2.1 Clinical information
A total of 30 bone marrow specimens from patients first diagnosed with AML in the First Affiliated Hospital of Bengbu Medical University from January 2018 to December 2022 were selected. Of these, 10 were FLT3-ITD+ patients, who were comprehensively diagnosed by MICM typing, and the diagnostic criteria were based on the “Diagnostic and efficacy criteria of hematologic diseases.” The cohort comprised 18 males and 12 females aged 14-75 years. In addition, 20 bone marrow specimens from patients with wild-type promyelocytic leukemia comprised the control group. This study was approved by the Ethic Committee of the First Affiliated Hospital of Bengbu Medical College (2021-No. 013), and all participants provided written informed consent.
2.2 Materials and reagents
The FLT3-ITD+AML cell lines Molm-13 and MV4-11, and the human acute lymphoblastic leukemia cell line RS4-11 were purchased from Wuhan Punosai Life Sciences Co. Overexpression lentiviral vector pCDH1-MCS1-EF1-copGFP, packaging plasmids psPAX2 and pMD2G were purchased from SBI, Japan. Fetal bovine serum, TRIzol reagent, RPMI 1640, BCA protein quantification kit and protease inhibitor were purchased from Biosharp, China. The SYBR green PCR kit and related buffers were purchased from Cochonda, and the CCK8 kit was purchased from Dojindo, Japan, and the Transwell was purchased from Corning, USA. Crystalline violet staining solution, puromycin, and penicillin were purchased from BiyunTian. Annexin V/7AAD apoptosis kit was purchased from Yesen (China), and Argrose reagent was purchased from Sawabe Biological Company. Rabbit monoclonal antibodies to JNK and p-JNK, rabbit monoclonal antibody to p-P38 and mouse polyclonal antibody to P38 were purchased from Abcam (UK) and Proteintech (USA), respectively.
2.3 Real-time PCR detection of GADD45G mRNA expression in FLT3-ITD+ clinical samples and cell lines
Bone marrow mononuclear cells and MV4-11 and MOLM-13 cells of FLT3-ITD+ patients were collected, negative control was set, RNA was extracted by TRIzol reagent, RNA concentration and purity were determined, cDNA was synthesized by reverse transcription, and gene expression was detected by Real-time PCR with housekeeping gene β-actin as internal reference (specific sequences are shown in Table 1). The relative mRNA expression of GADD45G was calculated by 2-ΔΔCt method.
Table 1. PCR primers
Name
|
Oligonucleotide sequence (5’–3’)
|
b-actin-human-F
|
ACGTGGACATCCGCAAAG
|
b-actin-human-R
|
TGGAAGGTGGACAGCGAGGC
|
GADD45G-human-F
|
CGAGTCAGCCAAAGTCTTGAA
|
GADD45G-human-R
|
AAAGCCTGGATCAGCGTAAA
|
2.4 Real-time PCR detection of GADD45g mRNA expression in AML cell lines with FLT3-ITD+
MV4-11, MOLM-13, and RS4-11 cells were used at the logarithmic growth stage. The usage method is the same as above.
2.5 Construction and infection of lentiviral vector overexpressing GADD45g.
PCR primers were designed according to the coding sequence of the human GADD45g gene. The GADD45g was amplified by PCR using the cDNA of normal human bone marrow mononuclear cells as a template. Then, the PCR products were identified and recovered by 1.0% agarose gel electrophoresis. The GADD45g recombinant lentiviral vector pCDH1-GADD45g-GFP was constructed by double-cleavage of the PCR amplicons and pCDH1 vector with restriction endonucleases, XbaI and EcoRI. The cleavage products were ligated using T4 ligase, and MV4-11 and MOLM-13 cells were collected at the logarithmic phase. The optimal multiplicities of infection (MOIs) were screened, and the cells were infected with the virus for 16h. Then, complete medium was replaced for 32h. The optimal MOI=80 was selected to construct the stable transplants because the virus infection efficiency was the highest under this condition. After successful infection, puromycin (1μg/mL) was added to obtain the stable strain after 3-4 weeks of culture.
2.6 Effect of GADD45g overexpression on the proliferative capacity of AML cells with FLT3-ITD+ as determined by CCK-8 reagents
The GADD45g overexpression and empty vector virus-infected MV4-11 and MOLM-13 cells were seeded in 96-well cell culture plates, respectively. After 48 h, 15μL of CCK-8 reagent was added to each well, and the reaction was incubated in a 37°C incubator for 2h. The OD values were measured using an enzyme marker at 450 nm and used for the analysis of cell proliferation.
2.7 Transwell assay for the effect of GADD45g overexpression on the migratory and invasive ability of AML cells with FLT3-ITD+
A volume of 25μL of Matrigel was added to the upper chamber of the transwell plate to cover the polycarbonate membrane at 37°C for 30 min for gel polymerization. The collected GADD45g overexpression and empty vector virus-infected MV4-11 and MOLM-13 cells were inoculated into the upper chamber of 24-well culture plate in a 200μL volume per well, respectively, for 48h. Then, the cells were fixed with 4% polymethanol for 30min, washed twice with PBS, and then stained with crystal violet for 10 min. After 48h, the cells were removed from the small chamber, the Matrigel and the cells on the surface were wiped off with a wet cotton swab, fixed with 4% polymethanol for 30 min, washed twice with PBS, and stained with crystal violet for 10min. The upper layer of non-migrated cells was gently wiped off with a cotton swab and examined under a light microscope.
2.8 Effect of GADD45g overexpression on apoptosis of AML cells with FLT3-ITD+ detected by flow cytometry
GADD45g overexpressing and empty vector virus-infected MV4-11 and MOLM-13 cells were collected, and apoptosis was detected using the Annexin V/7AAD Apoptosis kit (Yesen). After 48h of cell treatment, the cells were suspended in 300µL of 1X binding buffer. Then, 10µL of Annexin V-APC and 5µL of PI staining were added to the cells, and the mixture was incubated at room temperature for 15 min in the dark. Then, 400µL of binding buffer was added to detect apoptosis by flow cytometry, and “FlowJo” software was used for the data analysis.
2.9 Effect of GADD45g overexpression on colony-forming ability of AML cell lines with FLT3-ITD+ detected by soft-agar colony culture assay
GADD45g overexpression and empty vector virus-infected MV4-11 and MOLM-13 cells were subjected to live cell counting. Then, the cell density was adjusted to >40×104/mL, and the suspension was mixed with the colony culture system. The mixture was added to the 6-well plate with the upper layer of agar. After 2-3 weeks of culture, the petri dish was examined under an inverted microscope (100×), and the number of clones in the field of view was counted. Each colony with >50 cells (>0.05 mm clones) was counted by staining with 0.005% crystal violet in each well for 1h.
2.10 Western blotting detects protein changes during JNK pathway-mediated apoptosis
GADD45g overexpression and empty vector virus-infected MV4-11 and MOLM-13 cells were lysed by RIPA buffer on ice for 30min and stored at−20°C. The supernatant was clarified by centrifugation at 12,000 rpm, 4°C for 30min. The protein concentration was determined using the BCA Protein Quantification Kit, and was analyzed by SDS-PAGE. After the protein was transferred, the PVDF membrane was blocked for 30min and probed with primary antibody at 4°C overnight, followed by incubation with secondary antibody at room temperature for 2h. After three washes with TPBS, the immunoreactive bands were developed with an ECL developer, and images were captured.
2.11 Detection of cellular phenotypic changes using JNK pathway inhibitors
The JNK pathway inhibitor SP600125 was used to act on the overexpressed GADD45g FLT3-ITD+ AML cell line. These assays were repeated with the overexpressed GADD45g cell line control to observe the effects on cell proliferation, migration invasion, clone formation, apoptosis, and expression of related proteins. The JNK pathway was confirmed to play a role in GADD45g-mediated FLT3-ITD+ AML cell lines.
2.12 Statistical analysis
The current findings were statistically analyzed using GraphPad Prism 9.0. All assays were repeated three times. Unpaired t-tests and analysis of variance (ANOVA) were used. P<0.05 indicated a statistically significant.