Patient’s sources
Human melanoma tissues were obtained from 112 pathological paraffin samples of patients who had undergone tumor resection at Kaohsiung Veterans General Hospital in Taiwan between October 1990 and October 2019. In addition to these samples, basic information was obtained from the same hospital’s department of pathology. Each sample, along with its basic information, was assigned a serial number without patient identification data. The inclusion criteria are described as follows: the patientshaving a pathological diagnosis of malignant melanoma, belonging to a specific stage of melanoma, and being 20 years of age or older. The exclusion criteria are described as follows: belonging to a certain vulnerable population, and insufficient paraffin samples. The study protocol was approved by the Institutional Review Board of Kaohsiung Veterans General Hospital (IRB approval Nono:. VGHKS19-CT11-06). Malignant melanoma was staged in accordance with the TNM staging criteria established by the American Joint Committee on Cancer (2010). Data regarding patient demographics, risk factors, cancer cell pathological morphology, TNM stage, local and regional recurrence, distant metastasis, and survival status were obtained from the patients’ hospital records. In addition, survival status was confirmed through hospital records. OS was calculated as the date from the first pathological diagnosis of malignant melanoma to the date of all-cause mortality or that of the most recent follow-up.
In situ hybridization analysis (ISH) and grades of ISH expression
After each paraffin section underwent melanin bleaching, ISH was performed to determine the expression levels of LINC00094 in clinical human melanoma specimens, including tumor area, adjacent normal area, and normal control (nevus). Briefly, a DIG-labeled antisense probe was derived from a sequence of lncRNAs, with the expression level of an ISH probe used as a negative control. After hybridization, signals were detected using a polydetector system (BioTnA) per the manufacturer’s instructions. Subsequently, slides were incubated with a mouse anti-DIG antibody for 1 h and washed with phosphate-buffered saline (PBS); this process was followed by the addition of mouse IgG horseradish peroxidase (HRP)-conjugated secondary antibodies at room temperature for 30 min. After the slides had been washed with PBS twice, DAB solution was added. Finally, DAB staining was used to obtain a signal. Analysis of the ISH expression of adjacent normal epidermis tissues with cutaneous melanoma and normal control (intradermal nevus) tissues was also conducted. The grades of ISH expression of cutaneous melanoma are described as follows: no dots (0), 1–3 dots/cell (1), 4–9 dots/cell (2), 10–15 dots/cell with < 10% cells in clusters (3), and > 15 dots/cell with > 10% cells in clusters (4). The area scores were categorized as follows: <5% (0), 5–25% (1), 26–50% (2), 51–75% (3), and 76–100% (4). The expression level of each sample tissue was calculated as the sum of the grade score (0–4) and area score (0–4).
Cell lines with and without metformin treatment
Five human melanoma (A2058, A375, C32, RPMI and MeWo)) cell lines were obtained from the American Type Culture Collection and maintained on Dulbecco’s modified Eagle’s medium supplemented with 10% inactivated fetal bovine serum (Invitrogen, Carlsbad, CA, USA). Both the A2058 and A375 cell lines were treated with metformin at a concentration of 5 mmol/L for 4 days.
LncRNA profiles using Next-generation sequencing
After melanoma cells had been cultured in the presence or absence of metformin for 4 days, total RNA was prepared using TRIzol (Invitrogen) per the manufacturer’s protocol. RNA samples were processed using a strand-specific transcriptome preparation protocol and sequenced using an Illumina platform (Illumina, San Diego, CA, USA). Finally, the sequencing reads were mapped back to the human reference genome (hg19 from the UCSC) by using BLAT, with a minimum identity greater than 95%.
RNAi knockdown of LINC00094 in melanoma cells
Melanoma cells were transfected with RNAi oligonucleotides directed against LINC00094 (Invitrogen), and random sequence siRNA oligonucleotides (Invitrogen) were used as a negative control. In this study, two siRNA were designed for targeting sequencing of LINC00094 (Supplementary Fig. 2). Real-time reverse transcription PCR (RT-PCR) was used 48 h after transfection to confirm the expression of LINC00094.
Cell migration and invasion assays
Cells were tested for their migration and invasion abilities in vitro in Transwell chambers (CoStar, Lowell, MA, USA). Either the lower side or the upper side of polycarbonate Transwell membranes (containing 8-µm pores) were coated with 50 µg/mL type I collagen or 80 µg/well Matrigel and used for migration or invasion assays, respectively. Cells were added to the upper chamber of a Transwell membrane. After incubation for 24 h at 37°C, the cells on the lower side were prepared for Giemsa staining. The level of migration or invasion was determined using a microscope at 200× magnification. All experiments were repeated three times.
Cell proliferation and colony formation assays
To conduct a cell proliferation assay, 1 × 103 melanoma cells were seeded on a 96-well plate and transfected with LINC00094 siRNA (LINC00094-2 or si-LINC00094-3), miR-1270 mimics, or scramble control. Cell proliferation was evaluated on days 0, 1, 2, 3, and 4 by using a CellTiter-Glo One Solution Assay (Promega, Madison, WI, USA). All the experiments were independently repeated three times. To conduct a clonogenic assay, 1 × 103 live cells were deposited onto a six-well plate and transfected with LINC00094 siRNA (LINC00094-2 or si-LINC00094-3), miR-1270 mimics, or scramble control. After incubation at 37°C for 2 weeks, cancer cell colonies were fixed with 3.7% formaldehyde for 10 min and stained with 0.2% crystal violet in 10% ethanol for 3 h. After the wells were rinsed with H2O, they were air-dried. In each well, crystal violet was solubilized using 2 mL of 10% acetic acid, and the absorbance (optical density) of the solution was measured using a spectrophotometer at a wavelength of 620 nm.
Flow cytometry of cell cycle and apoptosis
After the cells were trypsinized, washed with PBS, resuspended in 70% ethanol, and maintained at 20°C overnight, they were then centrifuged, washed with PBS, resuspended in 450 mL of PBS and 10 mL of 10 mg/mL DNase-free RNase (Roche Molecular Biochemicals), and incubated at 37°C for 45 min. Following RNase treatment, 50 mL of propidium iodide (Boehringer Mannheim, Mannheim, Germany) was added, and the cells were incubated at room temperature for 10 min with light protection. Cell aggregates were removed through filtration before analysis. Cell cycle analysis was conducted using a Coulter EPICS XL flow cytometer.
Subcellular fraction localization
Nuclear and cytosolic fractions were separated using a PARIS kit (Life Technologies, Carlsbad, CA, USA) per the manufacturer’s instructions. After RNA had been extracted using TRIzol (Invitrogen), 2 µg of total RNA was reverse-transcribed with random primers and SuperScript III Reverse Transcriptase (Invitrogen). Real-time PCR was then used to determine the expression level of lncRNA. U6 was used as a nuclear marker, and GAPDH was used as a cytosolic fraction marker.
Coexpression and pathway enrichment analysis
After the expression profiles of SKCM were obtained from TCGA, gene correlation was calculated using Pearson’s correlation coefficient. Multiple pathways were examined to determine the functions of LINC00094-related genes. Subsequently, the top 100 positively correlated and top 100 negatively correlated genes with LINC00094 were selected, and pathway enrichment analysis was conducted using g:Profiler and the DAVID and GSEA databases. In addition, the false-positive discovery rate was calculated using the FDR-corrected q value.
Western blot assay
After the cells were harvested at 24 h following transient transfection, they were washed with PBS; this process was followed by lysing with a lysis buffer (50 mM Tris-HCl at pH 8.0, 150 mM NaCl, 1% NP-40, 0.02% sodium azide, 1 µg/mL aprotinin, and 1 mM phenylmethylsulfonyl fluoride) at 4°C for 30 min. Subsequently, the lysates were collected and centrifuged to remove cell debris, and protein assays were conducted using a Bio-Rad Protein Assay kit through a Bradford dye-binding procedure (Bio-Rad Laboratories, Hercules, CA, USA). After protein samples (60 µg) had been separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis in 10% resolving gel with a Mini-PROTEAN 3 Cell apparatus, they were electrotransferred to nitrocellulose membranes (Amersham Pharmacia Biotech, Amersham, UK). After blocking at 4°C overnight with PBS-Tween containing 5% skim milk, the membranes were incubated with primary antibodies for 1 h in PBS-Tween containing 5% skim milk. Subsequently, the membranes were incubated with anti-rabbit or mouse IgG HRP-conjugated secondary antibodies (1:10000; Roche Molecular Biochemicals) for 1 h at room temperature. After washing three times with PBS-Tween, immunoreactive bands were detected using an Amersham ECL kit (Amersham Pharmacia Biotech).
Real-time RT-PCR
Total RNA (2 µg, DNase I treatment) was reverse-transcribed using oligo(dT)15 primers and SuperScript III Reverse Transcriptase in accordance with the manufacturer’s instructions (Invitrogen). After the reaction was performed in an incubator at 42°C for 1 h, the enzyme was inactivated through incubation at 85°C for 5 min. Subsequently, cDNA was used for real-time PCR analysis with gene-specific primers, and gene expression was detected using a SYBR Green I assay (Applied Biosystems, Foster City, CA, USA). To determine the expression levels of lncRNAs by using a PCR thermocycler, the following PCR procedure was adopted: 94°C for 10 min followed by 35 cycles at 94°C for 1 min, 60°C for 1 min, and 72°C for 30 s, with a final extension at 72°C for 10 min. GAPDH was used as an internal control. The sequences of the primers used in this study:
• LINC00094-F: CATTTGAATTCTCCAGCTGTGC
• LINC00094-R: TGCAAACAAGCCAGGACTCT
• GAPDH-F: TGCACCACCAACTGCTTAGC
• GAPDH-R: GGCATGGACTGTGGTCATGAG
Small RNA transcriptome extraction through NGS
RNA was extracted from three samples—namely A375 cells with LINC00094-2 knockdown, A375 cells with LINC00094-3 knockdown, and A375 control cells—with TRIzol (Invitrogen). A small RNA library was constructed using the method described in our previous study.[51] Sequencing was performed using a MiSeq V2 reagent kit (150 cycles; Illumina). Sequencing data were analyzed using our tool.[52]
Stem–loop RT-PCR
For more details regarding this process, please refer to our previous study.[53] The expression levels of miR-1270 were normalized to those of U6 small RNA (ΔCt = target miRNA Ct − U6 Ct). The sequences of the primers used in this study:
• miR-1270-RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACACAGCT
• miR-1270-GSF: CGGCGGCTGGAGATATGGAAGAG
• U6-F: CTCGCTTCGGCAGCACA
• U6-R: AACGCTTCACGAATTTGCGT
Ectopic expression of miR-1270
Ectopic expression of miR-1270 was induced in melanoma cells through transfection by 10 nM miRNA mimics (GenDiscovery Biotechnology, New Taipei City, Taiwan) with a Lipofectamine RNAiMAX reagent (Invitrogen). After 48 h of transfection, the expression levels of miR-1270 were analyzed using stem–loop real-time quantitative PCR.
Luciferase reporter assay
Briefly, sequences of LINC00094 were cloned into a pMIR-REPROT vector (AM5795; Thermo Fisher Scientific, Waltham, MA, USA). Subsequently, the pMIR-REPROT-LINC00094 vector was cotransfected with or without miR-1270 mimics into an A2058 cell line by using Lipofectamine 2000 (Invitrogen, Thermo Fisher Scientific). After 48 h of transfection, cell lysates were used to measure luciferase activity on a Dual-Glo Luciferase Assay System (Promega).
RNA chromatin immunoprecipitation assay
Briefly, an RNA chromatin immunoprecipitation assay was performed using an RNA-binding protein immunoprecipitation kit (Millipore, Billerica, MA, USA) to examine the interaction between LINC00094 and miR-1270. A2058 cells were transfected with miR-1270 mimics or scramble control for 48 h and lysed with a radioimmunoprecipitation assay buffer. The cell lysate was supplemented with Dynabeads M-280 Streptavidin (Invitrogen) conjugated with an anti-Ago1/2/3 or anti-IgG antibody. Finally, Ago2-bound RNA was extracted using TRIzol, and the levels of purified RNAs were determined using real-time quantitative PCR.
Statistical analysis
The chi-squared test, Fisher’s exact test, Student’s t test, a one-way analysis of variance, the Mann–Whitney U test, and the Kruskal–Wallis test were employed to evaluate the correlations of lncRNA expression in melanoma tissues, adjacent normal tissues, and normal control tissues with clinicopathological parameters. These clinicopathological parameters were defined at the time of initial diagnosis or surgery. OS was measured as the time from the initial resection of the primary tumor to the date of death or that of the most recent follow-up. Cumulative survival curves were estimated using the Kaplan–Meier survival method and compared using a log-rank test. A two-tailed p value lower than 0.05 was considered statistically significant.