Biological material Specimens of both species were collected from fish from the Zemplínska Šírava reservoir (48°47′09.0″N 21°57′20.5″E), eastern Slovakia (detailed information on the collected fish, the process of their processing and parasite collection can be found in Orosová et al. 2023; Marková et al. 2024). Spread chromosome preparations were obtained from both sexes following the "hot plate" technique described in details in Orosová and Špakulová (2018). In brief, slides were incubated in acidic ethanol for 1 hour. A piece of fixed ovarian balls or testis was placed on a dry-cleaned slide in a drop of 60% acetic acid, macerated with tungsten needles and spread on hot plate at 45 ºC. Finally, the preparations were passed through an ethanol series (70%, 80% and 100%, 1 minute each) and stored at − 20 ºC until further use.
Probe synthesis and labeling Genomic DNA was extracted using the QIAamp® DNA mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instruction. Based on the Illumina paired-end sequencing data of A. lucii on the HiSeq 4000 platform at Novogene (HK) Co, Ltd (Hong Kong, China) (authors' unpublished raw dataset), new primers were designed for the amplification of 5S rDNA: Acanth5SF (GTGATCGAACGAGAACCGGT) and Acanth5SR (TCACAAACTTTCGCGCGTTA). Labeled 5S rDNA probe was obtained by standard PCR (35 cycles: initial denaturation step at 95°C for 3 min; 35 cycles of 94°C for 30 s, 59°C for 30 s and 72°C for 90 s; final extension at 72°C for 3 min) with dNTP mix containing 0.35 mM biotin-16-dUTP (Roche Diagnostics). The PCR products were visualized by agarose electrophoresis to verify amplification of the sequences. FISH was performed following the protocol described in Orosová et al. (2023). In brief, after removal from the freezer and dehydration in the ethanol series, slides were air-dried and treated with RNase A (20 µg in 2× SSC) for 1 hour and washed three times at 37°C for 5 minutes in 2× SSC. The amount of biotinylated probes was ∼50 ng per slide. The probes were denatured at 90°C for 5 min and hybridized for ∼20 h at 37°C in a humid chamber. The hybridization signals of the biotin-labeled probes were detected with Cy3-conjugated streptavidin (Jackson ImmunoRes. Labs. Inc., West Grove, PA, USA) and amplified with biotinylated anti-streptavidin (Vector Labs. Inc., Burlingame, CA, USA), which in turn was detected with Cy3-conjugated streptavidin. Finally, chromosomes were counterstained with DAPI in ProLong Antifade Medium (Invitrogen, Carlsbad, CA, USA). Dual color FISH was performed to determine the mutual position of the 18S and 5S rDNA clusters on chromosomes (for details see Orosová et al. 2023). The 18S rDNA probes for both analysed species were labeled with biotin-16-dUTP by nick translation procedure and the 5S rDNA probes with digoxigenin-11-dUTP (Roche Diagnostics, Mannheim, Germany) by PCR. The DIG-labelled probe was detected using anti-digoxigenin-FITC (Sigma-Aldrich). Slides were analyzed using a LEICA DM 4000 B combined light and fluorescence microscope equipped with a DFC 450 C digital camera. Images were captured separately for each fluorescent dye, then pseudocolored and merged using Adobe Photoshop, version 7.0.
In addition, the primers developed in our work were tested by PCR with the DNA of different Acanthocephala species (Bolbosoma vasculosum, Pallisentis rexus, Rhadinorhynchus laterospinosus) deposited in our laboratory (provided by Daniel Barčák). The PCR products were separated in a 1% agarose gel. A single band of the expected size was obtained for all species.
Sequencing Amplified products of 5S rDNA were run out on a 1.5% agarose gel, bands/fragments (approximately 300bp) were dissected from gel, purified using the Wizard SV Gel and PCR Clean-Up System (Promega) according to manufacturer’s instruction and sequenced (SEQme, Dobříš, Czech Republic).