Biomarker discovery research for the detection of porcine in processed meat products continues with the aim of obtaining sensitive, specific, stable, and accurate biomarkers. Genes in mitochondrial DNA can be used as genetic sources to find biomarkers for porcine detection. This study is concerned with constructing a Real-Time primer from the ND4L gene, one of the DNA mitochondrial genes, for porcine detection in food and determining its potency for biomarker candidates. The SYBR Green fluorescent dye signal detected the amplification process of PCR.
A primer is a short DNA sequence that forms complementary base pairs with a DNA template and is a crucial component of PCR. Primers must be highly specific and sensitive to copy the target sequence (Bustin et al. 2020). A pair of primers covering 133 bp of the ND4L gene from the Sus scrofa genetic sequences was successfully designed with forward 5’ TCATTATAGCATTCACGATTGCCC ‘3 and reverse 5’ TGTGTGTTTAGGACAATTAGAGTCG ‘3. Quality primer was checked using an in-silico analysis. The primer has met the general criteria for RT-PCR. Primer lengths of forward and reverse were 24 and 25 bp, respectively. Then, GC content reached 41.7% and 40% for forward and reverse primers, respectively. The other parameter, temperature melting primer was around 63oC with no hairpin formation in primer, while the melting curve prediction of the amplicon was 81.25oC based on Umeltz Quartz analysis. Characterization primers to increase successful amplification, i.e., primer length (18–24 bp), annealing temperature (60-65oC), GC content of around 50%, and no secondary structures (Bustin et al. 2020). Our primer design was still in the range of good primary criteria. For specificity primer, 30 non-targeted species were checked by BLAST-based on the nr sequence database, and all showed negative. Figure 1 shows the primer location in the ND4L gene (according to NCBI Accession No. MK251046). In laboratory analysis, optimized analysis showed the primer successfully amplified the porcine DNA with an annealing temperature of 65oC and a melting curve at 78oC (Fig. 2). The amplicon was detected through the SYBR Green fluorescent dye signal.
Repeatability ND4L primer
Repeatability tests are a part of the validity parameters of quantitative PCR. Amplification repeat was performed six times (six tubes) per PCR running with 20 ng/µL of porcine DNA template concentration under the same condition and time (on the same day). Two operators run in this analysis with the same RT PCR machine. Figures 2 and Table 1 show each operator's amplification and melting curves for the repeatability test. The repeatability and reproducibility analysis showed the primer ND4L amplified porcine DNA consistently under the same methods and laboratory conditions (Fig. 2 and Table 1). Repeatability (r) is defined as the ability of a method to produce the same results for replicating qPCR analyses in the same laboratory. Repeatability values represent the maximum expected difference (with 95% probability) between two independent test results with the same method and laboratory for identification samples (Ebentier et al. 2013).
Table 1
Average, standard deviation, and coefficient of variation of Cq and Tm (oC) ND4L primer on porcine DNA (20 ng/µL) in different operators
Rep | Running | Op | Average ± SD of Cq | CV of Cq (%) | Average CV of Cq (%) | Average ± SD of Tm (oC) | CV of Tm (%) | Average CV of Tm (%) |
1 | 1st | A | 12.13 ± 0.09 | 4.00 | 3.21 ± 0.79 | 78.17 ± 0.08 | 0.09 | 0.08 ± 0,01 |
2 | 2nd | A | 12.43 ± 0.29 | 2.41 | | 78.25 ± 0.05 | 0.07 | |
Average Operator A | 12.28 ± 0.26 | | | 78.21 ± 0.08 | | |
3 | 1st | B | 11.74 ± 0.54 | 4.56 | 2.94 ± 2.29 | 78.18 ± 0.07 | 0.09 | 0.08 ± 0,01 |
4 | 2nd | B | 11.47 ± 0.15 | 1.32 | | 78.23 ± 0.05 | 0.07 | |
Average Operator B | 11.61 ± 0.40 | | | 78.21 ± 0.07 | | |
Average | 11.95 ± 0.48 | 4.01 | | 78.21 ± 0.07 | 0.09 | |
Rep = replication (6 tubes per running); Op = operator; CV = Coefficient of Variation; SD = Standard Deviation |
In addition, the coefficient variation (CV) value Ct and Tm of primer ND4L was low in Cq, melting curve, and operator treatments. The CV% value reached 3.21% (Ct) and 0.08% (Tm) for operator A. However, the CV% value in operator B (Ct value) was lower (Fig. 2 and Table 1) with the maximum value is 100%. The Coefficient of Variation (%), also known as the Relative Standard Deviations (RSD) value represents both values' validity (Ebentier et al. 2013; Plura et al. 2023). There are four classifications of CV value: Low (less than 2.44), intermediate (between 2.44 and 7.94), high (between 7.94 and 9.78), and very high (greater than 9.78) with a maximum value of 1. The smaller the coefficient of variation (CV) value represented, the greater the homogeneity of the data and the smaller the variation (Romano et al. 2005). While the RSD value is one of the acceptance parameters of RT-PCR analysis and is ≤ 25% (Broeders et al. 2014). The ND4L primer has high precision and acceptance for the porcine detection method
The test's sensitivity was typically assessed using the Limit of Detection (LOD) test. The LOD is the smallest amount or concentration of analyte that can be detected in samples (Currie 1999). The primer's sensitivity (Limit of Detection/LOD) was evaluated using absolute and relative methods (Rohman et al. 2020). The absolute LOD was determined by serially diluting the DNA concentration. At the same time, the relative LOD was obtained by using a binary mixture of pork meat and beef (with varying levels of adulteration). The serial diluted pork DNA concentration was created to achieve absolute LOD from 50,000 pg/µL to 0.5 pg/µL. The primer was successfully amplified up to 5 pg/µL (Fig. 3 and Table 2) with a Cq value of 23.36 ± 0.26, but the melting curve was not detected. For relative LOD, we constructed a binary mixture of raw beef and pork meat with varying levels of pork meat (0.001%, 0.01%, 0.1%, 0.5%, 1%, 10%, 25%, 50%, and 75%). The study successfully detected 0.001% pork meat adulteration in beef meat with a Cq of 25.01 ± 0.97, but Tm was not detected (refer to Fig. 4 and Table 3).
Table 2
Limit of detection porcine DNA (absolute LOD) of ND4L primer
DNA concentration | Avg Cq ± SD value | CV (%) | Avg Tm value ± SD (oC) | CV (%) |
50,000 pg/µL | 10.36 ± 0.22 | 2.08 | 78.23 ± 0.06 | 0.07 |
5,000 pg/µL | 13.55 ± 0.21 | 1.55 | 78.30 ± 0.10 | 0.13 |
500 pg/µL | 16.80 ± 0.26 | 1.57 | 78.47 ± 0.06 | 0.07 |
50 pg/µL | 19.91 ± 0.15 | 0.77 | 78.93 ± 0.06 | 0.07 |
5 pg/µL | 23.36 ± 0.26 | 1.12 | - | - |
SD: Standard Deviation; CV: Coefficient of Variation; Avg: Average; Tm: Temperature Melting |
Table 3
Limit of detection porcine DNA (relative LOD) of ND4L primer
Binary mixture of pork to beef meat (%) | Cq ± SD value | CV (%) | Tm value ± SD (oC) | CV (%) |
0.001 | 25.01 ± 0.97 | 3.87 | - | - |
0.01 | 23.25 ± 0.41 | 1.78 | 79.30 ± 0.53 | 0.67 |
0.1 | 21.26 ± 0.37 | 1.72 | 78.97 ± 0.46 | 0.58 |
0.5 | 19.28 ± 0.36 | 1.89 | 78.57 ± 0.29 | 0.37 |
1 | 18.30 ± 0.37 | 2.02 | 78.40 ± 0.17 | 0.22 |
10 | 14.86 ± 0.47 | 3.14 | 78.10 ± 0.17 | 0.22 |
25 | 13.71 ± 0.50 | 3.66 | 78.17 ± 0.12 | 0.15 |
50 | 12.92 ± 0.51 | 3.92 | 78.17 ± 0.12 | 0.15 |
75 | 11.61 ± 0.45 | 3.85 | 78.13 ± 0.06 | 0.07 |
SD: Standard Deviation; CV: Coefficient of Variation; Avg: Average; Tm: Temperature Melting |
The ND4L primer (this study) has a high detection sensitivity (LOD reached 5pg/ µL and 0.001% for binary meat mixture) and well performance. While in previous studies, cytochrome b primer successfully detected a minimum DNA concentration of 5 ng/µL and 0.5% binary mixture of raw meat (Maryam et al. 2016). While (Orbayinah et al. 2019), also used the cytochrome b gene and obtained 10 ng/µL in meatball adulteration pork-beef. Both studies used the EvaGreen dye signal for amplicon detection. In the other study, the primer d-loop gene with TaqMan probe detected 5 pg/µL of pork meatball DNA and 5% of meatball pork-beef (Orbayinah et al. 2020).
In PCR analysis, the efficiency of PCR became an essential parameter for evaluating primers during amplification processes. The standard curve on PCR aimed at PCR efficiency assessment (Larionov et al. 2005). PCR efficiency of both DNA and binary mixture meat (pork-beef) in ND4L primer showed good primer performance with a value above 90 and below 110% (within the normal range) (Fig. 5). Based on a DNA sample from fresh meat, PCR efficiency reached 94% with an R2 (correlation coefficient) value of 0.99984 and a slope of -3.23. Meanwhile, the pork-beef binary meat mixture showed 104% PCR efficiency in DNA from the binary mixture, an R2 value of 0,99616, and a slope of -3.48. Hence, the result indicates that the primer ND4L has high efficiency and reproducibility. The high correlation coefficient (R2) and PCR efficiency also showed the high precision of quantitative PCR assay (Bustin et al. 2009).
The specificity of ND4L primer
Primers are a crucial component of PCR that determines accurate detection through specificity, sensitivity, and robustness analysis (Bustin et al. 2020). Specificity primer is an essential parameter validation for porcine DNA detection because of the many species of animals present in food and feedstuff products (Martín et al. 2009). This study, the ND4L primers were tested with 30 samples of non-target species commonly encountered in food processing products and two species Sus scrofa (pig and wild boar). ND4L primer was specifically only amplified in pig and wild boar (Fig. 6) and negatively amplified for 30 non-pig animals (Fig. 7, Table 4). This result showed that the ND4L primer has higher specificity than the other primer. A previous study used different animal species for sensitivity tests (including validation tests). Cytochrome b primer was specific to pig species and not amplified in nine non-pig species targets (bovine, buffalo, chicken, duck, goat, horse, ostrich, sheep, and turkey) (Lubis et al. 2018). Then, the ND5 primer gene was also specific only in pig species and not amplified in five animal species, such as donkeys, cats, rats, dogs, and monkeys (Denyingyhot et al. 2021). Karabasanavar et al. (2014) obtained the highest primer specificity rate. Their D-loop primers did not bind to 24 animal species (mammals, fish, birds, rats) and only bind porcine DNA. Interestingly, pork primer from the ND4L gene is highly specific to non-target animal species (30 species) generally found in food processing products. It proved that the ND4L primer has a highly specific primer.
Table 4
Specificity of ND4L primer for porcine detection method with 20 ng/µL concentration
No | Species | Theoretically expected (NCBI database) | | |
Representative sequences database | nr database | Average ± SD of Cq value | Average ± SD of Tm value |
1 | Pig (Sus scrofa domesticus) | P | P | 12.26 ± 0.24 | 78.24 ± 0.09 |
2 | Wild boar (Sus scrofa) | P | P | 18.47 ± 0.76 | 78.06 ± 0.15 |
3 | Cattle (Bos taurus) | N | N | N (0/3) | N (0/3) |
4 | Chicken (Gallus gallus domesticus) | N | N | N (0/3) | N (0/3) |
5 | Sheep (ovis aries) | N | N | N (0/3) | N (0/3) |
6 | Goat (capra hircus) | N | N | N (0/3) | N (0/3) |
7 | Duck (Anas platyrhynchos) | N | N | N (0/3) | N (0/3) |
8 | Buffalo (bubalus bubalis) | N | N | N (0/3) | N (0/3) |
9 | Horse (Equus caballus) | N | N | N (0/3) | N (0/3) |
10 | Rabbit (Oryctolagus cuniculus) | N | N | N (0/3) | N (0/3) |
11 | Salmon fish (Oncorhynchus nerka) | N | N | N (0/3) | N (0/3) |
12 | Pangas Catfish (Pangasius pangasius) | N | N | N (0/3) | N (0/3) |
13 | Catfish (Clarias batrachus) | N | N | N (0/3) | N (0/3) |
14 | Tuna fish (Thunnus albacares) | N | N | N (0/3) | N (0/3) |
15 | Spanish Mackerel (Scomberomorus commersonii) | N | N | N (0/3) | N (0/3) |
16 | Nile Tilapia (Oreochromis niloticus) | N | N | N (0/3) | N (0/3) |
17 | Pomfret fish (Pampus argenteus) | N | N | N (0/3) | N (0/3) |
18 | Kawakawa or mackerel tuna fish (Euthynnus affinis)) | N | N | N (0/3) | N (0/3) |
19 | Eel (Monopterus albus) | N | N | N (0/3) | N (0/3) |
20 | Shrimp (Litopenaeus vannamei) | N | N | N (0/3) | N (0/3) |
21 | Octopus (Octopus vulgaris) | N | N | N (0/3) | N (0/3) |
22 | Blood clams (Anadara granosa) | N | N | N (0/3) | N (0/3) |
23 | Green Mussels (Perna viridis) | N | N | N (0/3) | N (0/3) |
24 | Babylon Snail (Baylonia spirata) | N | N | N (0/3) | N (0/3) |
25 | Frog | N | N | N (0/3) | N (0/3) |
26 | Dog (Canis lupus familiaris) | N | N | N (0/3) | N (0/3) |
27 | Rat (Rattus norvegicus) | N | N | N (0/3) | N (0/3) |
28 | Squid (Loligo duvauceli) | - | N | N (0/3) | N (0/3) |
29 | Dori fish (Zeus faber) | - | N | N (0/3) | N (0/3) |
30 | White snapper fish (Lates calcarifer) | - | N | N (0/3) | N (0/3) |
31 | Tilapia | - | N | N (0/3) | N (0/3) |
32 | Mackerel (Rastrelliger sp) | - | N | N (0/3) | N (0/3) |
Note: P (positive); N (negative) |
A comparative test of primer ND4L with the commercial product for pork detection
The ND4L primer (our design) was compared to a porcine detection kit (commercial) product to determine the effectiveness of our primer design. ND4L primer used PCR mastermix containing SYBR Green fluorescent dye, while the commercial product used a primer probe with FAM labeled. Samples included various food processing types such as raw meat, meat floss, marshmallow, sausage, capsule, and gelatin. The results showed that porcine detection analysis using ND4L primer with SYBR Green and the commercial product was almost similar to the results analysis or had the same performance based on Ct value with commercial kit porcine detection (Table 5, Fig. 8). The products with low DNA (gelatin) could be detected using ND4L primer (SYBR green dye). To strengthen these findings, 52 samples of commercial processed meat products were tested for porcine DNA. This study analyzed various types of processed meat (simple – complicated processes) that were commonly found in the market, including floss, jerky, meatballs, sausages, dumpling, rendang meat, skin crackers, lungs chips, satay, smoked meat, and cornets. ND4L primer (SYBR Green dye) successfully detects pork DNA in various meat-processed products (20 of 52 samples) according to claim in their packages (Table 6, Fig. 9).
Table 5
Cq dan TM value on porcine detection from meat and food products using primer ND4L (SYBR Green dye) and commercial kit
No | Food products | Primer ND4L with SYBR Green dye | Commercial product kit for porcine detection |
Cq | TM (oC) | Cq |
1 | Shell capsule | Negative | Negative | Negative |
2 | Marshmallow | Negative | Negative | Negative |
3 | Chicken meat | Negative | Negative | Negative |
4 | Goat meat | Negative | Negative | Negative |
5 | Beef sausage | Negative | Negative | Negative |
6 | Pork | 14,42 | 78,4 | 20,31 |
7 | Beef meat | Negative | Negative | Negative |
8 | Pork Floss | 12,41 | 78,1 | 19,62 |
9 | Pig Gelatin | 28,85 | ND | 35,06 |
10 | Pork meatball | 11,79 | 78,1 | 20,58 |
ND: not detected |
Table 6
Porcine detection on commercial processed meat products using ND4L primer (*)
Products | Claim | Porcine detection |
Cq value | Tm (oC) value |
Floss1 | Beef | N (0/3) | N (0/3) |
Floss2 | Beef | N (0/3) | N (0/3) |
Floss3 | Beef | N (0/3) | N (0/3) |
Floss4 | Beef | N (0/3) | N (0/3) |
Floss5 | Beef | N (0/3) | N (0/3) |
Floss6 | Beef | N (0/3) | N (0/3) |
Floss7 | Beef | N (0/3) | N (0/3) |
Floss8 | Beef | N (0/3) | N (0/3) |
Floss9 | Pork | 13.13 ± 0.04 | 77.57 ± 0.06 |
Floss10 | Pork | 15.50 ± 0.24 | 77.90 ± 0.00 |
Jerky1 | Beef | N (0/3) | N (0/3) |
Jerky2 | Beef | N (0/3) | N (0/3) |
Jerky3 | Beef | N (0/3) | N (0/3) |
Skin crackers1 | Beef | N (0/3) | N (0/3) |
Skin crackers2 | Beef | N (0/3) | N (0/3) |
Skin crackers3 | Pig | 10.95 ± 0.37 | 77.67 ± 0.06 |
Skin crackers4 | Pig | 12.93 ± 0.06 | 78.17 ± 0.06 |
Skin crackers5 | Pig | 10.33 ± 0.22 | 77.73 ± 0.06 |
Lung chips | Beef | N (0/3) | N (0/3) |
Cornet1 | Beef | N (0/3) | N (0/3) |
Cornet2 | Pork | 9.80 ± 0.14 | 77.73 ± 0.06 |
Cornet3 | Pork | 10.72 ± 0.22 | 77.53 ± 0.06 |
Sausage1 | Chicken | N (0/3) | N (0/3) |
Sausage2 | Beef and Chicken | N (0/3) | N (0/3) |
Sausage3 | Beef and Chicken | N (0/3) | N (0/3) |
Sausage4 | Beef | N (0/3) | N (0/3) |
Sausage5 | Beef | N (0/3) | N (0/3) |
Sausage6 | Chicken | N (0/3) | N (0/3) |
Sausage7 | Beef and Chicken | N (0/3) | N (0/3) |
Sausage8 | Beef and Chicken | N (0/3) | N (0/3) |
Sausage9 | Beef and Chicken | N (0/3) | N (0/3) |
Sausage10 | Beef and Chicken | N (0/3) | N (0/3) |
Sausage11 | Beef | N (0/3) | N (0/3) |
Sausage12 | Beef and Chicken | N (0/3) | N (0/3) |
Sausage13 | Pork | 15.72 ± 0.10 | 77.67 ± 0.06 |
Sausage14 | Pork | 11.33 ± 0.67 | 77.70 ± 0.10 |
Meatball1 | Beef | N (0/3) | N (0/3) |
Meatball2 | Beef | N (0/3) | N (0/3) |
Meatball3 | Beef | N (0/3) | N (0/3) |
Meatball4 | Beef | N (0/3) | N (0/3) |
Meatball5 | Beef | N (0/3) | N (0/3) |
Meatball6 | Pork | 12.16 ± 0.55 | 77.77 ± 0.23 |
Meatball7 | Pork | 9.89 ± 0.09 | 77.63 ± 0.06 |
Meatball8 | Pork | 9.65 ± 0.07 | 77.70 ± 0.10 |
Meatball9 | Pork | 11.97 ± 0.77 | 77.97 ± 0.15 |
Meatball10 | Pork | 11.21 ± 0.12 | 77.79 ± 0.09 |
Meatball11 | Pork | 9.32 ± 0.04 | 77.73 ± 0.06 |
Meatball12 | Pork | 8.86 ± 0.06 | 78.00 ± 0.10 |
Satay | Pork | 11.37 ± 0.09 | 77.97 ± 0.12 |
Smoked meat | Pork | 10.77 ± 0.32 | 77.83 ± 0.06 |
Dumpling | Pork | 11.00 ± 0.12 | 77.47 ± 0.06 |
Rendang meat | Pork | 13.32 ± 0.70 | 77.87 ± 0.06 |
(*) Samples detection was repeated three times (triplo), N: Negative |