Regulation Mechanism of Nitrite Degradation in Lactobacillus plantarum WU14 Mediated by Fnr

doi:10.21203/rs.3.rs-4683278/v1

Download PDF

Research Article

Regulation Mechanism of Nitrite Degradation in Lactobacillus plantarum WU14 Mediated by Fnr

https://doi.org/10.21203/rs.3.rs-4683278/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 04 Nov, 2024

Read the published version in Archives of Microbiology →

You are reading this latest preprint version

Fumarate and nitrate reduction regulatory protein (Fnr), as a global transcriptional regulator, could directly or indirectly regulate many genes in different metabolic pathways at the top of the bacterial transcription regulation network. The present study aimed to explore the regulatory mechanism of Fnr-mediated nitrite degradation in Lactobacillus plantarum WU14 through gene transcription and expression analysis of oxygen sensing and nir operon expression regulation by Fnr, and the interaction and the mechanism of transcriptional regulation between Fnr and GlnR under nitrite stress. After the purification of Fnr and GlnR by GST tags, they were successfully expressed in Escherichia coli by constructing an expression vector. The electrophoresis mobility shift assay and qRT-PCR results indicated that Fnr could specifically bind to the PglnR and Pnir promoters and regulate the expression of nitrite reductase (Nir) and GlnR. After 6-12 h of culture, the expression of fnr and nir under anaerobic condition (A) were higher than that under aerobic condition (O), and the expression of these two genes increased with the addition of NaNO₂ during aerobic culture. Overall, the present study results indicated that Fnr could not only directly participate in the expression of Nir and GlnR but also indirectly regulate the expression of Nir through GlnR regulation.

Lactobacillus plantarum WU14

nitrite reductase

regulatory mechanism

transcription factor

protein interaction.

As a food additive, nitrite has been of worldwide concern due to its impact on human health. According to the United States professor Stoeivsand, the long-term consumption of foods with nitrite could cause cancer, goiter, and other diseases (Honikel et al. 2008). Lactic acid and organic acids produced by Lactic acid bacteria during metabolism could be absorbed by man during edible deep processed products of edible vegetables - pickled vegetables (Kaila. 1993), which can promote gastrointestinal peristalsis, stimulate intestinal immune cells to produce antibodies, inhibit the growth of intestinal putrefactive bacteria, reduce toxin production by putrefactive bacteria in the intestinal tract, prevent cell aging, reduce cholesterol, and other health and medical effects (Sazzad et al. 2022). However, nitrite pollution is very common in the process of pickling, with the production of strong carcinogens like N-nitroso compounds. Long term ingestion of these compounds may cause mutation and cancer. With the emerging food safety awareness among people, increasing attention has been paid to the safety problem of nitrite pollution in pickled food. Moreover, nitrite degradation is still a key problem in the production of pickled food (Schnadower et al. 2021; Markowiak-Kopeć (et al. 2020). In this regard, the use of microbial nitrite reductase (Nir) to reduce nitrite content, especially the dynamic degradation of nitrite produced in the pickling process by food grade bacteria-Lactic Acid Bacteria, producing nitrite reductase, could be a safe and effective strategy to cope with nitrite pollution (Ashrafudoulla et al. 2023). Studies have reported that some Lactobacillus own the nitrite reductase system, which could degrade a part of nitrite under anaerobic conditions (Markowiak-Kopeć et al. 2020). Hyun-Dong Paik found that lactic acid bacteria could reduce the concentration of nitrite in the broth culture and consume nitrite in various foods (Paik et al. 2014).

The global transcription factor Fumarate and Nitrate Reduction Protein (Fnr), located at the top of the bacterial transcription regulation network, is one of the most widely studied global transcription regulation proteins. So far, four types of fnr have been detected (Zhou et al., 2011; Crack et al. 2017). At present, the research on the biochemical and molecular mechanisms of Niris mainly focused on the denitrifying nitrogen fixing bacteria, such as Pseudomonas Stutzeri and Paracoccus. However, there are very few reports on the structure and function of nir operon and transcriptional regulatory protein of Lactic acid bacteria, and their molecular regulatory mechanisms are still unclear. The expression of several functional genes can be activated or inhibited by Fnr, which is highly conservative in bacteria and plays an important role in the conversion process of aerobic respiration and anaerobic respiration (Mao et al, 2022; Barrangou et al. 2002). The gene encoding Fnrwas first discovered by John Guest et al. in the mid-1970s during the identification of fumarate and nitrate reduction mutants (Yan et al. 2008). Fnris a global regulator of the anaerobic metabolism of Escherichia coli, controlling the synthesis of multiple genes (Schweikert et al. 2021). It belongs to the large family of regulators, containing 4Fe-4S clusters with oxygen instability (Mao et al. 2022). The 4Fe-4S complex remains stable under anaerobic conditions and undergoes decomposition due to the oxidation of this system, leading to Fnr dimerization and DNA binding activity destruction (Barrangou et al. 2002; Oh et al. 2004). Fnris a global regulator of many genes involved in energy production, especially those associated with anaerobic growth, which can regulate the physiological changes of bacteria to help them adapt to various environmental and metabolic stresses. Studies have reported that NOcan be producedin E. coli, and the function of several proteins is closely related to the production of nitric oxide and nitrosation (Oh et al. 2004; Fan et al. 1991). Of them, the flavin hemoglobin Hmp of E. coli is regulated by the global O₂ regulatory factors Fnrand MetR, and can be induced by nitrite and NO under aerobic and anaerobic conditions (Wu et al, 2013). The cytochrome C nitrite reductase encoded by nrfA is associated with NO production, but NO is not produced in the mutants of nitrate reductase or global regulator Fnrencoded by narG in the absence of yellow Hmp. It is reported that Fnris of great significance for the global gene regulation of bacteria and NO regulates the expression of Fnr (Beach et al. 2021).

Lactobacillus plantarum WU14 strain isolated from pickles has been proven to have strong nitrite degrading capacity, and its metabolic Niris of great significance to control the nitrite content in pickles. In our previous study, the regulation mechanism of nir gene in Lactobacillus plantarum WU14 mediated by GlnRunder nitrite stress was extensively studied (Qiu et al. 2022). However, the regulatory mechanism of the transition from aerobic to anaerobic respiration in L. plantarum WU14 by the global regulator Fnr, the response of Fnr to oxygen at the transcriptional level, and whether the positive regulatory effect of GlnR on nir is regulated by the upstream gene fnr have not been fully elucidated yet. Therefore, exploring the molecular regulation mechanism of nitrite reductase in Lactobacillus plantarum is of great significance to utilize the nitrite reductase of Lactic acid bacteria to eliminate the nitrite in pickled food and feed. Therefore, in this study, the regulation mechanism of nitrite degradation by Nirin L. plantarum WU14 was explored by taking the regulation of the nitrite reductase system of Lactic acid bacteria as the breakthrough. These results provide insights into eliminating nitrite in pickled food and feed.

Strains, medium, and chemicals

L. plantarum WU14 strain was isolated from pickles in our laboratory, and cultured in MRS medium (g/L) containing yeast extract 5 g, peptone 20 g, glucose 20 g, beef extract 10 g, CH₃COONa 2 g, triammonium citrate 2 g, Na₂HPO₄•7H₂O 2 g, MgSO₄•7H₂O 0.58 g, MnSO₄•4H₂O 0.25 g, Tween 80 1 mL (1 g), H₂O 1000 mL, pH 6.8 at 30°C for 24 h. L. plantarum WU14 was submitted to China General Microbial Culture Preservation Management Center (CGMCC) for preservation under the deposit number 61249. E. Coli Top 10 was obtained from Cowin Biotech Co., Ltd. (Jiangsu, China). The E. coli strains were cultured in Luria-Bertani medium (LB; 0.5% yeast extract, 1% tryptone, and 1% NaCl) supplemented with 100 µg/mL of kana or Amp. Transetta (DE3) and pEASY Blunt were obtained from TransGen (Beijing, China), and PGEX-6p-1 was obtained from our laboratory. LightShift ™ Chemical electrophoresis mobility shift assay (EMSA) Kit, Dnase I enzyme, restriction endonuclease (Bam HI, Xho I), and T4 DNA ligases were purchased from Thermo Scientific Co., Ltd. (Shanghai, China); the TRIZOL kit was purchased from Invitrogen Co., Ltd (USA); AceQ Universal SYBR qPCR Master Mix and Vazyme HiScript Ⅱ 1st Strand cDNA Synthesis Kit were purchased from Nanjing Vazyme Biotech Co., Ltd (Nanjing, China). All chemicals used in this study were of analytical grade and commercially available.

Sequence analysis and construction of plasmid and expression vector

Referring to the bacterial genome extraction kit's manual, the complete genome of L. plantarum WU14 was extracted. Through a search on the NCBI website, conserved sequences of the fnr and glnR genes in L. plantarum were obtained. Using SnapGene software, gene primers (Fnr-F, Fnr-R, GlnR-F, GlnR-R) were designed and analyzed to amplify the target sequences, as shown in Table 1. Following amplification, the resulting fnr and glnR gene fragments were subjected to 1% agarose gel electrophoresis for validation.

Table 1

Primers
Primer name	Primer sequence(5´-3´)
Fnr-F(BamHⅠ)	CGCGGATCCatgcattcaaaaatggattgtgtg
Fnr-R(XhoⅠ)	CCGCTCGAGacaaattgtaatctggcgc
GlnR-F(BamHⅠ)	atgaaggaaaaggaactccgtcgctcgttgg
GlnR-R(XhoⅠ)	ttagtgtgccggataattggggcccttgtc
M13-F	CGCCAGGGTTTTCCCAGTCACGAC
M13-R	CACACAGGAAACAGCTATGAC
pGEX5′	GGGCTGGCAAGCCACGTTTGGTG
pGEX3′	CCGGGAGCTGCATGTGTCAGAGG
Graphic for Manuscript

Subsequently, the PCR-amplified fnr and glnR gene fragments were recovered and ligated into the Blunt easy vector (Chen et al. 2021). Afterward, they were transformed into competent TOP 10 cells. Correct clones were selected, cultured in liquid LB medium supplemented with potassium (K⁺) at 37°C overnight on a shaker. Plasmids were extracted for sequencing. Utilizing enzymatic digestion, the Blunt recombinant cloning vector and pGEX-6p-1 empty vector were employed to construct fnr and glnR recombinant expression plasmids (Boontip et al. 2021; Liu et al. 2020). These constructs were then transformed into Transetta competent cells, induced for expression, and the resulting bacterial lysate was subjected to purification using column chromatography to isolate the fusion proteins.

The purified proteins were subsequently analyzed once again using SDS-PAGE, and the target protein bands on the gel were excised for mass spectrometry analysis (Zalazar et al 2013; Hellman et al. 2007).

Gel retardation assay (EMSA) confirms the mutual interaction between Fnr and GlnR with the promoter region

Gene expression is subject to numerous influencing factors, primarily modulated by various regulatory proteins within the organism. The activation or inhibition of gene transcription by these proteins significantly impacts gene expression. However, such regulatory mechanisms can generally be verified ex vivo. Electrophoretic Mobility Shift Assay (EMSA) serves as a rapid and sensitive method for detecting protein-nucleic acid interactions outside of the biological system.

In this context, EMSA experiments were conducted to validate the regulatory roles of two global transcription factors, Fnr and GlnR, on the nitrite reductase enzyme (Nir). Following a sequence alignment between the correctly sequenced glnR and nir sequences and those of other lactobacilli on the NCBI BLAST website, the promoter sequences of glnR and nir were analyzed. Using SnapGene software, primers were designed, incorporating a pair of biotin-labeled primers for the amplification of PglnR and Pnir, respectively. Subsequently, the PCR-amplified PglnR and Pnir target fragments, encompassing both biotin-labeled and non-labeled segments, were subjected to 1% agarose gel electrophoresis. The gel was then excised, and the fragments were recovered for subsequent EMSA validation (Mettert et al, 2017; Henriksson-Peltola et al. 2007).

Growth curve under different culture conditions and the test of ability to degrade NaNO₂

After the inoculation of L. plantarum WU14 in the MRS liquid medium at 37 ℃ for overnight, it was inoculated into two triangular flasks and two large centrifuge tubes (both with 50 mL MRS medium) at 1%. The two triangular flasks were O (aerobic) and NO (aerobic under 0.1% NaNO₂ stress) culture conditions, and the two centrifuge tubes were A (anaerobic) and NA (anaerobic under 0.1% NaNO₂ stress) culture conditions. 4 mL of culture solution was taken out every 4 h to measure the absorbance on a spectrophotometer at OD₆₀₀. Then, the distilled water was adjusted to zero, the OD₆₀₀ value was measured using the culture medium without bacteria at 0 h, and the growth curves for O, NO, A, and NA bacteria were plotted. L. plantarum WU14 was cultured in a concentration gradient NaNO₂ stress environment (the concentration of sodium nitrite was 0.05%, 0.1%, 0.2%, 0.3%, 0.5%, 1%, and 2%, respectively), the OD₆₀₀ absorbance of bacteria at different time points was measured, and the growth curve of L. plantarum WU14 at O/A was plotted.

The NaNO₂ degradation ability of L. plantarum WU14 was analyzed by measuring the change in NaNO₂ concentration in the culture medium with time under the NO and NA culture conditions. The operation steps of culture were similar to the growth curves. The supernatant sample was collected by centrifugation at 4 ℃ at 12000 r/min for 2 minutes, and the concentration of NaNO₂ was determined using the salt acid naphthalene ethylenediamine method (Fei et al. 2014).

Verification of the relative expression of fnr and nir using qRT-PCR

The cells under various conditions of O, NO, A, and NA were cultured based on the cell culture method used in the L. plantarum WU14 growth curve determination experiment. Then, the cells (15 mL of bacterial solution) at 0, 2, 4, 6, 8, 10, and 12 hours were collected for RNA extraction using the Trizol method (Geldart et al. 2017). The residual DNA in the RNA was removed by DNase I with water and L. plantarum WU14 genome as the control. The 200 bp 16 s RNA segment of L. plantarum WU14 was amplified to verify whether the DNA in the extracted RNA was removed completely. The RNA reverse was transcribed to cDNA following the procedures of the reverse transcription kit (Vazyme HiScript Ⅱ 1st Strand cDNA Synthesis Kit; Thermo Fisher). The samples were added to a 96 well plate according to the instructions of the AceQ Universal SYBR qPCR Master Mix kit (Thermo Fisher). Each 200 bp of cDNA fragments of the internal reference genes 16s, fnr, and nir was amplified, and each reaction was carried out in triplicate. The available data to calculate the relative expression amount were analyzed using the Cq value, and the 96 wells were placed in the qRT-PCR instrument to react.

Induced expression, purification, and detection of recombinant expression vector

Amplification and sequence analysis of the fnr and glnR genes

The complete genome DNA of L. plantarum WU14 was extracted using a bacterial genome extraction kit, and the results of the whole genome extraction are shown in Fig. 1A. Using the L. plantarum WU14 genome as a template, the fnr and glnR genes were amplified. The fnr gene was amplified using specific primers Fnr-F (Bam HⅠ) and Fnr-R (Xho Ⅰ), resulting in a size of 642 bp. Gel electrophoresis of the gel-recovered fragment is depicted in Fig. 1B. Similarly, the glnR gene was amplified using the same method, and the gel electrophoresis of the gel-recovered fragment is shown in Fig.1C.

Construction of fnr and glnR cloning vectors

The recovered fnr gene fragment was ligated into the pEASY-Blunt vector and transformed into E. coli TOP 10 competent cells. Eight transformed colonies were randomly selected and cultured overnight in LB liquid medium containing 600 μL 50 μg/mL Kanamycin. Using the M13-F/M13-R primers, bacterial liquid PCR verification was carried out, as depicted in Fig. 1D. The + lane served as a control using the empty vector as a template (band size of 150 bp), and the - lane used water as a negative control. The correct size for transformed colonies should exhibit the empty vector size plus the fnr gene fragment (band size of 800 bp). Bands in lanes 1-2 and 6-7 represented correctly sized transformed colonies. Colonies 1 and 6 were selected for plasmid extraction.

Using the same methodology, verification of the Blunt-glnR vector was conducted, yielding results as shown in Fig. 1E. The + lane served as a positive control (fragment size of 381 bp), and the - lane used water as a negative control. Consequently, bands in lanes 1-2 and 4-8 represented colonies with correct band sizes. Colonies 1 and 4 were chosen for plasmid extraction.

Plasmids from the selected four colonies were extracted and sent to the Genetic Sequencing Department at Shenggong Bio for sequencing. The sequencing verification and alignment results demonstrated the accuracy of the sequences.

After the correct Blunt fnr clone vector and pGEX-6p-1 empty vector digested with Bam HⅠ and Xho Ⅰ were sequenced, the correct bands were detected and recovered by 1% agarose gel electrophoresis. The fnr and pGEX-6p-1 fragments were ligated with T4 DNA ligase, transformed into the Transetta competent cells using heat shock, and coated on the LB flat plate with 50 μg/mL Amp for overnight culture. Then, 8 transformants were cultured in the liquid LB with 600 μL of 50μg/mL Amp and verified by PCR using Fnr-F and Fnr-R primers. As shown in Fig. 1F, the correct size of the bands 1-8 were all positive transformants, with the + lanes using the clonning vector as the template for the positive control (the strip size was 642 bp) and the - lanes used the water as the template for negative control; the No.1 clone was selected for subsequent induction expression experiment. The verification of the pGEX-6p-1-glnR recombinant expression vector was consistent with the above method. As shown in Fig. 1G, the correct strip size of 1-8 swimming lanes were all positive transformants, and the strip size should be empty plus glnR fragment (~500 bp) with the - lane used water as the template for the negative control, the K lane used the pGEX-6p-1 empty carrier as the template for negative control (~150 bp), and the + lane used the pGEX-6p-1-glnR vector as the template for positive control. The No.1 clone was selected for subsequent induction expression experiments.

Construction of fnr and glnR recombinant expression plasmids

Induction of recombinant fnr and glnR proteins expression

Using the bioinformatics software SnapGene, the fnr gene sequence was analyzed, revealing that the size of the Fnr protein is 25 kD. The GST protein tag in the pGEX-6p-1 vector is also 25 kD. Therefore, the induced protein size using this vector should be approximately 50 kD. The tag size in the pET30a vector can be disregarded. After culturing the bacterial strain, the cell lysate was collected through centrifugation. The supernatant was separated from the pellet (including the blank control) and subjected to SDS-PAGE analysis, as shown in Fig. 2A. When induced by the pET30a vector, the 25 kD band in the supernatant was weaker compared to the empty vector, while the concentration of the induced pellet band was significantly higher and formed aggregates. Thus, Fnr protein expression in the pET30a vector was associated with inclusion bodies. When induced by the pGEX-6p-1 vector, a visibly stronger band appeared at 50 kD in the supernatant compared to the empty vector supernatant. The induced pellet band was much higher than the empty vector pellet band, and aggregation was also observed. Hence, Fnr protein expression in the pGEX-6p-1 vector also involved inclusion bodies, with some expression present in the supernatant that could be purified and recovered.

By using the bioinformatics software SnapGene, the glnR gene sequence was analyzed, revealing that the theoretical size of the GlnR protein is 15 kD. Thus, the theoretical size of the recombinant protein is 40 kD. Induction of correctly verified bacterial strains was achieved using 0.1 mmol/L IPTG. Supernatant and pellet (including blank control) were analyzed through SDS-PAGE, as illustrated in Fig. 2B. At the 40 kD band size, the protein concentration in the induced supernatant was higher than in the empty vector, indicating inclusion body expression. However, soluble expression was also detected in the supernatant, which could be purified.

Purification and analysis of recombinant Fnr and GlnR proteins

The purified and recovered Fnr protein was subjected to SDS-PAGE analysis, as illustrated in Fig. 2C. Lanes 6-10 represent eluted target protein samples. In Lane 6, a distinct band around 50 kD is observed, corresponding to the expected size of the target protein. The purified protein displays minimal impurities, rendering it suitable for subsequent EMSA experiments. The purification method for GlnR protein is analogous to that of Fnr protein purification. After column penetration, a gradient elution with reduced glutathione was employed. The protein eluate was analyzed using SDS-PAGE, as depicted in Fig.2D. Lanes 5, 15, and 30 represent the original eluted protein samples, while lanes 5N, 15N, and 30N depict the protein samples after a 5-fold concentration using ultrafiltration. Notably, a single band is consistently observed around 40 kD in Figure 2D, aligning with the anticipated size of the target protein. The purified protein concentration is relatively low, but after concentration, it can be utilized for EMSA experiments.

EMSA verification of Fnr and Pnir promoters’ interaction

Promoter amplification

The PglnR promoter and the biotin-labeled PglnR promoter were amplified by the PglnR-F/PglnR-R and PglnR-FS/PglnR-RS specific primers using the L. plantarum WU14 genome as the template. The results were detected by 1% agarose gel electrophoresis, as shown in Fig. 3A. Since the promoter of the glnR gene was intercepted at 111 bp before the glnR gene, its theoretical size was 111 bp. The size of lane 1 was between 65-230 bp, and the possibility of primer dimer cloud be eliminated, which could be used as the target band for the next experiment. The Pnir promoter and the biotin-labeled Pnir promoter were amplified in the same way as the glnR gene promoter, and detected by 1% agarose gel electrophoresis, as shown in Fig. 3B. The first 400 bp of the nir gene was intercepted as the promoter of nir gene, so the theoretical size of Pnir was 400 bp. The 1-2 lanes in the figure were Pnir, and the migration speed of gel electrophoresis was not affected by the presence or absence of biotin markers. The band size was 400 bp, and the theoretical value was the same.

EMSA verification of Fnr and Pnir promoters’ interaction

In the purification process of the GST protein, the expression of E. coli transformed by the empty vector pGEX-6p-1 was induced. After the cell was broken, it was purified by a column using the recombinant fusion protein purification method. The eluant of the gradient elution was analyzed by SDS-PAGE, as shown in Fig. 3C. Since the theoretical size of GST was 25 kD, there was a single band of 25 kD in No. 1-2 lanes, and the concentration was high, indicating that the purification effect of GST protein was good, which could be preserved for later experiments.

The EMSA could verify whether Fnrinteracted with the Pnir promoter in vitro. When the biotin probe DNA was added with 20 fmol, the self-luminescence of biotin showed visible bands. When the protein reacted with the probe DNA, the migration speed of the DNA protein complex on the active gel slowed down, and a hysteresis band appeared. This result showed that the GST protein did not specifically bind to the probe when the gradients of the recombinant protein and competitive DNA were set at the same time. As shown in Fig. 3D, there was only a probe band without a lagging binding band in the GST lane, indicating that the GST protein did not bind to the Pnir promoter. However, when the GST-Fnrprotein was added, a DNA protein complex retention band appeared, and the retention band increased with the increase of concentration, indicating that the GST-Fnrprotein could bind to the Pnir promoter in vitro. When the competitive DNA was added to the reaction system, the retention band become weaken and gradually disappeared with the increase in concentration. This might be because the concentration of the competitive DNA was much higher than the probe DNA. When it was bound to the protein, only a few or no probe DNA was bound to GST-Fnr, and the complex lagging band weakened or disappeared. These results showed that the Fnr protein could bind to the Pnir promoter in vitro and regulate the expression of the nir gene.

EMSA verification of Fnr and PglnR promoters’ interaction

In this study, the interaction between Fnrand PglnR promoters was explored in vitro to prove that Fnr could regulate Nirby regulating glnR indirectly. Moreover, whether Fnrcould bind to the PglnR promoter in vitro was verified through the EMSA experiment. As shown in Fig. 3E, no binding hysteresis band was found in the GST lane, indicating that the GST protein did not bind to the PglnR promoter; however, the retention bands were obvious in the lane added with the GST-Fnrprotein, indicating that the Fnrprotein interacted with the PglnR promoter in vitro. After adding the competitive DNA, the retention bands were weakened significantly and gradually disappeared with the increase of concentration, indicating that the Fnr protein bound to the PglnR promoter. The EMSA experiment results showed that Fnrhad a regulatory effect on the transcription of glnR. The combined research the above proved that Fnrcould indirectly regulate the nir gene by regulating glnR.

Growth curve under different culture conditions and test of ability to degrade NaNO₂

Growth curve of L. plantarum WU14 under O, A, NO, and NA condition (0.1% NaNO₂)

The growth curve of L. plantarum WU14 cultured under O, NO, A, and NA conditions is shown in Fig. 4A. During 4-12 h culture, the strain was in a logarithmic growth period and became stable at 12 h-24 h. Only in the anaerobic culture, the strain was still growing slowly in the 12-24 h culture, which was better than that in the aerobic culture. The growth of the strain and the maximum concentration of the strain at the later stage were inhibited by 0.1% NaNO₂.

Growth curve of L. plantarum WU14 under NaNO₂ concentration gradient stress

The growth curve of L. plantarum WU14 under concentration gradient NaNO₂ stress aerobic culture is shown in Fig. 4B. With the increase of NaNO₂concentration, the inhibition degree of cell growth increased, and the maximum cell concentration decreased with the increase of NaNO₂ concentration. When the NaNO₂ content was 2%, the cell growth increased after 12 hours of culture, and the maximum cell concentration was low with OD₆₀₀ less than 1, indicating that the higher the concentration of NaNO₂, the more obvious the inhibition degree of the cell.

The growth curve of L. plantarum WU14 anaerobic culture under NaNO₂ concentration gradient stress is shown in Fig. 4D. With the increase of NaNO₂ concentration, the inhibition degree of cell growth increased. Compared with Figures 4B and 4D, it was found that the maximum cell concentration value was greater under anaerobic conditions than under aerobic conditions, suggesting that L. plantarum WU14 has a stronger growth ability under anaerobic conditions than aerobic conditions.

Test of ability to degrade NaNO₂

The change in NaNO₂ content in the medium with time under the stress of different NaNO₂ concentrationsis shown in Fig. 4C. With the increase of NaNO₂ concentration, the amount of NaNO₂ degraded by the strain decreased, indicating that its degradation ability was inhibited. When the content of NaNO₂ was lower than 0.3%, the final degradation rate of NaNO₂ exceeded 70%.

The change in NaNO₂ content in the medium with time under the stress of different NaNO₂ concentrations in anaerobic culture is shown in Fig. 4E. The change in the degradation ability of the strain was consistent with that under aerobic conditions; however, the degradation ability of the strain under anaerobic conditions was higher than that under aerobic conditions.

Verification of relative expression of fnr and nir by qRT-PCR

EMSA experiments confirmed that both Fnr and GlnR proteins are capable of binding to the Pnir promoter, regulating Nir activity. Fnr protein responds to changes in oxygen concentration, adapting cellular respiration to optimize cell growth under varying oxygen levels. GlnR, also known as a nitrogen metabolism regulatory protein, is sensitive to nitrite concentrations in the environment. Therefore, this experiment aimed to assess the expression of the fnr and nir genes by altering the bacterial growth environment.

The expression amount of fnr from L. plantarum WU14 with 16S rDNA as the internal reference gene under different culture conditions is shown in Fig. 5. The analysis of A and C histograms showed that the relative expression of fnr was relatively uniform within 6-12 h. The expression of fnr under anaerobic conditions was upregulated compared with that under aerobic conditions, and the gene expression under NaNO₂ stress was also slightly upregulated. However, a relatively uniform conclusion could not be drawn by the analysis of other conditions and time points. Therefore, it was speculated that the change in the culture conditions alone might not have much impact on gene expression.

The expression of nir under different culture conditions was compared with that of internal reference 16S rDNA, as shown in Fig. 6. The histogram analysis indicated that there was no significant difference between the relative expression of nir and fnr. The expression of nir in the anaerobic culture was upregulated compared with the aerobic culture within 6-12 h, and the gene expression was also slightly upregulated under NaNO₂ stress. Under anaerobic conditions, the expression of fnr and nir was higher than that under aerobic conditions within 6-12 h of culture, and the expression of these two genes increased with the addition of NaNO₂ to the aerobic culture. However, under the conditions of anaerobic and NaNO₂ stress, this phenomenon disappeared. It might be due to the complex regulation network of the cell, which affected other regulatory genes and had an impact on the results, leading to a low repeatability of the experimental results.

In our previous study, the regulatory mechanism of nir gene in Lactobacillus plantarum WU14 mediated by GlnR under nitrite stress was studied extensively. However, the regulatory mechanism of the transition from aerobic to anaerobic respiration in L. plantarum WU14 by the global regulator Fnr, the response of Fnr to oxygen at the transcriptional level, and the regulatory mechanism of the positive regulatory effect of GlnR on nir by the upstream gene Fnr have not been fully elucidated yet. The global transcription factor Fnr, located at the top of the bacterial transcription regulation network, can regulate the transcription factors of many genes in different metabolic pathways. It can directly regulate the transcription of many genes in bacteria and indirectly regulate the transcription expression of genes responsible for the regulatory factors. In the middle and late phase of vegetable pickling, the reproduction of Lactic acid bacteria is dominant, the growth of harmful bacteria is inhibited, the degree of nitrate reduction is weakened, and nitrite degradation is transferred to the enzyme transformation stage due to the gradual formation of an anaerobic environment (Yang et al. 2020; Nurizzo et al. 1997; Koebke et al. 2018). In this process, Fnr significantly mediates the transformation and regulation of bacteria from aerobic respiration to anaerobic respiration, regulates a series of related genes’ expression related to anaerobic respiration, including nitrite reductase, and inhibits the expression of related genes in aerobic metabolism (Koebke et al. 2018; Hough et al. 2008). Therefore, studying the regulatory mechanism of the gene expression of nitrite reductase in Lactic acid bacteria by Fnr has great significance. Bacteria pose different strategies to adapt to the existence of different metabolic substrates.

The well-known Crp/Fnr series regulators have long been considered as oxygen sensors to regulate various biological processes, including aerobic/anaerobic metabolism, nitrogen fixation, bioluminescence, infection, and virulence switching. In most cases, Fnr remains active under anaerobic conditions. Fnr belongs to the Crp/Fnr transcriptional regulatory protein family, which can regulate the expression of target genes in the form of homodimers and bind to the target DNA regions through their C-terminal DNA binding domain. This binding ability is controlled by the N-terminal sensor domain, thus responding to various environmental/cell metabolism. Generally, the expression of nir operon is regulated by Fnr during the catalysis of NO production by Nir in the prokaryotic cells (Kleerebezem et al. 2003). So far, the regulation mechanism of Fnr in E. coli has been extensively studied. Since Fnr is highly sensitive to oxygen, it is a key switch between anaerobic and aerobic metabolism in E. coli (Ibrahim et al. 2015; Ibrahim et al. 2015). Additionally, many Fnr regulators have been identified in various bacteria, such as FnrA in P. stutzeri, Anr in P. aeruginosa, FnrL in Rhodobacter sphaeroides, FnrP in Pa. denitrificans, and FixK1 in Bradyrhizobium japonicum. The N-terminals of these regulators are rich in cysteine motif with activating proteins similar to Fnr of E. coli, such as NnrR of R. sphaeroides, Nnr of Pa. denitrificans, Dnr of P. aeruginosa, and DnrD of P. stutzeri. These regulatory factors are cysteine free and could activate the expression of nir and nor (Hartsock et al. 2010; Dang et al. 2022). In Pa. denitrificans and P. aeruginosa, the transcription of Nnr or Dnr depends on NO, NIRS is regulated by the product rather than the substrate, and the transcription of NIRS is activated by knocking out the nnr gene of Pa. denitrificans (Ravcheev et al. 2007). With the completion of more bacterial genome sequencing, powerful bioinformatics prediction means and high-throughput technologies have provided effective support for exploring the complex relationship between global regulatory networks. Although many Fnr and GlnR targets have been detected, including many indirect targets, the regulatory mechanism of Fnr on GlnR target genes and the regulatory signals and mechanisms of Fnr are still unclear, demanding more in-depth research. In this study, the regulation mechanism of nitrite reductase Nir in Lactobacillus plantarum WU14 mediated by the global transcription regulator Fnr was studied preliminarily based on the regulation of nitrogen metabolism in WU14 by GlnR. Based on gene cloning and sequence analysis of glnR and nir, the relatively conservative fnr sequence of L. plantarum WU14 was detected through NCBI database comparison and the target gene fnr and glnR were amplified by PCR with the specific primers designed. The E. coli expression system was used to induce the expression and purification of Fnr and GlnR proteins. The EMSA results indicated that the GlnR protein could bind to the Pnir promoter, and the Fnr protein could bind to the glnR and nir promoters. Notably, Fnr could directly regulate the nir gene and indirectly regulate the nir gene by regulating the GlnR protein. It is reported that the Fnr protein can sense and adapt to the changes in oxygen concentration by adjusting cell respiration to facilitate cell growth. GlnR, also known as the nitrogen metabolism regulation protein, is more sensitive to the concentration of nitrite in the environment. Therefore, in this study, the regulation mechanism of nitrite degradation by Nir in L. plantarum WU14 was explored by taking the regulation of the nitrite reductase system of Lactic acid bacteria as the breakthrough. Based on the perspective of transcriptional level and gene expression, the present study aimed to analyze the oxygen sensing mechanism of global transcriptional regulatory proteins Fnr and Nir in L. plantarum WU14 under nitrite stress and verify the interaction between Fnr and Nir and nir promoters and Fnr and GlnR to explore the multi-level regulatory mechanism of Fnr participating in nir operons expression. In this study, the relative expression of fnr and nir genes at the transcriptional level was detected using the real-time fluorescent quantitative PCR. The results showed that the expression of fnr and nir genes of L. plantarum WU14 in the anaerobic condition was higher than that in the aerobic condition when cultured for 6–12 h, and the addition of NaNO₂ in the aerobic culture could increase the expression of these two genes. However, this phenomenon disappeared under the conditions of anaerobic and NaNO₂ stress. This might be due to the complex regulation network of the cell, which affected other regulatory genes and had an impact on the results, leading to a weak repeatability of the experimental results. Therefore, further research is highly warranted.

Under aerobic conditions, oxygen is the ultimate electron acceptor. When the concentration of oxygen decreases, the respiratory mechanism and ultimate electron acceptor change to adapt to the environment, and this whole cell scale metabolic transformation is precisely and strictly regulated. In microorganisms, NO could be formed from nitrate through denitrification, and nitrate is reduced to nitrite and NO in some L. plantarum under anaerobic conditions. The nitrite degradation mechanism of L. plantarum is to reduce nitrite to NO and then to N₂O by metabolic nitrite reductase (Nir). In previous studies, Fnr has been identified as a "switch" between anaerobic and aerobic metabolism in many bacteria. As a global regulator, Fnr is active under anaerobic conditions and inactive under aerobic conditions. Several studies have shown that the function of many proteins is closely associated with the production of nitric oxide and nitrosation. Of them, the flavin hemoglobin Hmp of E. coli is regulated by the global regulatory factors Fnr and MetR (Cruz-Ramos et al. 2002) and induced by nitrite and NO under aerobic and anaerobic conditions. The cytochrome c nitrite reductase encoded by nrfA participates in the production of NO, but no NO would be produced in the mutants lacking nitrate reductase encoded by yellow Hmp and narG or global regulator Fnr. It is reported that the expression of fnr could be regulated by NO, and Fnr would be of great significance for global gene regulation in bacteria (Mettert et al. 2017). Overall, the present study results provide insights into the functions of nir operon expression and the regulation system of Lactic acid bacteria at the molecular level, the combination of model elements, new regulation models, and signal transduction, and lay a foundation for developing biodegradable machine to control or degrade nitrite in food safely and effectively, ensuring the national food safety and protecting human health.

In summary, based on the cloning and sequence analysis of glnR and nir, the target fnr and glnR genes of L. plantarum WU14 were amplified with the specific primers designed by the relatively conservative sequences through NCBI database comparison, and the expression and purification of Fnr and GlnR proteins were induced using the E. coli expression system. Additionally, the interaction between the protein and the promoter in vitro was explored using the EMSA experiment. The results showed that the GlnR protein could bind to the Pnir promoter, and the Fnr protein could bind to the PglnR and Pnir promoters. Furthermore, Fnr could directly regulate the nir gene or indirectly regulate the nir gene by regulating the GlnR protein (Graphic for Manuscript). Finally, the relative expression of the fnr and nir genes in L. plantarum WU14 at the transcription level was detected using the real-time fluorescent quantitative PCR. The results showed that the expression of fnr and nir genes under anaerobic conditions was higher than that under aerobic conditions during 6–12 h of culture, and the addition of NaNO₂ to the aerobic culture could increase the expression of both genes; however, this phenomenon disappeared under the conditions of anaerobic and NaNO₂ stress.

Author contributions SC, HZ and BX conceived the review idea and plan of experiments. HZ, HQ and SF performed the experiments. AY and YL did the statistical analysis. SC wrote the first draft. SC, HZ, YX, JH and BX finalize the outline and prepare schematics. Subsequently, all the authors read and approved the final manuscript.

Funding This work was supported by the Guangdong Basic and Applied Basic Research Foundation (2024A1515012511, 2022A1515012380), the Guangdong Special Project on Key Fields of Colleges and Universities (Rural Revitalization, 2020ZDZX1020), Science and Technology Special Fund Project of Maoming Science and Technology Bureau (2021KJZXZJGSPDX003), and the Projects of Talents Recruitment of GDUPT (519033).

Data availability No datasets were generated or analysed during the current study.

Competing interests The authors declare no competing interests.

Ashrafudoulla MD, Mevo SIU, Sazzad HT, Shamsun N, Pantu KR, Furkanur RM, Si HP, Sang-Do H (2023) Challenges and opportunities of non-conventional technologies concerning food safety. World's Poult Sci J 79:3–26. https://doi.org/10.1080/00439339.2023.2163044
Barrangou R, Yoon SS, Breidt F, Fleming HP, Klaenhammer TR (2002) Identification and characterization of Leuconostoc fallax strains isolated from an industrial sauerkraut fermentation. Appl Environ Microbiol 68:2877–2884. https://doi.org/10.1128/aem.68.6.2877-2884.2002
Beach NK, Myers KS, Owen BR, Seib M, Donohue TJ, Noguera DR (2021) Exploring the Meta-regulon of the CRP/FNR Family of Global Transcriptional Regulators in a Partial-Nitritation Anammox Microbiome. mSystems 6: e0090621. https://doi.org/10.1128/mSystems.00906-21
Boontip T, Waditee-Sirisattha R, Honda K, Napathorn SC (2021) Strategies for Poly(3-hydroxybutyrate) Production Using a Cold-Shock Promoter in Escherichia coli. Front Bioeng Biotech 9:666036. https://doi.org/10.3389/fbioe.2021.666036
Chen W, Shi Y, Li G, Huang C, Zhuang Y, Shu B, Cao X, Li Z, Hu G, Liu P, Guo X (2021) Preparation of the peroxisome proliferator-activated receptor α polyclonal antibody: Its application in fatty liver hemorrhagic syndrome. Int J Biol Macromol 182:179–186. https://doi.org/10.1016/j.ijbiomac.2021.04.018
Crack JC, Le-Brun NE (2017) Redox-Sensing Iron–Sulfur Cluster Regulators. Antioxid Redox Sign. https://doi.org/10.1089/ars.2017.7361
Cruz-Ramos H, Crack J, Wu GH, Hughes MN, Scott C, Thomson AJ, Green J, Poole RP (2002) NO sensing byFNR: regulation of the Escherichia coli NO-detoxifying flavohaemoglobin, Hmp. EMBO J 21:3235–3244. https://doi.org/10.1093/emboj/cdf339
Dang J, Wang T, Wen J, Liang H (2022) An Important Role of the Type VI Secretion System of Pseudomonas aeruginosa Regulated by Dnr in Response to Anaerobic Environments. Microbiol Spectr 10:e0153322. https://doi.org/10.1128/spectrum.01533-22
Fei Y, Liu D, Luo T, Chen G, Wu H, Li L, Yu Y (2014) Molecular Characterization of Lactobacillus plantarum DMDL 9010, a Strain with Efficient Nitrite Degradation Capacity. PLoS ONE 9: e113792. https://doi.org/10.1371/journal.pone.0113792
Fan LH, Yang JB, Zhang C (1991) Study on the lactic acid fermentation of tomato juice (in Chinese). Food and Fermentation Industries 02:22-29. https://doi.org/10.13995/j.cnki.11-1802/ts.1991.01.00
Geldart K, Kaznessis YN (2017) Characterization of Class IIa Bacteriocin Resistance in Enterococcus faecium. Antimicrob Agents Chemother 61:e02033-16. https://doi.org/10.1128/AAC.02033-16
Hartsock A, Dang J, Wang T, Wen J, Liang H (2010) An Important Role of the Type VI Secretion System of Pseudomonas aeruginosa Regulated by Dnr in Response to Anaerobic Environments. Microbiol Spectr 10:e0153322. https://doi.org/10.1128/spectrum.01533-22
Honikel KO (2008) The use and control of nitrate and nitrite for the processing of meat products. Meat Sci78: 68-76. https://doi.org/10.1016/j.meatsci.2007.05.030
Hough MA, Eady RR, Hasnain SS (2008) Identification of the Proton Channel to the Active Site Type 2 Cu Center of Nitrite Reductase: Structural and Enzymatic Properties of the His254Phe and Asn90Ser Mutants. Biochemistry 47: 13547–13553. https://doi.org/10.1021/bi801369y
Hellman LM, Fried MG (2007) Electrophoretic mobility shift assay (EMSA) for detecting protein–nucleic acid interactions. Nat Protoc 2:1849–1861. https://doi.org/10.1038/nprot.2007.249
Henriksson-Peltola P, Sehlen W, Haggard-Ljungquist E (2007) Determination of the DNA-binding kinetics of three related but heteroimmune bacteriophage repressors using EMSA and SPR analysis. Nucleic Acids Res35:3181–3191. https://doi.org/10.1093/nar/gkm172
Ibrahim SA, Crack JC, Rolfe MD, Borrero-de Acuña JM, Thomson AJ, Le Brun NE, Schobert M, Stapleton MR, Green J (2015) Three Pseudomonas putida FNR Family Proteins with Different Sensitivities to O₂. J Biol Chem 290:16812–16823. https://doi.org/10.1074/jbc.M115.654079
Kaila M (1993) ENHANCEMENT OF THE CIRCULATING ANTIBODY SECRETING CELL RESPONSE IN HUMAN DIARRHEA BY A HUMAN LACTOBACILLUS STRAIN. Pediatr Infect Dis J 12:263. https://doi.org/10.1097/00006454-199303000-00027
Koebke KJ, Yu F, Salerno E, Van Stappen C, Tebo AG, Penner-Hahn JE, Pecoraro VL (2018) Modifying the Steric Properties in the Second Coordination Sphere of Designed Peptides Leads to Enhancement of Nitrite Reductase Activity. Angew Chem 130:4018–4021. https://doi.org/10.1002/ange.201712757
Kleerebezem M, Boekhorst J, Van Kranenburg R, Molenaar D, Kuipers OP, Leer R, Tarchini R, Peters SA, Sandbrink HM, Fiers MWEJ, Stiekema W, Klein Lankhorst RM, Bron PA, Hoffer SM, Nierop Groot MN, Kerkhoven R, Vries MD, Ursing B, de Vos WM, Siezen RJ (2003) Complete genome sequence of Lactobacillus plantarum WCFS1.P Natl Acad Sci100:1990–1995. https://doi.org/10.1073/pnas.0337704100
Liu B, Liu GD, Guo HY, Zhu KC, Guo L, Liu BS, Zhang N, Jiang SG, Zhang DC (2020) Functional characterization of NK-lysin in golden pompano Trachinotus ovatus (Linnaeus 1758). Dev Comp Immunol107:103658. https://doi.org/10.1016/j.dci.2020.103658
Mao LC, Li SH, Peng XX, Li H (2022) Global transcriptional regulator FNR regulates the pyruvate cycle and proton motive force to play a role in aminoglycosides resistance of Edwardsiella tarda. Front Microbiol13:1003586. https://doi.org/10.3389/fmicb.2022.1003586
Markowiak-Kopeć P, Śliżewska K (2020) The Effect of Probiotics on the Production of Short-Chain Fatty Acids by Human Intestinal Microbiome. Nutrients 12: 1107. https://doi.org/10.3390/nu12041107
Mettert EL, Kiley PJ (2017) Reassessing the Structure and Function Relationship of the O2 Sensing Transcription Factor FNR. Antioxid Redox Signal 29. https://doi.org/10.1089/ars.2017.7365
Nurizzo D, Silvestrini MC, Mathieu M, Cutruzzolà F, Bourgeois D, Fülöp V, Hajdu J, Brunori M, Tegoni M, Cambillau C (1997) N-terminal arm exchange is observed in the 2.15 Å crystal structure of oxidized nitrite reductase from Pseudomonas aeruginosa. Structure 5:1157–1171. https://doi.org/10.1016/s0969-2126(97)00267-0
Oh CK, Oh MC, Kim SH (2004) The Depletion of Sodium Nitrite by Lactic Acid Bacteria Isolated from Kimchi. J Med Food 7:38–44. https://doi.org/10.1089/109662004322984680
Paik HD, Lee JY (2014) Investigation of reduction and tolerance capability oflactic acid bacteria isolated from kimchi against nitrate and nitrite in fermented sausage condition. Meat Sci 97:609–614. https://doi.org/10.1016/j.meatsci.2014.03.013
Qiu HL, Chang XY, Luo Y, Shen FF, Yin AG, Miao TT, Li Y, Xiao YY, Hai JP, Xu B (2022) Regulation of nir gene in Lactobacillus plantarum WU14 mediated by GlnR.Front Microbial 13: 983485. https://doi.org/10.3389/fmicb.2022.983485
Ravcheev DA, Gerasimova AV, Mironov AA, Gelfand MS (2007) Comparative genomic analysis of regulation of anaerobic respiration in ten genomes from three families of gamma-proteobacteria (Enterobacteriaceae, Pasteurellaceae, Vibrionaceae). BMC Genomics 8:54. https://doi.org/10.1186/1471-2164-8-54
Sazzad HT, Kyeongjun K, Sang-Hyeok P, Jun-Ha P, Md A, Mevo SIU, Md FRM, Md IH, Won-Bo S, Iksoon K, Sang-Do H (2022) Prophylactic efficacy of Lactobacillus curvatus B67-derived postbiotic and quercetin, separately and combined, against Listeria monocytogenes and Salmonella enterica ser. Typhimurium on processed meat sausage. Meat Sci. https://doi.org/10.1016/j.meatsci.2022.109065
Schnadower D, O'Connell KJ, VanBuren JM, Vance C, Tarr PI, Schuh S, Hurley K, Rogers AJ, Poonai N, Roskind CG, Bhatt SR, Gouin S, Mahajan P, Olsen CS, Powell EC, Farion K, Sapien RE, Chun TH, Freedman SB (2021) Association Between Diarrhea Duration and Severity and Probiotic Efficacy in Children With Acute Gastroenteritis. Am J Gastroenterol116:1523-1532. https://doi.org/ 10.14309/ajg.0000000000001295.
Schweikert S, Kranz A, Yakushi T, Filipchyk A, Bott M (2021) FNR-Type Regulator GoxR of the Obligatorily Aerobic Acetic Acid Bacterium Gluconobacter oxydans Affects Expression of Genes Involved in Respiration and Redox Metabolism. Appl Environ Microbiol 87:e00195-21. https://doi.org/10.1128/AEM.00195-21
Wu C, Zheng J, Huang J, Zhou R (2013) Reduced nitrite and biogenic amine concentrations and improved flavor components of Chinese sauerkraut via co-culture of Lactobacillus plantarum and Zygosaccharomyces rouxii. Ann Microbiol64:847–857. https://doi.org/10.1007/s13213-013-0724-8
Yan PM, Xue WT, Tan SS, Zhang H, Chang XH (2008) Effect of inoculating lactic acid bacteria starter cultures on the nitrite concentration of fermenting Chinese paocai. Food Control19:50–55. https://doi.org/10.1016/j.foodcont.2007.02.008
Yang J, Feng L, Pi S, Cui D, Ma F, Zhao H, Li A (2020) A critical review of aerobic denitrification: Insights into the intracellular electron transfer. Sci Total Environ 731:139080. https://doi.org/10.1016/j.scitotenv.2020.139080
Zalazar L, Alonso CAI, De Castro RE, Cesari A (2013) An alternative easy method for antibody purification and analysis of protein–protein interaction using GST fusion proteins immobilized onto glutathione–agarose. Anal Bioanal Chem 406:911–914. https://doi.org/10.1007/s00216-013-7533-6
Zhou A, Chen YI, Zane GM, He Z, Hemme CL, Joachimiak MP, Baumohl JK, He Q, Fields MW, Arkin AP, Wall JD, Hazen TC, Zhou J (2011) Functional Characterization of Crp/Fnr-Type Global Transcriptional Regulators in Desulfovibrio vulgaris Hildenborough. Appl Environ Microbiol 78:1168–1177. https://doi.org/10.1128/aem.05666-11

No competing interests reported.

GraphicalAbstract.png
Graphic for Manuscript

Download PDF

Journal Publication

published 04 Nov, 2024

Read the published version in Archives of Microbiology →

Editorial decision: Revision requested
01 Sep, 2024
Reviews received at journal
31 Aug, 2024
Reviews received at journal
26 Aug, 2024
Reviews received at journal
25 Aug, 2024
Reviewers agreed at journal
20 Aug, 2024
Reviewers agreed at journal
20 Aug, 2024
Reviewers agreed at journal
19 Aug, 2024
Reviewers agreed at journal
19 Aug, 2024
Reviews received at journal
19 Aug, 2024
Reviewers agreed at journal
13 Aug, 2024
Reviewers agreed at journal
10 Aug, 2024
Reviews received at journal
18 Jul, 2024
Reviewers agreed at journal
05 Jul, 2024
Reviewers agreed at journal
05 Jul, 2024
Reviewers invited by journal
05 Jul, 2024
Editor assigned by journal
04 Jul, 2024
Submission checks completed at journal
04 Jul, 2024
First submitted to journal
03 Jul, 2024

You are reading this latest preprint version

Regulation Mechanism of Nitrite Degradation in Lactobacillus plantarum WU14 Mediated by Fnr

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Methods

Strains, medium, and chemicals

Sequence analysis and construction of plasmid and expression vector

Growth curve under different culture conditions and the test of ability to degrade NaNO₂

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1

Regulation Mechanism of Nitrite Degradation in Lactobacillus plantarum WU14 Mediated by Fnr

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Methods

Strains, medium, and chemicals

Sequence analysis and construction of plasmid and expression vector

Growth curve under different culture conditions and the test of ability to degrade NaNO2

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1

Growth curve under different culture conditions and the test of ability to degrade NaNO₂