2.1. Materials and Instruments
The Pasteur Institute was where HCT-116 colorectal cancer cell line was bought. All of the Shigella dysenteriae, Staphylococ aureus, Pseudomonas aeruginosa and Lactobacillus lactis PTCC 1057, were provided by the Iranian Research Organization for Science and Technology (Tehran, Iran). From SPL Life Sciences, we bought tissue culture flasks, 96-well culture plates, 6-well culture plates, and pipettes (Gyeonggi-do, South Korea). Invitrogen supplied RPMI 1640 medium, trypsin, penicillin, streptomycin, and FBS (Waltham, MA, USA). Sigma Aldrich was where we got MTT powder, Triton-X100, diethylpyrocarbonate (DEPC), Proteinase K, trypan blue, and sterile discs (St. Louis, MI, USA). Merck gave us the DMSO, the crocin, and the de Man, Rogosa, and Sharpe (MRS) media (Darmstadt, Germany). RNA isolation kit (RiboEx) was purchased from GeneAll company (Korea). InterLabService was where the Reverta-L reagent kit was bought (Moscow, Russia). Complementary DNA (cDNA) synthesis kit (BioFact™ RT-Kit) and 2X Real-Time PCR Master Mix were bought from BioFact company (Korea). Bio-Rad T100 Thermal Cycler (USA) and Applied Biosystems™ StepOne™ Real-Time PCR System (USA) were used to carry out cDNA synthesis and qPCR reactions. An ELx 800 spectrophotometer (Biotek, USA) was used to evaluate optical density (OD). Annexin V-fluorescein isothiocyanate (FITC) Propidium iodide (PI) dual staining kit was provided from EBioscience (Waltham, MA, USA). Unless stated otherwise, all extra materials were bought from Fermentas Life Science (Waltham, MA, USA) or Merck (Darmstadt, Germany).
2.2. Cell-free supernatant (CFS) preparation
L. lactis was cultivated at a temperature of 37°C in a modified MRS broth medium until it reached 0.7–0.8 OD at 600 nm wavelength. MRS agar, which is a defined medium, was created to grow lactobacilli from various sources as a substitute for tomato juice agar. The OD (0.8) yield on MRS agar was determined to be 109 colony-forming units (CFU) per milliliter, which corresponds to the bacterial density found in the large intestine (i.e., around 109 – 1011 CFU/ml). During multiple cultures, bacteria grown in the presence of crocin showed resistance to increasing concentrations of crocin, including 25 µg/ml, 50 µg/ml, 75 µg/ml, 100 µg/ml, 125 µg/ml, 150 µg/ml, and 200 µg/ml. For 48 hours, the bacteria were cultured in the mentioned concentrations of crocin, or until 109 CFU/ml of bacterial colonies were cultivated in MRS broth. After that, the supernatants and sediments of the resistance bacteria to the highest concentration of crocin (200 µg/ml) and untreated bacteria were collected, and then adjusted to 7.4 pH. Next, to produce cell-free supernatant (CFS) and crocin-resistant bacteria supernatant (cro-CFS), the supernatants were passed through 0.2-micron sterile filters. Besides, bacterial sediments were PBS-washed two times and the resistance of recovered bacteria to low pH was evaluated. To conduct cellular investigations, both untreated and crocin-treated bacteria were harvested and transferred to RPMI medium 24 hours prior to treatment. Following, the supernatants were centrifuged to collect CFS and cro-CFS, their pH was adjusted to 7.4 and they were filtered via a 0.2-micron filter.
2.3. Evaluating the resistance of corcin-treated bacteria to the acidic environments
The resilience of bacteria treated with crocin to the acidic environment of the stomach was investigated. Briefly, the bacteria that showed the greatest resistance to crocin at pH 7.2 were isolated and washed with PBS. They were then exposed to pH 3.0 PBS for 0, 1, 2, and 3 hours. The rate of bacterial resistance was determined using the MRS agar-based pour plate method in regard to the survival of bacteria. The following equation explains how the survival rates of the bacteria were determined [12].
Equation I: Survival rate% = log CFUN1/log CFUN0×100.
In this equation, N1 signifies the counts viable bacteria isolated on MRS agar at low pH, and N0 represents the counts of viable bacteria prior to culturing in an acidic environment.
2.3. Antimicrobial Susceptibility Test
The effectiveness of CFS in fighting pathogen bacteria commonly found in medical settings was tested using an antimicrobial susceptibility test, also known as disc diffusion and zone of inhibition assay. Gram-negative bacteria Shigella dysenteriyae, gram-positive bacteria Staphylococcus aureus, and Pseudomonas aeruginosa [12] were used in the experiment. All bacterial strains were grown in nutritious broths and a germ-free disc covered by cro-CSF (10 µl/mL) and CFS alongside relevant antibiotics were loaded onto plates, allowing the diffuse of CFS into the agar for 2 hours at 24°C. Next, the plates were incubated at 37°C for 24 hours, and the diameter of the inhibitory zone was calculated. To determine these zones around the discs a Mitutoyo sliding caliper was employed. and the results were categorized based on the level of resistance relative to the standard antibiotics [13]. The negative control was a sterile disc containing PBS (pH 7.2) while Azithromycin 30 µg discs were considered as the positive controls for Pseudomonas aeruginosa, and Staphylococcus aureus, and Ampicillin 30 µg discs for Shigella dysenteriyae.
2.4. Characterization of the protein content of CSF
To evaluate the effect of protein elements of CFS on its antibacterial and cytotoxic activity, Proteinase K treatment was performed. Briefly, CFS and cro-CFS (200 µl/mL) were treated with Proteinase K (100µg/ml) for 1 hour at 37°C. Next, the enzyme deactivation was done by incubating CFS mixtures at 70°C for 20 min [14]. The treated CFSs were used for further experiments.
2.5. Cell Culture
HCT-116 human colorectal cancer cell line were cultured in RPMI 1640 media. The supplementary components included 10% FBS, penicillin antibiotic (100 U/ml) and streptomycin antibiotic (100 µl/ml) antibiotic. The cultivation environment was a CO2 incubator providing 80% humidity and 37°C temperature.
2.6. Cell viability (MTT) assay
The cytotoxic effects of various concentrations of CFSs on HCT-116 cells was assessed using the MTT test. HCT-116 cells (2.0×104 cells per well) were seeded into 96-well cell culture plates and after reaching confluency upon 24 hours of incubation treated with the CFSs. After 24-hour incubation, MTT reagent (2mg/ml solved in PB) was added to the wells and allowed to be incubated for 4 hours. The formazan crystals produced by oxidoreductase enzymes of viable cells were dispersed using DMSO solution and the absorbance of each well at 570 nm wavelength was measured using the Tecan ELISA plate reader.
2.7. Flow cytometry analysis of cell apoptosis
To identify the presence of treated cells in early and late stages of apoptosis, or in necrosis state, FITC-labeled annexin V and PI dual staining was done based on the flow cytometric analysis. HCT-116 cells (2.5×105 cells per well) were cultured in 6-well culture plates, treated with CFS and cro-CFS, incubated for 24 hours, and harvested. The harvested cells were then washed with PBS and then incubation with 1x binding buffer solution (200 µL) containing 5 µL annexin V-FITC and 5 µL PI for 15 min in a dark place. The stained cells were washed and resuspended in PBS and then subjected to the BD FACS Calibur TM flow cytometer (FACS Quant; Milteny, Germany). Data analysis was performed by FlowJo software Version 10 (TreeStar Inc., USA).
2.8. Flow cytometry analysis of cell cycle progression
In order to identify the effects of CFS and cro-CFS on the HCT-116 cell division and proliferation, flow cytometry analysis based on PI staining was performed. To do this, after cultivation and treatment in 6-well culture plates, HCT-116 cells were collected, and washed with cold PBS. Next, they were fixed with 75% ethanol and stored at -20°C for 2 days. Next, the cells were treated with RNase A (100 µg/mL) for 30 min at the room temperature. After that, the cells were incubation in 500 µL PBS solution containing PI (0.1%, v/v) and Triton X-100 (0.1%, v/v). Finally, the samples were subjected to flow cytometry and the obtained data was analyzed using FlowJo software.
2.9. Gene expression analysis
To understand the molecular aspects of CFS-mediated cell apoptosis, gene expression analysis was performed using qRT-PCR technique. HCT-116 cells were cultured in 6-well culture plates, treated with IC50 of CFS and cro-CFS, and incubated for 24 hours. After that, RNA extraction and cDNA synthesis were carried out. Using the cDNA samples, gene expression was analyzed by 2X Real-Time PCR Master Mix in StepOne™ Real-Time PCR System. Reverse and forward primers for Bax, Bcl-2, and Caspase-3 genes were generated using oligo 7 software, which are presented in Table 1. After gathering Threshold Cycle (Ct) values for each sample through duplicated reactions, 2− ddCt was employed for the comparison of relative gene expression between the samples. GAPDH housekeeping gene was used to normalize gene expression.
Table 1
The list and sequences of used primers for gene expression analysis.
Gene | Forward/ Reverse | Sequence (5′-3′) | Length | Accession Number |
BAX | Forward | GACTCCCCCCGAGAGGTCTT | 121 | NM_004324 |
Reverse | ACAGGGCCTTGAGCACCAGTT |
BCL-2 | Forward | CTGTGGATGACTGAGTACCTG | 127 | NM_000633 |
Reverse | GAGACAGCCAGGAGAAATCA |
Caspase-9 | Forward | CTGTCTACGGCACAGATGGAT | 177 | NM_001229 |
Reverse | GGGACTCGTCTTCAGGGGAA |
GAPDH | Forward | CAAGATCATCAGCAATGCCT | 166 | NM_002046 |
Reverse | GCCATCACGCCACAGTTTCC |
2.10. Statistical analysis
To determine if there were any significant differences between the groups, we utilized the analysis of variance (ANOVA) method and then followed up with Dennett’s test. We conducted all statistical analyses using GraphPad Prism version 6.01. We considered a P-value less than 0.05 to be statistically significant. In order to ensure accuracy, we conducted three separate tests on each set of data gathered during our investigation.