Wnt8b Regulates Myofibroblast Differentiation of Lung-Resident Mesenchymal Stem Cells via the Activation of Wnt/β-catenin Signaling in Pulmonary Fibrogenesis

doi:10.21203/rs.3.rs-466908/v1

Download PDF

Research

Wnt8b Regulates Myofibroblast Differentiation of Lung-Resident Mesenchymal Stem Cells via the Activation of Wnt/β-catenin Signaling in Pulmonary Fibrogenesis

https://doi.org/10.21203/rs.3.rs-466908/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Apr, 2022

Read the published version in Differentiation →

Version 1

posted

You are reading this latest preprint version

Background

Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and fatal lung disease that is characterized by enhanced changes in stem cell differentiation and fibroblast proliferation. Lung resident mesenchymal stem cells (LR-MSCs) are important regulators of pathophysiological processes including tissue repair and inflammation, and evidence suggests that this cell population also plays an essential role in fibrosis. Our previous study demonstrated that Wnt/β-catenin signaling is aberrantly activated in the lungs of bleomycin-treated mice and induces myofibroblast differentiation of LR-MSCs. However, the underlying correlation between LR-MSCs and the Wnt/β-catenin signaling remains poorly understood.

Methods

We used mRNA microarray, immunohistochemistry assay, qRT-PCR, and western blotting to measure the expression of Wnt8b in myofibroblast differentiation of LR-MSCs and BLM-induced mouse fibrotic lungs. Immunofluorescence staining and western blotting were performed to analyze myofibroblast differentiation of LR-MSCs after overexpressing or silence Wnt8b. Moreover, we analyzed the effects of Wnt8b inhibition on BLM-induced pulmonary fibrosis by Sirius Red Staining and immunohistochemical staining.

Results

We found that Wnt8b was highly expressed by LR-MSCs undergoing myofibroblast differentiation. In vitro, Wnt8b promoted LR-MSCs differentiate into myofibroblasts via activating Wnt/β-catenin signaling. Moreover, siRNA-mediated inhibition of Wnt8b prevented Transforming growth factor (TGF)-β1-induced myofibroblast differentiation of LR-MSCs in vitro and ameliorated pulmonary fibrotic lesions.

Conclusions

Our study identified Wnt proteins and Wnt/β-catenin signaling in pulmonary fibrosis in vitro and in vivo, and highlighted Wnt8b as a potential therapeutic target in pulmonary fibrosis. Moreover, these finding might provide a new perspective in the development of treatment strategies for IPF.

Immunology

Lung resident mesenchymal stem cell

Wnt8b

Wnt/β-catenin signaling

Idiopathic pulmonary fibrosis

Idiopathic pulmonary fibrosis (IPF) is a progressive and usually fatal lung disease characterized by stem cell differentiation, fibroblast proliferation and extracellular matrix remodeling, which results in irreversible distortion of the lung’s architecture [1, 2]. Although its causes remain to be elucidated fully, our group did a lot of work to understand the myofibroblast differentiation of lung resident mesenchymal stem cells (LR-MSCs) involved in the biological processes of IPF [3–5]. Tissue mesenchymal stem cells (MSCs) are generally believed to exist in most mammalian organs, including the lung, and to play a significant role in the development of fibrotic diseases [6]. MSCs are adult connective tissue progenitor cells with multilineage differentiation potential that can be induced to differentiate into various cell types [6]. These LR-MSCs possess typical characteristics shared by other tissue-specific MSCs, including self-renewal ability, multipotent differentiation capacity, and autocrine or paracrine properties [7, 8]. Importantly, these cells can be driven by local profibrotic factors to undergo a myofibroblast transition that participates in the development of pulmonary fibrosis [9]. However, the roles of LR-MSCs involved in the progression of IPF are largely unknown.

Our previous study demonstrated that Wnt/β-catenin signaling is aberrantly activated in the lungs of bleomycin-treated mice and induces myofibroblast differentiation of LR-MSCs [10]. This profibrotic pathway is mediated by Wnt proteins, a family of 19 secreted glycoproteins [11]. Aberrant activation of Wnt/β-catenin signaling that is mediated by altered expressions of Wnt proteins has been reported to be implicated in various diseases, including renal, pulmonary, and liver fibrosis [12–14]. Recent studies demonstrated that the expression levels of Wnt ligands were low in normal lungs but markedly elevated in the lungs of IPF patients [15–17]. Therefore, these Wnt proteins with altered expression may play critical role in myofibroblast differentiation of LR-MSCs involved in the development of IPF. However, the exact mechanisms of Wnt proteins in the development and progression of IPF remains unknown.

In the present study, we examined gene expression patterns of myofibroblast differentiated LR-MSCs by microarrays. We identified extremely increased expression of Wnt8b in the differentiation of LR-MSCs and lung fibrosis. In particularly, we demonstrated that Wnt8b could promote LR-MSCs differentiate into myofibroblasts by activating Wnt/β-catenin signaling. Silence of Wnt8b could suppress transforming growth factor (TGF)-β1-mediated myofibroblast differentiation of LR-MSCs. Furthermore, targeted inhibition of Wnt8b could evidently suppress the development of pulmonary fibrosis. Thus, our study identified Wnt proteins and Wnt/β-catenin signaling in pulmonary fibrosis in vitro and in vivo, and highlighted Wnt8b as a potential therapeutic target in pulmonary fibrosis.

Antibodies and reagents

The antibodies against mouse β-actin (ab8277), rabbit polyclonal antibody against mouse β-catenin (ab32572), rabbit polyclonal antibody against mouse alpha smooth muscle actin (α-SMA, ab5694), rabbit monoclonal antibody against mouse Vimentin (ab92547), rabbit polyclonal antibody against mouse Collagen I (ab34710), rabbit monoclonal antibody against mouse ATP-binding cassette protein G2 (ABCG-2) (ab207732) were purchased from Abcam (Cambridge, MA). Rabbit anti-fibronectin antibody (F3648) was obtained from Sigma. Goat polyclonal antibody against mouse Wnt8b (AF3367) was purchased from R&D (Minneapolis, MN). The secondary horseradish peroxidase (HRP)-conjugated antibodies, Alexa Fluor 488– and Alexa Fluor 594–coupled goat anti-rabbit or anti-mouse and donkey anti-goat IgG, fetal bovine serum (FBS), and supplements were obtained from Fisher Scientific. Dulbecco’s modified Eagle’s medium (DMEM) was obtained from American Type Culture Collection (ATCC, Manassas, VA). All other chemicals of analytic grade were obtained from Fisher Scientific unless otherwise indicated.

Cell culture and transfection

Isolation of LR-MSCs was performed as previously reported [3, 18]. Freshly isolated LR-MSCs were cultured at a concentration higher than 10⁵ cells/ml with DMEM containing 15% FBS, 4% L-glutamine, 1% nonessential amino acids, and 1% penicillin and streptomycin, and maintained in a humidified atmosphere of 95% air, 5% CO₂ at 37 ℃. The cells were passaged 1:2 using 0.25% trypsin when they reached 70–90% confluence. Transfections were performed with lentiviral protocols provided by GENECHEM (Shanghai, China). The LV-Wnt8b and LV-Wnt8b-RNAi were synthesized by GENECHEM. The transfection efficiency was measured by quantitative real-time PCR (qRT-PCR) and western blot.

Quantitative real-time PCR

For analysis of mRNA, HiScript 1st strand cDNA Synthesis Kit (Vazyme Biotech Co., Nanjing, China) was used for RT-PCR reaction. Gene expression was quantified by SYBR Green Q-PCR Kit (Roche, Germany) using the ABI Prim 7300 Sequence Detection System (Applied Biosystems, Foster city, CA). Specific primers for mRNAs are listed in Table 1. The Ct values were analyzed using the ΔΔCt method and relative changes of mRNA levels were obtained by normalization to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) relative to the control.

Table 1

Primers used for PCR analysis.
Genes	Forward primer	Reverse primer
α-SMA	CCCAGATTATGTTTGAGACCTTC	ATCTCCAGAGTCCAGCACAATAC
Vimentin	CCTGGAGTCACTTCCTCTGGTTG	TCTTGCTGGTACTGCACTGTTGC
Collagen I	CTTCTGGTCCTCGTGGTCTCCCT	AAGCCTCGGTGTCCCTTCATTCC
Wnt8b	CCAGAGTTCCGGGAGGTAG	GAGATGGAGCGGAAGGTGT
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA

Western blot analysis

Tissue or cell lysates were prepared and separated on SDS-polyacrylamide gels as described previously [4]. The PVDF membrane with transferred proteins was probed with various antibodies, and the signals on the membrane were visualized by an Odyssey Scanning System (LI-COR, Lincoln, NE).

mRNA expression assays and analysis

The mRNA microarray analysis was performed by Affymetrix Mouse Exon ST 1.0 microarray chips (Invitrogen, Shanghai, China). mRNAs with expression values of greater than 2-fold-change compared to controls were regarded as overexpressed while less than 0.5 (log scale)-fold-change were considered as under-expressed.

Immunofluorescent staining

The immunofluorescence analysis was performed as previously described28. Rabbit anti-Collagen I, mouse anti-α-SMA, Rabbit anti- Vimentin, Rabbit anti-β-catenin, Rabbit anti-ABCG2 and Goat anti-Wnt8b were employed as the primary antibodies. Alexa Fluor 594- or Alexa Fluor 488-conjugated goat anti-mouse/rabbit IgG (Invitrogen) and Alexa Fluor 594-conjugated donkey anti-goat IgG (Invitrogen) were used as the secondary antibody. Nuclei were stained with 1 µg/ml 4',6-diamidino-2-phenylindole (DAPI; Sigma). The images were captured using a confocal fluorescence microscope (Olympus, Tokyo, Japan).

Induction and treatment of pulmonary fibrosis.

All animal procedures were conducted in accordance with humane animal care standards approved by the Nanjing University Ethics Committee (Nanjing, China) and maintained under specific pathogen-free conditions. The animals were acclimated to the environment for 1 week prior to treatment. The mice were administered with bleomycin (BLM, Nippon Kayaku, Tokyo, Japan) intratracheally at a dose of 5 mg/kg dissolved in a total of 50 µl sterile saline. The control group was similarly treated with 50 µl of sterile saline. The lentiviral vector of LV-Wnt8b and LV-Wnt8b-RNAi were purchased from GENECHEM. Mice were administered with the lentiviral vector intratracheally at a dose of 2 × 10⁸ TU/ml diluted by sterile saline. Seven days later, the LV- Wnt8b and LV- Wnt8b-RNAi groups were administered with BLM intratracheally at a dose of 5 mg/kg dissolved in a total of 50 µl sterile saline. The LV-NC groups were similarly treated with 50 µl sterile saline. The mice were sacrificed for lung collection at day 14 after BLM administration (n = 6 for each time point).

Histopathology

The mouse lungs were inflated with a neutral buffered formalin solution overnight and embedded in paraffin before sectioning into 5 µm-thick slices. The sections were stained with hematoxylin–eosin for structure observation.

Immunohistochemistry and Sirius Red staining

Paraffin-embedded lung tissue was sectioned at 5 µm and then subjected to Sirius Red or immune staining [14]. Briefly, tissue sections were deparaffinized, hydrated, and antigen-retrieved, followed by Sirius Red/Fast Green Collagen Staining Kit (Chondrex, MA), the sections were stained in dye solution and mixed with a dye extraction buffer. The dye solutions were collected and their O.D. values were read by a microplate reader. Or the sections incubated with primary and secondary antibodies for immune staining. Sections stained without primary antibodies served as negative controls. The DAB or AEC Substrate System (DAKO) was used to reveal the immunohistochemical staining.

Statistical analysis

All the experimental data were presented as mean ± S.E. Statistical analysis of data were performed using SigmaStat 3.5 software (Jandel Scientific Software). Comparison between multiple groups was performed by using one-way analysis of variance (ANOVA) followed by the Student–Newman–Keuls test or Student’s t test between two groups. A p value of less than 0.05 was considered statistically significant.

LR-MSCs could differentiate into myofibroblasts in vitro

The primary LR-MSCs from mouse lung tissue could differentiate into myofibroblasts in the treatment of TGF- β1, (10 ng/ml) [14, 18]. As shown in the Fig. 1, immunofluorescence assay, qRT-PCR and western blotting were used to measure the expression of collagen I, α-SMA and Vimentin. The major markers of myofibroblast differentiation were increased during the incubation with TGF- β1 for 3 and 7 days.

Wnt8b was upregulated both in myofibroblast differentiation of LR-MSCs and BLM-induced mouse fibrotic lungs

To detect the expressions of the Wnt genes during the myofibroblast differentiation of LR-MSCs, we performed an mRNA microarray with total RNAs isolated from LR-MSCs harvested on day 7 after TGF-β1 (10 ng/ml) treatment. The expressions of 459 mRNAs were changed significantly (2 − ΔΔCT > 2-fold or < − 2-fold, or p-value < 0.05). There are 267 genes up-regulated, among the 267 genes, Wnt8b expression was upregulated (P-value: 0.0274). To confirm the microarray data, immunofluorescence assay, qRT-PCR and western blotting were used to measure the expression of Wnt8b. As shown in Fig. 2 (A-G), the mRNA and protein levels of Wnt8b were significantly increased in both myofibroblast differentiation of LR-MSCs and fibrotic lung tissues. We also confirmed these findings by using immunohistochemistry (IHC) staining in the fibrotic lung tissues (Fig. 2H).

To determine whether the Wnt8b was expressed in LR-MSCs during the development of fibrosis, the fibrotic lung tissue sections were double stained with ABCG-2 and Wnt8b. The results demonstrated that the expression of Wnt8b was upregulated in LR-MSCs (Fig. 2I), indicating Wnt8b involved in the myofibroblast differentiation of LR-MSCs and the development of pulmonary fibrogenesis.

Wnt8b promoted LR-MSCs differentiate into myofibroblasts via activating Wnt/β-catenin signaling

To determine whether Wnt8b plays a role in myofibroblast differentiation of LR-MSCs, we examined the protein levels of β-catenin, Vimentin and Collagen in LR-MSCs which were transfected with LV-Wnt8b or incubated with Wnt3a (10 ng/ml, positive control). Overexpression of Wnt8b or treated with Wnt3a could increase the expressions of β-catenin, α-SMA, Vimentin and Collagen (Fig. 3D, E). Similarly, the immunofluorescence results showed that the expressions of α-SMA, β-catenin, Vimentin and Collagen were dramatically elevated after transfecting Wnt8b or treated with Wnt3a (Fig. 3F). These data indicated that Wnt8b could promote myofibroblast differentiation of LR-MSCs through activating Wnt/β-catenin signaling.

Silence of Wnt8b could suppress myofibroblast differentiation of LR-MSCs

To further explore the underlying correlation between Wnt8b and LR-MSCs in myofibroblast differentiation, LR-MSCs were transfected with LV-Wnt8b-RNAi followed by incubation in the presence or absence of TGF-β1 (10 ng/ml) for 7 days. LV-Wnt8b-RNAi could successfully restrain the expression of Wnt8b both in mRNA level and protein level (Fig. 4A-E). After LR-MSCs were transfected with LV-Wnt8b-RNAi, TGF-β1-induced expressions of β-catenin, α-SMA, Vimentin and Collagen were significantly suppressed (Fig. 4F, G, H). The data demonstrated that silence of Wnt8b inhibited the myofibroblast differentiation of LR-MSCs induced by TGF-β1, indicating Wnt8b is involved in this differentiation process.

Suppression of Wnt8b could protect mice from BLM-induced pulmonary fibrosis

We further analyzed the effects of Wnt8b inhibition on BLM-induced pulmonary fibrosis. As shown in Fig. 5 (A-C), pulmonary fibrotic lesion and collagen deposition were greatly reduced after LV-Wnt8b-RNAi administration. LV-Wnt8b-RNAi profoundly suppressed the expressions of Wnt8b, β-catenin, Fibronectin and α-SMA as demonstrated by Immunohistochemistry staining (Fig. 5D). In addition, silencing Wnt8b could attenuate the activation of Wnt/β-catenin signaling through impairing the expression of β-catenin. Immunofluorescence staining also revealed that LV-Wnt8b-RNAi retarded myofibroblast activation in BLM-induced pulmonary fibrosis (Fig. 5E and F). These results indicated that inhibition of Wnt8b could repress the activation of Wnt/β-catenin signaling and inhibit pulmonary fibrosis after bleomycin administration.

It is generally believed that tissue-specific stem cells exist in most mammalian tissues. The function of these cells is to maintain tissue homeostasis by suppling new tissue-specific cells either during normal tissue cycling or when existing tissue cells are lost as a result of pathological development [19]. These resident MSCs mediate pathogenic processes largely through the secretion of proscarring, proangiogenic, and immunomodulatory factors [7]. Therefore, LR-MSCs are potentially useful in regenerative therapies in damaged lung tissue repair [9]. It is thus worth exploring the trigger that induces the myofibroblast differentiation of LR-MCSs in IPF. In this study, we revealed the role of Wnt8b and demonstrated a mechanism by which LR-MSCs participate in the development of pulmonary fibrosis.

Previously, we and others have evaluated that Wnt/β-catenin signaling to play a critical role in LR-MSCs fate decisions, Wnt ligands could be expressed in these types of cells [3, 20]. Moreover, activating Wnt/β-catenin signaling could induce LR-MSCs to differentiate into myofibroblasts which were the principal components of myofibroblast foci [14]. The Wnt/β-catenin signaling was mainly activated by Wnt proteins. Several Wnt proteins, including Wnt2, Wnt5a, Wnt7b, Wnt8b, Wnt11 and Wnt13, were expressed in both developing and adult lung [21]. In the present work, firstly we performed a mRNA microarray with total RNAs isolated from LR-MSCs treated with TGF-β1 for 7 days to analysis the expression of Wnt genes. Among the up-regulated genes, we found only Wnt8b was upregulated. Our observation in pulmonary fibrosis is consistent with the acknowledged actions of Wnt molecules in other fibrosis. For example, after unilateral ureteral obstruction, all members of the Wnt family except Wnt5b, Wnt8b, and Wnt9b are upregulated in the fibrotic kidneys with distinct dynamics [12].

Although the expression of Wnt ligands have been shown to be up regulated during the development of IPF, the role of Wnt8b in IPF remains unknown. The present studies showed that Wnt8b is a member of class I Wnt family signaling through β-catenin, and Wnts could regulated cell fate and behavior in the Wnt/β-catenin signaling pathway [22]. Wnt8b has been suggested to be a cancer-related gene through the synergistic activation of the β-catenin signaling [23]. To reveal the role that Wnt8b plays in the myofibroblast differentiation of LR-MSCs, we observed localization of Wnt8b expression in LR-MSCs undergoing pulmonary fibrosis in fibrotic lungs (Fig. 2I). In addition, overexpression of Wnt8b could activate canonical Wnt signaling and promote LR-MSCs to differentiate into myofibroblasts (Fig. 3D and F). Recently, the expression of Wnt8b was shown to play key roles in gastric cancer through activation of the β-catenin / transcription factors (TCF) signaling pathway [23]. Also, Wnt8b exerted a significant influence on phosphate induced vascular calcification (VC) by altering the Wnt/β-catenin signaling pathway. Silencing Wnt8b terminates phosphate-induced VC in vascular smooth muscle cells (VSMCs) by inhibiting the Wnt-β-catenin signaling pathway [24]. Here, we confirmed the contribution of Wnt8b inhibition to the maintenance of LR-MSC quiescence and protection of mice from BLM-induced pulmonary fibrosis (Figs. 4 and 5).

However, the means by which Wnt signaling elicits a biological response largely depends on the combination of Wnt ligands with the corresponding receptors that are present. When Wnt ligands bind to the frizzled (Fzd) receptor along with low-density lipoprotein receptor-related protein (LRP), β-catenin accumulated in the cytoplasm and subsequently translocated into the nucleus, which promote the transcription of target genes [11]. In the previous work we found that Wnt7b, Wnt10a and Fzd10 were induced in LR-MSCs following TGF-β1 treatment and fibrotic lung tissues. Fzd10 knockdown reduced Wnt7b and Wnt10a-induced activation of Wnt/β-catenin signaling, which imply that Wnt7b and Wnt10a may be the ligands for Fzd10 [14]. According to a systematic analysis of Fzd receptor expression, wnt8b and frizzled-3a (fzd3a) genetically interact to regulate the patterning of guidance cues in the rostral forebrain of zebrafish [25]. Wnt8b and Fzd8a can functionally interact to transmit posteriorizing signals that determine the fate of the posterior diencephalon and midbrain of zebrafish [22]. The sonic hedgehog (Shh) signaling is reported to regulate the expression of Wnt molecules by recruiting the transcription factor glioblastoma (Gli) to the promoters of Wnt genes [26]. Gli1 could bound to and increased promoter activity of the Wnt7b and Wnt10a genes, and inhibition of Gli1 suppressed myofibroblast differentiation of LR-MSCs and pulmonary fibrosis [14, 17]. Sine oculis–related homeobox 3 (Six3) directly repressed Wnt8b expression during the neuroretina specification in mouse embryos [27]. SRY-Box Transcription Factor 21 (SOX21) represses Wnt8b expression by interfering with the binding of TCF4/β-catenin complex to the Wnt8b enhancer [28]. The other studies suggested that complex and direct interactions between Wnt8b, and fibroblast Growth Factor 17 (Fgf17) could regulate Gli3 expression [29]. Above all these results indicate a complex mechanism by which regulating the expression of Wnt8b in myofibroblast differentiation of LR-MSCs that involved in fibrosis progression and further studies are needed to clarify the detailed mechanisms. Moreover, the comparison between Wnt10a blockade and Wnt8b inhibition in terms of antifibrotic efficacy and side effects remains to be clarified in future studies.

In summary, our results demonstrate that Wnt8b could promote LR-MSCs differentiate into myofibroblasts by activating Wnt/β-catenin signaling. Silence of Wnt8b could suppress TGF-β1-mediated myofibroblast differentiation of LR-MSCs targeted inhibition of Wnt8b could evidently suppress the development of pulmonary fibrosis. These finding provide strong support for further research that might help clarify the pathogenesis of IPF and indicate that Wnt8b may be a promising therapeutic target for IPF treatment.

ABCG-2: ATP-binding cassette protein G2; ATCC: American Type Culture Collection; α-SMA: alpha smooth muscle actin; BLM: bleomycin; DAPI: 4’,6-Diamidino-2-phenylindole; DMEM: Dulbecco’s modified Eagle’s medium; FBS: fetal bovine serum; Fzd: frizzled; Fzd10: frizzled-10; Fzd8a: frizzled-8a; Fzd3a: frizzled-3a; Fgf17: fibroblast Growth Factor 17; Gli: glioblastoma; Gli1: glioblastoma 1; Gli3: glioblastoma 3; HRP: horseradish peroxidase; IgG: Immunoglobulin G; IPF: Idiopathic pulmonary fibrosis; IHC: immunohistochemistry; LR-MSCs: lung resident mesenchymal stem cells; LRP: lipoprotein receptor-related protein; MSCs: mesenchymal stem cells; PVDF: polyvinylidene fluoride; qRT-PCR: quantitative real-time PCR; SDS: sodium dodecyl sulphate; Shh: sonic hedgehog; Six3: Sine oculi’s–related homeobox 3; SOX21: SRY-Box transcription factor 21; TCF: transcription factors; TGF-β1: transforming growth factor-β1; VC: vascular calcification; VSMCs: vascular smooth muscle cells; WNT: Wingless-type MMTV integration site family; WNT8b: Wingless-type MMTV integration site family, member 8b; WNT3a: Wingless-type MMTV integration site family, member 3a.

Acknowledgements

We also thank Dr. Cong Wang for assistance in data analysis of mRNA microarray.

Author contributions

The authors contributed in the following ways: Chaowen Shi, Xiang Chen and Xiaodong Han were involved in the conception and design of the experiments; Chaowen Shi wrote the manuscript; Chaowen Shi carried out most of the experiments, Xiang Chen and Wenna Yin contributed to some experiments; Zhaorui Sun and Jiwei Hou contributed to the manuscript revision. All the authors contributed to the manuscript preparation and gave final approval of the submitted manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (82000069), Natural Science Foundation of Jiangsu Province of China (BK20200891, BK20200314).

Availability of data and materials

All datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Ethics statement

The animal experiments were performed according to the Guide for the Care and Use of Laboratory Animals (The Ministry of Science and Technology of China, 2006) and all experimental protocols were approved under the animal protocol number SYXK (Su) 2009-0017 by the Animal Care and Use Committee of Nanjing University.

Consent for publication

Not applicable.

Competing interests

The author declares that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Author details

¹Immunology and Reproduction Biology Laboratory & State Key Laboratory of Analytical Chemistry for Life Science, Medical School, Nanjing University, Nanjing, Jiangsu 210093, China. ²Jiangsu Key Laboratory of Molecular Medicine, Nanjing, 210093, China. ³School of Life Sciences, Jiangsu University, Zhenjiang, Jiangsu, 212013, China. ⁴ Department of Emergency Medicine, Jinling Hospital, Medical School of Nanjing University, Nanjing, 210002, China.

Gross T, Hunninghake G: Idiopathic pulmonary fibrosis.The New England journal of medicine 2001, 345:517-525.
Kinoshita T, Goto T: Molecular Mechanisms of Pulmonary Fibrogenesis and Its Progression to Lung Cancer: A Review.International journal of molecular sciences 2019, 20.
Shi C, Lv T, Xiang Z, Sun Z, Qian W, Han X: Role of Wnt/β-Catenin Signaling in Epithelial Differentiation of Lung Resident Mesenchymal Stem Cells.Journal of cellular biochemistry 2015, 116:1532-1539.
Chen X, Shi C, Wang C, Liu W, Chu Y, Xiang Z, Hu K, Dong P, Han X: The role of miR-497-5p in myofibroblast differentiation of LR-MSCs and pulmonary fibrogenesis.Scientific reports 2017, 7:40958.
Wang C, Cao H, Gu S, Shi C, Chen X, Han X: Expression analysis of microRNAs and mRNAs in myofibroblast differentiation of lung resident mesenchymal stem cells.Differentiation; research in biological diversity 2020, 112:10-16.
Jun D, Garat C, West J, Thorn N, Chow K, Cleaver T, Sullivan T, Torchia E, Childs C, Shade T, et al: The pathology of bleomycin-induced fibrosis is associated with loss of resident lung mesenchymal stem cells that regulate effector T-cell proliferation.Stem cells (Dayton, Ohio) 2011, 29:725-735.
Salazar K, Lankford S, Brody A: Mesenchymal stem cells produce Wnt isoforms and TGF-beta1 that mediate proliferation and procollagen expression by lung fibroblasts.American journal of physiology Lung cellular and molecular physiology 2009, 297:L1002-1011.
Hegab A, Kubo H, Fujino N, Suzuki T, He M, Kato H, Yamaya M: Isolation and characterization of murine multipotent lung stem cells.Stem cells and development 2010, 19:523-536.
Foronjy R, Majka S: The potential for resident lung mesenchymal stem cells to promote functional tissue regeneration: understanding microenvironmental cues.Cells 2012, 1:874.
Chen X, Shi C, Meng X, Zhang K, Li X, Wang C, Xiang Z, Hu K, Han X: Inhibition of Wnt/β-catenin signaling suppresses bleomycin-induced pulmonary fibrosis by attenuating the expression of TGF-β1 and FGF-2.Experimental and molecular pathology 2016, 101:22-30.
Nusse R, Clevers H: Wnt/β-Catenin Signaling, Disease, and Emerging Therapeutic Modalities.Cell 2017, 169:985-999.
He W, Dai C, Li Y, Zeng G, Monga S, Liu Y: Wnt/beta-catenin signaling promotes renal interstitial fibrosis.Journal of the American Society of Nephrology : JASN 2009, 20:765-776.
Yu F, Fan X, Chen B, Dong P, Zheng J: Activation of Hepatic Stellate Cells is Inhibited by microRNA-378a-3p via Wnt10a.Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 2016, 39:2409-2420.
Chen X, Shi C, Cao H, Chen L, Hou J, Xiang Z, Hu K, Han X: The hedgehog and Wnt/β-catenin system machinery mediate myofibroblast differentiation of LR-MSCs in pulmonary fibrogenesis.Cell death & disease 2018, 9:639.
Meuten T, Hickey A, Franklin K, Grossi B, Tobias J, Newman D, Jennings S, Correa M, Sannes P: WNT7B in fibroblastic foci of idiopathic pulmonary fibrosis.Respiratory research 2012, 13:62.
Königshoff M, Balsara N, Pfaff E, Kramer M, Chrobak I, Seeger W, Eickelberg O: Functional Wnt signaling is increased in idiopathic pulmonary fibrosis.PloS one 2008, 3:e2142.
Cao H, Chen X, Hou J, Wang C, Xiang Z, Shen Y, Han X: The Shh/Gli signaling cascade regulates myofibroblastic activation of lung-resident mesenchymal stem cells via the modulation of Wnt10a expression during pulmonary fibrogenesis.Lab Invest 2020, 100:363-377.
Shi C, Cao X, Chen X, Sun Z, Xiang Z, Zhao H, Qian W, Han X: Intracellular surface-enhanced Raman scattering probes based on TAT peptide-conjugated Au nanostars for distinguishing the differentiation of lung resident mesenchymal stem cells.Biomaterials 2015, 58:10-25.
Liu L, Rando T: Manifestations and mechanisms of stem cell aging.The Journal of cell biology 2011, 193:257-266.
Wang C, Zhu H, Sun Z, Xiang Z, Ge Y, Ni C, Luo Z, Qian W, Han X: Inhibition of Wnt/β-catenin signaling promotes epithelial differentiation of mesenchymal stem cells and repairs bleomycin-induced lung injury.American journal of physiology Cell physiology 2014, 307:C234-244.
Morrisey E: Wnt signaling and pulmonary fibrosis.The American journal of pathology 2003, 162:1393-1397.
Kim S, Shin J, Park H, Yeo S, Hong S, Han S, Rhee M, Kim C, Chitnis A, Huh T: Specification of an anterior neuroectoderm patterning by Frizzled8a-mediated Wnt8b signalling during late gastrulation in zebrafish.Development (Cambridge, England) 2002, 129:4443-4455.
Saitoh T, Mine T, Katoh M: Expression and regulation of WNT8A and WNT8B mRNAs in human tumor cell lines: up-regulation of WNT8B mRNA by beta-estradiol in MCF-7 cells, and down-regulation of WNT8A and WNT8B mRNAs by retinoic acid in NT2 cells.Int J Oncol 2002, 20:999-1003.
Tian B, Yao L, Sheng Z, Wan P, Qiu X, Wang J, Xu T: Specific knockdown of WNT8b expression protects against phosphate-induced calcification in vascular smooth muscle cells by inhibiting the Wnt-β-catenin signaling pathway.Journal of cellular physiology 2019, 234:3469-3477.
Hofmeister W, Key B: Frizzled-3a and Wnt-8b genetically interact during forebrain commissural formation in embryonic zebrafish.Brain research 2013, 1506:25-34.
Yang S, Andl T, Grachtchouk V, Wang A, Liu J, Syu L, Ferris J, Wang T, Glick A, Millar S, Dlugosz A: Pathological responses to oncogenic Hedgehog signaling in skin are dependent on canonical Wnt/beta3-catenin signaling.Nature genetics 2008, 40:1130-1135.
Liu W, Lagutin O, Swindell E, Jamrich M, Oliver G: Neuroretina specification in mouse embryos requires Six3-mediated suppression of Wnt8b in the anterior neural plate.The Journal of clinical investigation 2010, 120:3568-3577.
Fang Z, Liu X, Wen J, Tang F, Zhou Y, Jing N, Jin Y: SOX21 Ensures Rostral Forebrain Identity by Suppression of WNT8B during Neural Regionalization of Human Embryonic Stem Cells.Stem cell reports 2019, 13:1038-1052.
Hasenpusch-Theil K, Watson J, Theil T: Direct Interactions Between Gli3, Wnt8b, and Fgfs Underlie Patterning of the Dorsal Telencephalon.Cerebral cortex (New York, NY : 1991) 2017, 27:1137-1148.

Download PDF

Journal Publication

published 01 Apr, 2022

Read the published version in Differentiation →

Version 1

posted

You are reading this latest preprint version

Wnt8b Regulates Myofibroblast Differentiation of Lung-Resident Mesenchymal Stem Cells via the Activation of Wnt/β-catenin Signaling in Pulmonary Fibrogenesis

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Materials And Methods

Antibodies and reagents

Cell culture and transfection

Quantitative real-time PCR

Western blot analysis

mRNA expression assays and analysis

Immunofluorescent staining

Histopathology

Immunohistochemistry and Sirius Red staining

Statistical analysis

Results

Wnt8b was upregulated both in myofibroblast differentiation of LR-MSCs and BLM-induced mouse fibrotic lungs

Wnt8b promoted LR-MSCs differentiate into myofibroblasts via activating Wnt/β-catenin signaling

Silence of Wnt8b could suppress myofibroblast differentiation of LR-MSCs

Suppression of Wnt8b could protect mice from BLM-induced pulmonary fibrosis

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Journal Publication

Version 1