abmart, M20008), Anti-HA (Abmart, M20003), Anti-GFP (Santa Cruz, sc-9996), Anti-RACK1 (Huabio, ET7109-04), Anti-SASH1 (Bioss, bs-6099R), Anti-AGFG2 (UpingBio, YP-Ab-04108), Anti-GBP4 (Abmart, PA5012), Anti-FITC-ly6G (Biolegend, 127605), Anti-APC-F4/80 (Biolegend, 123116), Anti-Collagen Type Ⅰ (Proteintech, 14695-1-AP), Anti-Smooth muscle actin (Proteintech, 14395-1-AP), Goat anti-mouse IgG (Abbkine, A21010), Goat anti-rabbit IgG (Abbkine, A21020). Recommended concentrations were used for all antibodies.
Lipopolysaccharides (LPS, Sigma, L4391), Adenosine triphosphate (ATP, Aladdin, A100885), Uric acid sodium salt (MSU, Sigma, U2B75), Nigericin (Shanghai Yuanye Bio-Technology, S25116), Pam3CSK4 (Invitrogen, tlrl-pms), Muramyl Dipeptide (MDP, Absin, abs45126715), Poly(dA:dT) (Invitrogen, tlrl-patn), PMA (Sigma, P1585), MCC950 (TargetMOI, XSD20220316-00020), Dexamethasone (Dex, Sigma, D4902), Nintedanib (Meilunbio, MB7360).
Chemistry
The dried flowers of Inula helianthus aquatilis C. Y. Wu ex Y. Ling were added to 10 times the amount of 70% ethanol and cold-soaked for 2 h, followed by 3 rounds of reflux extraction for 2 h each. The filtrate was then combined and subjected to column chromatography using macroporous resin D101 with a gradient elution of 30%-90% ethanol. The components were tracked by HPLC, enriching the sesquiterpene lactone fraction, which was then quantified for subsequent activity evaluation.
The dried flowers of Inula helianthus aquatilis C. Y. Wu ex Y. Ling (300 g) were extracted under reflux with PE (3 L × 2 h, three times). After removal of the PE in vacuo, the combined extract (15 g) was subjected to silica gel column chromatography (PE/EA, 200:1→2:1), monitoring by thin layer chromatography. The extract was chromatographically separated on a silica gel column and eluted with PE-EA to obtain ergolide (430 mg), bigelovin (153 mg), and 8-epi-helenalin (150 mg).
Single-cell RNA Sequencing (scRNA-seq) analysis
PBMC Sample
A dataset of scRNA-seq (GSE175450) was collected from the Tumor Immune Single-cell Hub (TISCH) database (42). The standard workflow for processing scRNA-seq data was performed using the R package “Seurat V4" (43). We used the Uniform Manifold Approximation and Projection (UMAP) coordinates and annotation information provided by TISCH and visualized them with the "plot1cell" package (44). The expression of genes and gene signatures was described by the “scRNAtoolVis” package(45).
BALF Sample
Using cell type-specific marker gene expression analysis, cell types were distinguished from the scRNA-seq data. The R packages ‘celldex’ and ‘SingleR’ were used to classify the immune cell populations, including but not limited to T cells, B cells, natural killer cells, dendritic cells, and monocytes. Each immune cell type was identified based on its known marker genes and characterized by its distinct gene expression signature using the ‘MonacoImmuneData’ reference index, which contains normalized expression values of 114 bulk RNA-seq samples derived from sorted immune cell populations, enabling high-resolution profiling of immune cell transcriptome (46).
Inflammasome stimulation (47)
Canonical NLRP3 inflammasome was activated as follows: BMDMs were primed with LPS (100 ng/mL) for 3 h and treated with bigelovin for 1 h, followed by ATP (5 mM) for 45 min, nigericin (5 µM) for 45 min, and MSU (500 µg/mL) for 12 h. For noncanonical NLRP3 activation, the cells were primed with Pam3CSK4 (500 ng/mL) for 3 h and treated with bigelovin for 1 h. After that, LPS (2 µg) were transfected into BMDMs using Lipofectamine 3000 (Invitrogen, L3000015) for 24 h. For alternative NLRP3 activation, PBMCs were treated with bigelovin for 1 h and then stimulated with LPS (100 ng/mL) for 16 h.
Other inflammasomes were stimulated as follows: For NLRP1 inflammasome activation, BMDMs were primed with LPS (100 ng/mL) for 3 h and treated with bigelovin for 1 h. Subsequently, the cells were stimulated with MDP (10 µg/mL) for 24 h. AIM2 inflammasome activation was obtained by transfection of 2 µg poly(dA:dT) using Lipofectamine 3000 (Invitrogen, L3000015) for 6 h.
THP-1 cells were primed with PMA (500 nM) for 3 h and then treated with bigelovin for 1 h after stimulated with LPS (100 ng/mL) for 3 h. Subsequently, the cells were stimulated with ATP (5 mM) for 45 min.
Enzyme-linked immunosorbent assay (ELISA)
The ELISA experiments producure has been described previously(18).
Cell counting kit 8 (CCK-8)
The CCK-8 assasy has been described previously(18) .
Lactate dehydrogenase assay (LDH)
BMDMs were seeded in 24-well plates overnight and stimulated with 100 ng/mL LPS for 3 h, treated with bigelovin at the indicated concentrations for 1 h. After that, stimulated with 5 mM ATP for 45 min, LDH release was detected by the LDH Cytotoxicity Assay Kit (Beyotime, C0016) following the manufacturer’s instructions.
Western blot and co-immunoprecipitation
The protocols for immunoprecipitation and co-immunoprecipitation assay has been described previously(48, 49)
Quantitative real-time PCR (qRT-PCR)
The protocols for qRT-PCR has been described previously(48). The primer sequences used in the study were described below:
GapdhMusFor: CATCACTGCCACCCAGAAGACTG
GapdhMusRev: ATGCCAGTGAGCTICCCGITCAG
Il1bMusFor: TGGACCTTCCAGGATGAGGACA
Il1bMusRev: GTTCATCTCGGAGCCTGTAGTG
Il6MusFor: TACCACTTCACAAGTCGGAGGC
Il6Mus Rev: CTGCAAGTGCATCATCGTIGTTC
TnfaMusFor: CGTGCCTATGTCTCAGCCTCTT
TnfaMusRev: GCCATAGAACTGATGAGAGGGAG
Rack1MusFor: TCCTCTGATGGTCAGTTTGCCC
Rack1MusRev: CACGCTCAACACATCCTTGGTG
ASC oligomerization assay
The assay for ASC oligomerization has been described previously (18).
NLRP3 oligomerization assay (50)
BMDMs were stimulated by ATP (5 mM) as described above. The cells were collected and resuspended in HEPES, subjected to 20 strokes of homogenization using a syringe, followed by centrifugation at 4°C, 900 g for 8 minutes to remove cell nucleus and unbroken cells. After centrifugation at 6200 g for 8 min, supernatants were discarded and the pellets were resuspended in 200 µL of HEPES. DSS (2 mM) was incubated at room temperature for 1 h for cross-linking and then was dissolved in the sample buffer. And Western blotting was performed for detection of NLRP3 oligomerization.
Intracellular Ca2+ and K+ measurement
BMDMs after stimulation were washed with PBS. After digestion by pancreatic enzymes, the cells were centrifuged and washed again. Subsequently, BMDMs were incubated with Fluo-4 AM (2 µM) (Beyotime, S1060) for 30 min at 37°C. After centrifugation, the samples were resuspended in 300 µL PBS and incubated for 30 min at 37°C once more and subsequently analyzed by flow cytometry on Beckman Coulter Gallios.
BMDMs were incubated with ION Potassium Green-2 AM (10 µM) (Abcam, ab142806) for 15 min at 37°C and then stimulated with 5 mM ATP for 45 min. The levels of intracellular K+ were determined by flow cytometry on Beckman Coulter Gallios.
Measurement of lysosome rupture
BMDMs after stimulation were washed with RPMI 1640 medium once. The cells were loaded with Lyso-Tracker Red (1 µM) (Solarbio, L8010) for 30 min at 37°C. After that, the cells were digested by pancreatic enzymes before centrifugation and washed with PBS once. The samples were analyzed by flow cytometry after resuspending in 200 µL PBS.
Measurement of mtROS
BMDMs were stimulated by ATP as previously described. Then, the cells were washed twice with PBS and incubated with DCFH-DA (10 µM) (Beyotime, S0033) for 30 min at 37°C. After centrifugation, the samples were resuspended in 200 µL PBS after rinsing and subsequently analyzed by flow cytometry.
Confocal microscopy
BMDMs after stimulation were incubated with Mito-Tracker Red CMXRos (200 nM) (Beyotime, C0135) for 30 min before sample collection. The cells were washed twice with PBS and fixed with 4% PFA for 30 min at room temperature. Then, the cells were washed three times by PBST and stained with DAPI (Beyotime, C1005) for 10 min. Subsequently, the cells were washed three times by PBST again. Confocal microscopy analysis was analyzed by fluorescence microscope on Lecia TCS SP8.
Plasmid transfection
Plasmids of FLAG-NLRP3, GFP-NLRP3, FLAG-NEK7, FLAG-ASC, GFP-ASC, GFP-Vector, GFP-RACK1, GFP-RACK1 C168A were manufactured by General Biotechnology (Hefei, China). DNA of plasmids were transfected to HEK293T using Lipofectamine 3000 for 24 h, then cells were treated with bigelovin for another 24 h for co-immunoprecipitation assays.
isoTOP-ABPP Cysteine Chemoproteomic Profiling
The BMDMs were with (100 ng/mL) LPS for 3 h, then 1 µM bigelovin or the corresponding concentration of the DMSO was added. Cells steady at 37℃ for 1 h before lysis with PBS. Protein concentration was determined with BCA assay and the concentration was adjusted to 1 µg/µL with PBS. For biological replicates, two aliquots of 1 mL cell lysates were prepared. Each aliquot was treated with 100 µM IA-alkyne at room temperature (RT) for 1 h The click reaction reagent containing 60 µL 0.9 mg/mL TBTA (in 4:1 tBuOH/DMSO), 20 µL 12.5 mg/mL CuSO4 (in H2O), 20 µL 13 mg/mL TCEP (in H2O) and 20 µL 5 mM light isoDTB tags (DMSO) or heavy isoDTB tags (bigelovin) were prepared. Samples were treated with 120 µL click reaction reagent at RT for 1 h. After incubation, the light and heavy labeled samples were combined and precipitated with cold acetone. Protein precipitates were washed with methanol and dissolved followed by enrichment with streptavidin agarose beads. After reduction and alkylation, on-bead digestion was performed with 10 ng/µL trypsin at 37℃ overnight. The beads were washed and then peptides attached to the beads were eluted with 0.1% formic acid in 50% acetonitrile in water. Peptides were analyzed on a Q Exactive Plus with an EASY-nLC 1200 system. Samples were separated at a flow rate of 300 nL/min using the following gradient: 2–5% buffer B (80% acetonitrile with 0.1% formic acid in H2O) in buffer A (0.1% formic acid in H2O) for 2 min, followed by a gradient from 5%-32% B for 76 min, 32%-45% buffer B for 5 min, 45%-100% B for 2 min and holding at 100% B for 2 min. Column temperature was maintained at 50℃. The scan range of MS1 was 300-1,700 m/z with a resolution of 70,000 (at 200 m/z), with an AGC target of 3×106 and a maximum injection time of 50 ms. The top 20 precursors were selected for MS/MS analysis with a resolution at 17,500 (at 200 m/z), AGC target 1×105, and a maximum injection time of 100 ms. The isolation window of precursors was 2 m/z. Normalized collision energy was set at 27 eV with a 30 s dynamic exclusion window. Data analysis for the isoTOP-ABPP assay was carried out as described previously (19).
Cellular thermal shift assay (CETSA) (49)
The BMDMs were incubated with bigelovin (300 µM) or DMSO for 1 h. Harvested cells were frozen and thawed three times by liquid nitrogen. The proteins were separated from cells by centrifuging at 15,000 g for 10 min at 4 ℃. Subsequently, the supernatant was equally divided into 6 parts and heated for 3 min at different temperatures and detected protein level by immublotting.
C57BL/6 mice were injected intraperitoneally bigelovin (0.1 mg/kg) for three consecutive days, and then peritoneal macrophages were harvested to CETSA in vivo.
Surface Plasmon Resonance (SPR)
The binding affinity between bigelovin and recombinant human RACK1 protein (Biorbyt, orb754920) was assayed using a GE Biacore T200 instrument. RACK1 protein was loaded to the CM5 sensor chip (Cytiva, 2205-4643-AE). The concentration gradient bigelovin was prepared with running buffer (1×PBS-P, 5% DMSO), and flowed over the chip. The parameters of SPR used in the study were described below: flow rate, 30 µL/min; temperature, 25°C; association time, 60 s; disassociation time, 120 s. The equilibrium dissociation constant (KD) was calculated using Biacore T200 Evaluation Software.
Molecular docking
The protein structure of RACK1 (UniProt ID: D6RBD0) was derived from the AlphaFold Protein Structure Database (https://alphafold.ebi.ac.uk/) and prepared by Schrödinger 2019 protein wizard module. The amino acid sequence in D6RBD0 was renumbered based on the sequence utilized in the constructed plasmid transfected into the cells. Bigelovin was processed using the LigPrep module and docked using the covalent dock module in the Schrödinger 2019. During the setup process, the reaction type was selected as Michael addition and the scoring function was set to Extra Precision.
LPS-induced mice (51)
To assess the preventive effect, C57BL/6J mice were injected intraperitoneally fractions (0.1 or 1 mg/kg), bigelovin (10 or 100 µg/kg), vehicle, dexamethasone (5 mg/kg) for three consecutive days. Thirty minutes after the last dose, 7.5 mg/kg LPS (Sigma, L2630) was injected intraperitoneally. The serum, BALF and lung tissues were collected after 12 h, and inflammatory cytokines were measured by qRT-PCR or ELISA. The number of cells in the BALF was counted, and the number of macrophages (F4/80+ cells) and neutrophils (Ly6G+ cells) in the BALF were analyzed by flow cytometry. Lung samples were collected 24 h after LPS administration and fixed in 4% paraformaldehyde for histopathological evaluation. The prophylactic effect of oral bigelovin (0.1 or 1 mg/kg) administration was evaluated as described above. To study the therapeutic effect, the mice were injected intraperitoneally 7.5 mg/kg LPS. After 30 minutes, the mice were injected intraperitoneally fractions (0.1 or 1 mg/kg), bigelovin (10 or 100 µg/kg), vehicle, and dexamethasone (5 mg/kg). The mice were euthanized 24 h later. At the experimental endpoint, serum and lungs were collected for detection of mRNA, protein, or pathological damage.
Biosafety evaluation
C57BL/6J mice were intragastric administration of bigelovin (1 mg/kg, 10 mg/kg) for thirty consecutive days. The weight and overall condition of the mice were monitored throughout the experiment. On day 30, the mice were euthanized, and liver, heart, spleen, lung, kidney, and colon tissues were collected for subsequent analysis.
RACK1 knockdown in vivo (25)
The siRNAs (siControl: 5´-UUCUCCGAACGUGUCACGUTT-3´; siRACK1: 5´-GUAGAUGAAUUGAAGCAAGTT-3´) were synthesized by General Biotechnology (Hefei, China). C57BL/6J mice were intravenously injected with siRNA (80 µg per mouse) using in vivo-jetPEI (Polyplus, 101000030), followed by intraperitoneal injection of 7.5 mg/kg LPS 48 h later, and then the mice were injected intraperitoneally bigelovin for 12 h. The lung tissues were collected for the further assay.
SiO 2 -induced mice (52)
C57BL/6J mice were randomly divided into five groups, including normal, model, bigelovin (intraperitoneal injection of 0.1 mg/kg, 1 mg/kg), and positive control group treated with nintedanib (intragastric administration of 100 mg/kg). The SiO2 (Sigma, S5631) suspension (300 mg/kg) was injected into the trachea of mice, and the control group was injected with physiological saline. Seven days after SiO2 treatment, mice were injected intraperitoneally with bigelovin or given nintedanib by gavage for 14 consecutive days. On day 21, the mice were euthanized for subsequent analysis.
DSS-induced colitis
Colitis in mice was induced by 2.5% DSS in drinking water for 7 consecutive days followed by a 2-day tapwater period, according to previous research (49). The bigelovin at the dose of 0.01, 0.1 mg/kg was given intraperitoneally once a day for 7 days during DSS administration. The solvent was given intraperitoneally to both sham and model groups as vehicle control.
Immunohistochemistry
Formalin-fixed, paraffin-embedded tissues from mice were stained with Anti-Collagen Type Ⅰ antibody and Anti-Smooth muscle actin as previously described (48).
Statistical analysis
Statistical analyses were performed using GraphPad Prism 8.0.1. All data were analyzed by two-tailed t-tests or one-way ANOVA (clinical samples) as appropriate, and p < 0.05 was considered statistically significant.