In Vitro Sperm Generation from Immature Mouse Testicular Tissue Using Plasma Rich in Growth Factors

doi:10.21203/rs.3.rs-4710515/v1

Download PDF

Research Article

In Vitro Sperm Generation from Immature Mouse Testicular Tissue Using Plasma Rich in Growth Factors

https://doi.org/10.21203/rs.3.rs-4710515/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Culture medium enriched with Knockout serum replacement (KSR) can produce in vitro mouse sperm, but it is inefficient, strain-specific and contains bovine products, which limits its use in the human clinic. The study aimed to optimize the culture medium for testicular tissue by using plasma rich in growth factors (PRGF) as a serum supplement, addressing the limitations of KSR.

Methods

Immature testicular tissues from NMRI mice were cultured for 14 days to identify the optimal PRGF concentration using histological analysis and tubular integrity scoring. Subsequently, tissues were cultured for 42 days with the optimal PRGF concentration and compared to a control group with 10% KSR, followed by evaluation through histological, tubular integrity, and immunofluorescence assays.

Results

After 14 days, 5% PRGF media significantly preserved tubule integrity better than 10% and 20% PRGF, performing similarly to 10% KSR. However, after 42 days, the integrity scoring revealed significantly a higher percentage of well-preserved tubules in 5% PRGF compared to 10% KSR. Additionally, only PRGF supported spermatogenesis to the production of flagellated sperm. Real-time PCR analysis revealed that transcript levels of Plzf, Tekt1, and Tnp1 were significantly elevated in 5% PRGF compared to 10% KSR. Immunofluorescence and quantitative analysis confirmed enhanced spermatogenesis progression in 5% PRGF media, with significantly increased numbers of PLZF + spermatogonia, SYCP3 + spermatocytes, ACRBP + spermatids, and Ki67 + proliferating cells per tubule compared to 10% KSR. Moreover, 5% PRGF showed a significantly lower mean fluorescence intensity of the pro-apoptotic marker Bax, with no significant difference in the anti-apoptotic marker Bcl-2 compared to KSR.

Conclusions

The findings suggest that 5%PRGF is a viable alternative to KSR in mouse testicular tissue cultures, promoting structural integrity and spermatogenesis up to the production of flagellated sperm. These results pave the way for using autologous PRGF in refined culture media for in vitro sperm production, advancing personalized reproductive medicine.

in vitro spermatogenesis

testicular culture

sperm

PRGF

KSR

Male infertility is a significant factor contributing to infertility in couples, particularly observed in patients with non-obstructive azoospermia (NOA) and prepubertal boys undergoing cancer treatments such as chemotherapy and radiotherapy (1). Consequently, a critical objective of reproductive medicine is to induce and resume in vitro spermatogenesis using these patients' spermatogonial stem cells, aiming to produce functional sperm for conception through assisted reproductive technologies (ART) (2).

The first report of in vitro spermatogenesis dates back to 1920, involving the culture of rabbit testicular pieces on rabbit plasma for several days. After nine days, primary leptotene spermatocytes were observed (3). In 1937, pachytene prophase meiosis I spermatocytes were produced by culturing immature mouse testicular tissue on a clot containing equal parts fowl plasma and fowl embryo extract (4). About two decades later, Trowell developed the gold standard culturing system known as the gas-liquid interphase method (5).

Since then, many advancements have been made in in vitro spermatogenesis studies. In 2003, haploid spermatids were obtained by culturing testicular tissue from 5-day-old mice for two weeks in media containing Dulbecco's Modified Eagle Medium (DMEM) and 10% Fetal Bovine Serum (FBS). Although haploid round spermatids were successfully injected into oocytes, the eggs did not develop past the eight-cell stage (6).

To overcome these limitations, Sato et al. used KnockOut Replacement Serum (KSR) as a supplement in the testis culture medium. This study was the first to obtain both functional round spermatids and sperm from testicular tissue cultures of C57BL/6 transgenic mice (7).

Although culture media containing 10% KSR can stimulate in vitro spermatogenesis in immature mouse testicular tissue, several significant issues remain. Firstly, the use of KSR leads to occasional sperm formation, meaning the efficiency of in vitro spermatogenesis does not match that of in vivo spermatogenesis (8, 9). Secondly, KSR is ineffective for other mouse strains and species, and it can only fully induce in vitro spermatogenesis in testicular tissue from neonatal C57BL/6J mice (10). Therefore, developing suitable culture media for different strains and species is crucial. Thirdly, the KSR-containing medium is derived from bovine serum and contains xenobiotic products, limiting its application to human clinics (9). As a result, media supplementation used to induce spermatogenesis in testicular tissue culture must be optimized.

In recent years, plasma rich in growth factors (PRGF) has been increasingly used as a source of growth factors in animal and clinical studies (11, 12, 13, 14). PRGF is a subtype of platelet-rich plasma, a derivative of autologous blood consisting of high concentrations of platelets rich in growth factors, which play important roles in stimulating and accelerating tissue regeneration, as well as cell proliferation and differentiation (15). The use of autologous PRGF is safe and cost-effective and has received clinical use authorization from the European Community and the U.S. Food and Drug Administration (16).

Therefore, these advantages of PRGF present new opportunities for exploring its application as a serum supplement in culture media to induce in vitro spermatogenesis in immature mouse testicular tissue.

Ethics

Five-day postpartum (dpp) male NMRI (Naval Medical Research Institute) mice were housed in air-conditioned rooms maintained at a constant temperature of 22 ± 2°C and 55 ± 5% humidity, with a 12-hour light/dark cycle. This study was conducted in accordance with the guidelines outlined in the Iranian Guide for the Care and Use of Laboratory Animals (2020) and was approved by the Ethical Committee of the Faculty of Medical Sciences at Tarbiat Modares University, with permission number IR.MODARES.REC.1399.043. The work has been reported in line with the ARRIVE guidelines 2.0.

Culture Media and Reagents

The basal culture medium used was α-Minimum Essential Medium (α-MEM) (Invitrogen), supplemented with 10% KSR and various concentrations of PRGF. Additionally, 100 IU/mL penicillin/streptomycin and 50 µg/mL gentamicin (Invitrogen, Carlsbad, CA, USA) were added to the culture medium of both KSR and PRGF groups.

Determining the Optimized Concentration of PRGF by Short-term Testicular Culture (14 Days)

During the initial phase of this investigation, testicular tissues were subjected to a 14-day culture period in basal media supplemented with varying concentrations of PRGF (5%, 10%, and 20%) and a control group with 10% KSR. Subsequently, to identify the most effective PRGF concentration, a thorough histological analysis and an assessment of tubular structure integrity were conducted (Fig. 1A-D).

Evaluating the Efficiency of Optimal PRGF Concentration in Long-term Testicular Culture (42 Days)

In the subsequent phase of the study, testicular tissues were cultured for 42 days in basal media enriched with the previously determined optimal concentration of PRGF and, for comparison, in media containing 10% KSR as a control. Following this extended culture period, a comparative histological examination, an evaluation of tubular integrity, and an immunofluorescence assay were performed to assess the performance of the optimized PRGF-supplemented media relative to the control (Fig. 1E-G).

PRGF Preparation

To prepare PRGF, 300 mL of venous blood was obtained from six adult male donors using 50 mL blood extraction tubes containing 3.8% sodium citrate as an anticoagulant. Each sample was centrifuged at 2000 g for 4 minutes at room temperature (RT), resulting in three layers: red blood cells, white blood cells, and plasma. The plasma was subsequently separated and subjected to a second centrifugation at 5000 g for a duration of 5 minutes at RT. The plasma was then divided into two equal fractions, F1 and F2. The upper portion, F1, contained several platelets similar to those found in peripheral blood, while fraction F2 consisted of the upper layer of the buffy coat, containing the highest concentration of platelets. The F2 fraction was selected for activation and pooled to minimize variability in platelet lysis caused by variations in F2 growth factor concentrations across donors. (17). To activate the platelets, 10% calcium chloride (50 µl/mL of plasma) was added, and the falcon tube was placed in a water bath at 39°C for 2 hours. A gelatinous layer of blood cells formed gradually (Fig. 2A-B). The liquid surrounding the gelatinous layer was collected and centrifuged for 5 minutes at 20000 g (Fig. 2C). The resulting liquid was aliquoted in 1.5 cc microtubes and stored in a freezer at -80°C until needed. When the PRGF serum was required, the microtubes were removed from the freezer, thawed, and centrifuged at 13000 g for 10 minutes at 4°C to prevent culture media gelation. The final product was a plasma containing activated platelets, which was then added to the media as a serum.

Testicular Tissue Culture Method

After killing mice by cervical dislocation, immature testes were sectioned into 2–3 fragments, each measuring between 1 and 2 mm in diameter. As illustrated in Fig. 2-D, these tissue fragments were placed on stands made from agarose gel, and positioned within a 6-well plate. To fabricate the agarose gel, agarose powder (Karl Roth, Germany) was dissolved in distilled water at a concentration of 1.5% (w/v). This mixture was heated and then poured into a 10 cm dish. Once the gel had cooled, it was sliced into hexahedral blocks, each approximately 10 × 10 × 5 mm in size. These blocks were then immersed in culture media for a duration of 24 hours or longer, allowing the media to fully replace the water content. Each block of agarose gel was designated to hold between one to four pieces of the testicular tissue. The media volume was adjusted to fill the space to four-fifths of the gel's height. The media was refreshed every two days. The culture conditions were maintained in an incubator enriched with 5% CO₂ at a temperature of 34°C.

Histological Examination

Testicular tissues cultured for 14 and 42 days were fixed in Bouin's fixative for 4 hours at RT and subsequently embedded in paraffin. Serial sections (5 µm) were prepared from each specimen and stained with hematoxylin and eosin (H&E) for morphological analysis.

Quantitative Real-time PCR

Total RNA was extracted from four pieces of cultured testis tissue, lasting 42 days for each group. The extraction was performed using RNX-Plus™ (Cinnagen, Iran) and following the manufacturer's instructions. The concentration of the extracted RNA was measured using an ultraviolet spectrophotometer (DPI-l, Qiagen, IRI). DNase-treated RNA samples were then reverse transcribed into cDNA using the Revert Aid™ (Fermentase, Lithuania) first-strand cDNA synthesis kit and Oligo (dT) primers.

In preparation for the polymerase chain reaction (PCR) procedures, primers targeting specific genes—namely Plzf (spermatogonia), Tekt1 (spermatocyte), Tnp1 (spermatid), and ki67 (proliferation) were meticulously designed using an online primer design tool accessible through the NCBI website (www.ncbi.nlm.nih.gov/tools/primer-blast/) and were subsequently produced by a commercial entity (CinnaGen, Iran) (Table 1).

Quantitative Real-time PCR (qRT-PCR) experiments were conducted utilizing Master Mix supplemented with SYBR Green I dye (Fluka, Switzerland), and the reactions were carried out in a Biosystems StepOne™ instrument (Applied Biosystems, UK).

The PCR protocol commenced with a preliminary denaturation step at 94°C for a duration of 4 minutes, which was essential for the activation of the polymerase enzyme. This was followed by 40 consecutive cycles, each comprising a denaturation phase (20 seconds at 94°C), an annealing phase (30 seconds at 57°C), and an extension phase (20 seconds at 72°C).

Upon the conclusion of the PCR run, the integrity and specificity of the reactions were verified through the examination of melting curve profiles. For each analyzed sample, both the reference gene (β-actin) and the gene of interest were concurrently amplified within the same reaction. The relative quantification of the target genes, normalized against a housekeeping gene (β-actin), was ascertained employing the comparative cycle threshold (CT) method, also known as the 2^−∆∆CT method. The expression level of each gene in the control samples, which consisted of mature mouse testis tissue, was assigned a baseline value of 1. This baseline was then utilized to compute the relative changes in expression, or fold change, for the target genes across different experimental conditions. A p-value threshold of less than 0.05 was established to determine statistical significance in the observed gene expression differences.

Table 1

Primers sequences designed for Real-time PCR
Gene	Detection	Accession number	Primer sequence (5′-3′)
Plzf	Spermatogonia	NM_001033324.3	F: GCTGCTGTCTCTGTGATGG R: GGGCTGATGGAACATAGGGG
Tekt1	Spermatocyte	NM_011569	F: CACCAGGAAGTCTCAGAGCGAT R: GTAAGCAGGTCATCCGTCTGGT
Tnp1	Spermatid	NM_009407.2	F: TGTGATGCGGCAATGAGC R: CGACTGGGATTTACCCACTC
Ki67	Proliferation	NM_001081117	F: GAGGAGAAACGCCAACCAAGAG R: TTTGTCCTCGGTGGCGTTATCC
β-actin	Internal control	NM_001101	F: TCCCTGGAGAAGAGCTACG R: GTAGTTTCGTGGATGCCACA

Dissociation of Testicular Tissues

For sperm detection in 42-day cultured tissues, mechanical dissociation using an insulin needle on slides was performed to release cells into phosphate-buffered saline (PBS).

Immunofluorescence Staining

Tissues cultured for 42 days were fixed with 4% paraformaldehyde in PBS at 4°C overnight. To target spermatogonial stem cells, leptotene-stage spermatocytes, and sperm-like cells, primary antibodies against promyelocytic leukemia zinc finger protein (PLZF), synaptonemal complex protein 3 (SYCP-3), and acrosin binding protein (ACRBP) were utilized. Additionally, the expression of pro-apoptotic Bax, anti-apoptotic Bcl-2, and proliferation marker Ki67 was assessed.

After deparaffinization and rehydration, sections were treated with 10 mM trisodium citrate dihydrate (pH 6.0) in a microwave for 20 minutes at medium power (600 W) for antigen retrieval. Slides were then washed in TBS plus 0.03% Triton X-100 (Sigma- Aldrich) two times and nonspecific binding sites were blocked with a blocking buffer containing a 1% BSA solution in TBS for 2 hours at RT. Following this, slides were washed for 3 minutes and incubated overnight at 4°C with primary antibodies PLZF, SYCP-3, ACRBP, Bax, Bcl-2 (1:100, Santa Cruz Biotechnology, U.S.A.), and Ki67 (1:100, Elabscience, U.S.A.). After washing, slides were incubated with Cy3-conjugated Goat anti-Mouse IgG (1:100, Elabscience, U.S.A.) for 1 hour at RT in the dark. After washing, nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, 1:200, Sigma, Germany) for 5 minutes. Sections were then dehydrated through ascending ethanol concentrations, cleared with xylene, and mounted with coverslips.

Stained samples were visualized using a light and fluorescent microscope (Olympus BX50, Germany). Five random images per sample (magnification: x400) were captured and analyzed for fluorescence intensity using Image-J software (National Institutes of Health, Bethesda, MD, USA). For PLZF, SYCP-3, ACRBP, and Ki67, the mean number of antibody-positive cells per seminiferous tubule was calculated. For Bax and Bcl-2, mean fluorescence intensity was quantified following the method described by Leite et al. (18).

Integrity of Seminiferous Tubules

A double-blind assessment was conducted to evaluate the integrity of seminiferous tubules using semi-quantitative analysis under a light microscope at ×400 magnification, following the scoring method described by de Michele et al. (19). For this purpose, at least 200 round or nearly round tubules were randomly selected from 15 fields in 5 histological sections for each time point and culture medium. The four parameters investigated included: the adhesion of cells to the basement membrane, cell cohesion, proportion of pyknotic nuclei (less than 5% of the total), and the clear distinction between germ cells and Sertoli cells. The scoring system for seminiferous tubule integrity ranged from 1 (poorly preserved), 2 (fair), 3 (good) to 4 (best preserved).

Statistical Analysis

Graphical and statistical analyses were conducted using GraphPad Prism 4 software (GraphPad Software Inc., La Jolla, CA, USA). Quantitative data are presented as mean ± standard deviation (SD). Statistical analysis was performed using one-way ANOVA and T-tests. A significance level of P < 0.05 was considered statistically significant.

Histological and Tubular Integrity Evaluation to Determine Optimal PRGF Concentration

Histological evaluation after 14 days of culture showed central necrosis and degeneration of seminiferous tubules in all media (Fig. 3). Furthermore, the peripheral tubules of tissues cultured in 20% and 10% PRGF media exhibited poor preservation, with large clusters of apoptotic cells. In contrast, in 10% KSR and 5% PRGF media, a torus-shaped zone with intact and well-preserved tubules surrounded the central necrotic area, and spermatogenesis was active in this zone.

According to the integrity scoring system (Fig. 4A-D), the peripheral tubules in 20% and 10% PRGF media showed a disorganized pattern, with decreased cell cohesion and adhesion to the basement membrane, and an increased number of pyknotic cells. This resulted in a significantly higher percentage of tubules with a poorly preserved integrity score (1) compared to the 5% PRGF and 10% KSR media (Fig. 4E). The percentage of tubules with a fair integrity score (2) significantly increased in media containing 20% and 10% PRGF compared to the culture group with 10% KSR. However, the percentage of tubules with good and best-preserved integrity scores (3–4) significantly increased in cultures supplemented with 5% PRGF and 10% KSR compared to 20% and 10% PRGF.

Therefore, the 5% PRGF media significantly preserved the integrity of tubules after 14 days of culture compared to 10% and 20% PRGF. No significant difference was observed in the integrity score between the 10% KSR and 5% PRGF groups throughout the 14-day culture period.

Histological and Tubular Integrity Evaluation: Assessing the Efficiency of 5% PRGF Media for Long-term Culture

Comparative histological examination of 10% KSR and 5% PRGF media after 42 days of culture revealed necrosis and degeneration of tubules in the middle part of each tissue (Fig. 5A-B). However, the 5% PRGF media supported well-preserved peripheral tubules, with spermatogonial stem cells progressing to the meiotic phase and differentiating into round and elongated spermatids. In contrast, the 10% KSR media showed poorly preserved peripheral tubules with decreased cell cohesion and adhesion to the basement membrane.

Based on the integrity scoring system (Fig. 5C), it was found that after 42 days of tissue culture, the percentage of tubules with good and best-preserved integrity scores significantly increased in the presence of 5% PRGF compared to 10% KSR. Conversely, the use of KSR-supplemented media led to a higher percentage of tubules with poor and fair integrity scores (1–2) compared to 5% PRGF. In conclusion, media containing 5% PRGF proved to be more effective in preserving the integrity of tubules after 42 days of culture when compared to 10% KSR.

After 42 days of culture, four dissociated tissues from the 10% KSR and 5% PRGF media were observed under a light microscope. Four flagellated sperm cells were observed only in the 5% PRGF media (Fig. 5D).

Expression of genes involved in spermatogenesis and proliferation

Real-time PCR analysis revealed that the transcript levels of Plzf, Tekt1, and Tnp1 were significantly elevated in tissues treated with 5% PRGF relative to those treated with 10% KSR (p < 0.05). In contrast, the expression of Ki67 remained relatively unchanged between the two treatment groups. Following culture of testicular tissues from both groups, the expression levels of the Tekt1, Tnp1, and Ki67 genes showed a significant reduction when compared to the control group, which consisted of adult mouse testes (p < 0.05) (Fig. 1).

Assessment of Immunofluorescence Staining Following 42 Days of Testicular Tissue Culture

Quantitative immunofluorescence results showed that the mean number of PLZF + cells (spermatogonial stem cells) per tubule in the 5% PRGF media was significantly greater than in the KSR media (P = 0.0045) (Fig. 6AB).

The onset of meiosis and the differentiation of spermatogonia were marked by the emergence of cells positive for SYCP3, a marker for spermatocytes, in both culture media (Fig. 6AB). However, a quantitative analysis revealed a significant increase in the number of spermatocytes per seminiferous tubule in the medium supplemented with 5% PRGF compared to the KSR-supplemented medium (P = 0.0013).

The identification of post-meiotic markers, specifically ACRBP (a spermatid and sperm marker), confirms the presence of more advanced stages of spermatogenesis. Quantitative analysis demonstrated a statistically significant increase (P = 0.0212) in the number of ACRBP-positive cells per tubule in the 5% PRGF media compared to the KSR group (Fig. 6AB). This indicates that the 5% PRGF media is more effective in promoting the progression of spermatogenesis to later stages.

The proliferation status was evaluated by Ki67 + cell analysis, which showed a significant increase in the number of Ki67 + cells per tubule in the 5% PRGF media compared to KSR (P = 0.0293) (Fig. 7AB).

Figure 7 illustrates a significant increase in the mean fluorescence intensity of the pro-apoptotic marker Bax per field, comparing the KSR group to the 5% PRGF group, after 42 days of culture (P = 0.0004). However, the mean fluorescence intensity of the anti-apoptotic marker Bcl-2 per field in media supplemented with 5% PRGF did not show a statistically significant increase compared to KSR after 42 days of culture (P = 0.2477), as demonstrated in (Fig. 7AB).

In vitro sperm production is a complex biological process that has challenged researchers for the past hundred years. The testicular tissue culture media supplemented with KSR is far from optimal, and there is much room for improvement. Researchers have attempted to enhance media composition by formulating chemically defined mediums, but none have resulted in successful sperm production (1, 20, 21).

This study aimed to develop a media for in vitro spermatogenesis without the use of KSR. In the first step, the effects of adding three different concentrations of PRGF to the basal media were evaluated during 14 days of NMRI mice testes culture. Notably, the media supplemented with 20% and 10% PRGF exhibited poorly preserved peripheral tubules, characterized by decreased cell cohesion and attachment to the basement membrane, and an increased number of pyknotic cells. These findings suggest that high concentrations of PRGF may have detrimental effects on the structural integrity and cellular viability of the seminiferous tubules due to increased cytotoxicity. Similar to the research, various studies have indicated that using overly high platelet concentrations, due to the presence of excessive growth factors, can suppress the proliferation of osteoblasts, fibroblasts, and adipose-derived mesenchymal stem cells (22, 23, 24).

Conversely, media supplemented with 5% PRGF, similar to 10% KSR, maintained a greater percentage of tubules with good and best-preserved integrity (scores 3–4) compared to 20% and 10% PRGF. A separate study, consistent with the findings, demonstrated that 5% PRP media led to significantly higher viability and proliferation of spermatogonial stem cells compared to 1%, 2.5%, and 10% PRP after a 14-day culture (25).

In contrast, the evaluation of the long-term culture at 42 days revealed distinct differences between the 10% KSR and 5% PRGF groups. In 5% PRGF media, the integrity of peripheral tubules was significantly better preserved compared to 10% KSR, and spermatogenesis progressed up to the production of flagellated sperm. In addition, real-time PCR analysis demonstrated that the use of 5% PRGF significantly enhanced the transcript levels of Plzf, Tekt1, and Tnp1 in comparison to tissues treated with 10% KSR (p < 0.05).This finding suggests that 5% PRGF may be an effective substitute for KSR in supporting in vitro spermatogenesis and mature sperm production. PRGF is a human autologous blood derivative rich in proteins and growth factors such as insulin-like growth factor 1 (IGF-I), transforming growth factor-β1 (TGF-β1), epidermal growth factor (EGF), bone morphogenetic proteins (BMP), basic fibroblast growth factor (bFGF), hepatocyte growth factor (HGF), and vascular endothelial growth factor (VEGF) (26), which can play crucial roles in improving the in vitro spermatogenesis process.

In mouse testis culture, IGF-1, TGF-α, and EGF can induce differentiation of type A spermatogonial cells (27, 28). Consequently, the increased count of PLZF-positive spermatogonial and SYCP3-positive spermatocytes observed in each tubule following a 42-day culture in 5% PRGF media, as compared to KSR, is likely due to the presence of these growth factors in PRGF.

The significant difference in the number of ACRBP + spermatid and sperm cells per tubule observed in PRGF-cultured tissues compared to KSR can likely be attributed to the presence of TGF-β in PRGF. This is because TGF-β plays a key role in the auto/paracrine pathways that regulate the meiotic differentiation of spermatocytes (29). Additionally, IGF-1 supplementation in the media has been demonstrated to enhance the quantity of both round and elongated spermatids in cultured mouse testicular tissue (30).

Growth factors such as BMP2, BMP7, HGF, IGF-1, and VEGF play a stimulatory role in the proliferation of spermatogonia and Sertoli cells during in vitro spermatogenesis (31, 32, 33). The presence of these factors can effectively contribute to a significant increase in the number of Ki67 + cells in tissues cultured with PRGF.

The application of 5% PRGF significantly downregulated Bax expression while upregulating Bcl-2 expression, suggesting its anti-apoptotic effects. These effects can be attributed to HGF and IGF-1 within PRGF, as previous research has demonstrated their roles in promoting the survival of germ cells in rats and mice, respectively (30, 33). Moreover, other studies have highlighted the importance of PRGF in promoting the proliferation, differentiation, and survival of stem cells under in vitro conditions (34, 35).

The findings suggest that KSR did not successfully induce complete spermatogenesis or even maintain the structural integrity of the peripheral tubules in NMRI mice after a 42-day culture. Initial reports suggested that KSR could induce complete in vitro spermatogenesis in mice (7, 36). However, later studies revealed that the effectiveness of KSR in successful spermatogenesis is strain-dependent and worked with C57BL/6 mice testes. Specifically, it was found that KSR was poorly supported in vitro spermatogenesis in testis of B6D2F2 mice (10). In another study, it was observed that the basal media formulation used by Sato et al. (7) (𝛼MEM and KSR) rarely promoted spermatogonial cell progression up to the spermatocyte stage in CD1 and C57 mice strains (37). Furthermore, current evidence suggests KSR is not sufficient to achieve complete in vitro spermatogenesis in rat and human immature testicular tissues (19, 38, 39, 40).

Besides the inefficiencies noted for KSR in testicular tissue culture, the limitation of its clinical application highlights the necessity for an appropriate alternative. Given these limitations, human autologous blood derivatives have been proposed as a preferable alternative to supplements derived from xenogeneic sources, such as KSR (41, 42, 43, 44, 45, 46). The use of autologous PRGF, as a personalized medicine approach with promising potential for maximum patient safety (47) and maintenance of genomic stability (24, 48), presents a suitable opportunity for future research in the field of in vitro spermatogenesis in different species.

In this study, we successfully produced flagellated spermatozoa using immature mouse testicular tissue culture. However, a notable limitation was the absence of an investigation into the fertility potential of the in vitro-generated sperm and spermatids using microinsemination techniques. Consequently, this aspect warrants further scientific inquiry.

In conclusion, our study presents compelling evidence that 5% PRGF is a promising substitute for KSR in in vitro spermatogenesis, enhancing structural integrity and cell viability in NMRI mouse testicular tissue cultures. Our findings show that 5% PRGF not only preserves the architecture of seminiferous tubules but also supports the progression of spermatogenesis up to the production of flagellated sperm. These results underscore the potential of autologous PRGF as a key component in refining culture media for in vitro sperm production, offering a path away from xenogeneic supplements towards a more personalized medicine approach. While our study achieved the production of mature sperm, future research should investigate the fertility potential of these spermatozoa to assess their practical applications in reproductive technologies.

KSR: Knockout serum replacement

PRGF: Plasma rich in growth factors

NOA: Non-obstructive azoospermia

ART: Assisted reproductive technologies

DMEM: Dulbecco's Modified Eagle Medium

FBS: Fetal Bovine Serum

Dpp: Day postpartum

NMRI: Naval Medical Research Institute

α-MEM: α-Minimum Essential Medium

RT: Room temperature

H&E: Hematoxylin and eosin

qRT-PCR: Quantitative Real-time PCR

CT: Cycle threshold

PBS: Phosphate-buffered saline

PLZF: Promyelocytic leukemia zinc finger protein

SYCP-3: Synaptonemal complex protein 3

ACRBP: Acrosin binding protein

IGF-I: Insulin-like growth factor 1

TGF-β1: Transforming growth factor-β1

EGF: Epidermal growth factor

BMP:Bone morphogenetic proteins

bFGF: basic fibroblast growth factor

HGF: Hepatocyte growth factor

VEGF: Vascular endothelial growth factor

Ethics approval and consent to participate

This research project, titled "Effects of Plasma Rich in Growth Factors (PRGF) Treatment in Neonate Mouse Testicular Organ Culture," was carried out in accordance with the "Guideline for the Care and Use of Laboratory Animals in Iran" (2021). All donors signed informed consent forms for blood donation. It received ethical approval from the Committee of the Faculty of Medical Sciences at Tarbiat Modares University, under the permission number IR.MODARES.REC.1399.043; date of approval: 22th June 2020.

Consent for publication

Not applicable.

Availability of data and materials

The data supporting the findings of this study are available upon request from the corresponding authors.

Competing interests

All authors confirm that they have reviewed and understood the journal's policies on conflict of interest disclosure and authorship. They declare no competing interests related to this work. Each author has contributed significantly to the research and manuscript preparation, reviewed and approved the final version for publication.

Funding

The authors would like to acknowledge the financial support provided by the Research Deputy of Tarbiat Modares University (TMU), Tehran, Iran, as well as the Ministry of Science, Research and Technology and Modares Science and Technology Park, under grant number 02-00-01-000940, which enabled this project to be undertaken.

Authors' contributions

SAM conducted the investigation and authored the manuscript. MM was responsible for study design and contributed to the manuscript's editing. All authors reviewed and approved the final version of the manuscript.

Acknowledgment

The authors would like to express their gratitude to the Research Deputy of Tarbiat Modares University (TMU) in Tehran, Iran, and Ministry of Science, Research and Technology and Modares Science and Technology Park for their support and assistance. The authors declare that they have not used Artificial Intelligence in this study.

Authors' information

Department of Reproductive Biology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran

Seyyed Amir Moradian

Department of Anatomical Sciences, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran

Mansoureh Movahedin

Corresponding author

Correspondence to Mansoureh Movahedin.

Sanjo H, Komeya M, Sato T, Abe T, Katagiri K, Yamanaka H, et al. In vitro mouse spermatogenesis with an organ culture method in chemically defined medium. PLoS One. 2018;13(2):e0192884.
Yokonishi T, Ogawa T. Cryopreservation of testis tissues and in vitro spermatogenesis. Reproductive medicine and biology. 2016;15:21-8.
Champy C. De la méthode de culture des tissus. VI. Le testicule. Arch Zool Exptl Gen. 1920;60:461-500.
Martinovitch PN. Development in vitro of the mammalian gonad. Nature. 1937;139(3514).
Trowell OA. The culture of mature organs in a synthetic medium. Exp Cell Res. 1959;16(1):118-47.
Suzuki S, Sato K. The fertilising ability of spermatogenic cells derived from cultured mouse immature testicular tissue. Zygote. 2003;11(4):307-16.
Sato T, Katagiri K, Gohbara A, Inoue K, Ogonuki N, Ogura A, et al. In vitro production of functional sperm in cultured neonatal mouse testes. Nature. 2011;471(7339):504-7.
Chapin RE, Winton T, Nowland W, Danis N, Kumpf S, Johnson K, et al. Lost in translation: The search for an in vitro screen for spermatogenic toxicity. Birth Defects Research Part B: Developmental and Reproductive Toxicology. 2016;107(6):225-42.
Yokonishi T, Sato T, Komeya M, Katagiri K, Kubota Y, Nakabayashi K, et al. Offspring production with sperm grown in vitro from cryopreserved testis tissues. Nature communications. 2014;5(1):4320.
Portela JM, Mulder CL, van Daalen SK, de Winter-Korver CM, Stukenborg J-B, Repping S, et al. Strains matter: success of murine in vitro spermatogenesis is dependent on genetic background. Developmental biology. 2019;456(1):25-30.
Dehghani F, Sotoude N, Bordbar H, Panjeshahin MR, Karbalay-Doust S. The use of platelet-rich plasma (PRP) to improve structural impairment of rat testis induced by busulfan. Platelets. 2019;30(4):513-20.
Solakoglu Ö, Heydecke G, Amiri N, Anitua E. The use of plasma rich in growth factors (PRGF) in guided tissue regeneration and guided bone regeneration. A review of histological, immunohistochemical, histomorphometrical, radiological and clinical results in humans. Ann Anat. 2020;231:151528.
Anitua E, Muruzabal F, de la Fuente M, Riestra A, Merayo-Lloves J, Orive G. PRGF exerts more potent proliferative and anti-inflammatory effects than autologous serum on a cell culture inflammatory model. Exp Eye Res. 2016;151:115-21.
Vaidakis D, Papapanou M, Siristatidis CS. Autologous platelet-rich plasma for assisted reproduction. Cochrane Database Syst Rev. 2024;4(4):Cd013875.
Ruzafa N, Pereiro X, Fonollosa A, Araiz J, Acera A, Vecino E. Plasma Rich in Growth Factors (PRGF) Increases the Number of Retinal Müller Glia in Culture but Not the Survival of Retinal Neurons. Front Pharmacol. 2021;12:606275.
Anitua E, Pascual C, Antequera D, Bolos M, Padilla S, Orive G, et al. Plasma rich in growth factors (PRGF-Endoret) reduces neuropathologic hallmarks and improves cognitive functions in an Alzheimer's disease mouse model. Neurobiology of aging. 2014;35(7):1582-95.
Agostini F, Polesel J, Battiston M, Lombardi E, Zanolin S, Da Ponte A, et al. Standardization of platelet releasate products for clinical applications in cell therapy: a mathematical approach. J Transl Med. 2017;15(1):107.
Leite C, Silva NT, Mendes S, Ribeiro A, de Faria JP, Lourenço T, et al. Differentiation of human umbilical cord matrix mesenchymal stem cells into neural-like progenitor cells and maturation into an oligodendroglial-like lineage. PLoS One. 2014;9(10):e111059.
de Michele F, Poels J, Vermeulen M, Ambroise J, Gruson D, Guiot Y, et al. Haploid Germ Cells Generated in Organotypic Culture of Testicular Tissue From Prepubertal Boys. Front Physiol. 2018;9:1413.
Sanjo H, Yao T, Katagiri K, Sato T, Matsumura T, Komeya M, et al. Antioxidant vitamins and lysophospholipids are critical for inducing mouse spermatogenesis under organ culture conditions. Faseb j. 2020;34(7):9480-97.
Matsumura T, Sato T, Abe T, Sanjo H, Katagiri K, Kimura H, et al. Rat in vitro spermatogenesis promoted by chemical supplementations and oxygen-tension control. Scientific Reports. 2021;11(1):3458.
Kakudo N, Minakata T, Mitsui T, Kushida S, Notodihardjo FZ, Kusumoto K. Proliferation-promoting effect of platelet-rich plasma on human adipose-derived stem cells and human dermal fibroblasts. Plast Reconstr Surg. 2008;122(5):1352-60.
Graziani F, Ivanovski S, Cei S, Ducci F, Tonetti M, Gabriele M. The in vitro effect of different PRP concentrations on osteoblasts and fibroblasts. Clin Oral Implants Res. 2006;17(2):212-9.
Atashi F, Jaconi ME, Pittet-Cuénod B, Modarressi A. Autologous platelet-rich plasma: a biological supplement to enhance adipose-derived mesenchymal stem cell expansion. Tissue Eng Part C Methods. 2015;21(3):253-62.
Khadivi F, Koruji M, Akbari M, Jabari A, Talebi A, Ashouri Movassagh S, et al. Application of platelet-rich plasma (PRP) improves self-renewal of human spermatogonial stem cells in two-dimensional and three-dimensional culture systems. Acta Histochem. 2020;122(8):151627.
Anitua E, Alkhraisat MH, Orive G. Perspectives and challenges in regenerative medicine using plasma rich in growth factors. J Control Release. 2012;157(1):29-38.
Tajima Y, Watanabe D, Koshimizu U, Matsuzawa T, Nishimune Y. Insulin-like growth factor-I and transforming growth factor-alpha stimulate differentiation of type A spermatogonia in organ culture of adult mouse cryptorchid testes. Int J Androl. 1995;18(1):8-12.
Haneji T, Koide SS, Tajima Y, Nishimune Y. Differential effects of epidermal growth factor on the differentiation of type A spermatogonia in adult mouse cryptorchid testes in vitro. J Endocrinol. 1991;128(3):383-8.
Damestoy A, Perrard MH, Vigier M, Sabido O, Durand P. Transforming growth factor beta-1 decreases the yield of the second meiotic division of rat pachytene spermatocytes in vitro. Reprod Biol Endocrinol. 2005;3:22.
Yao J, Zuo H, Gao J, Wang M, Wang D, Li X. The effects of IGF-1 on mouse spermatogenesis using an organ culture method. Biochem Biophys Res Commun. 2017;491(3):840-7.
Puglisi R, Montanari M, Chiarella P, Stefanini M, Boitani C. Regulatory role of BMP2 and BMP7 in spermatogonia and Sertoli cell proliferation in the immature mouse. Eur J Endocrinol. 2004;151(4):511-20.
Tian R, Yang S, Zhu Y, Zou S, Li P, Wang J, et al. VEGF/VEGFR2 Signaling Regulates Germ Cell Proliferation in vitro and Promotes Mouse Testicular Regeneration in vivo. Cells Tissues Organs. 2016;201(1):1-13.
Catizone A, Ricci G, Del Bravo J, Galdieri M. Hepatocyte growth factor modulates in vitro survival and proliferation of germ cells during postnatal testis development. J Endocrinol. 2006;189(1):137-46.
Mellado-López M, Griffeth RJ, Meseguer-Ripolles J, Cugat R, García M, Moreno-Manzano V. Plasma Rich in Growth Factors Induces Cell Proliferation, Migration, Differentiation, and Cell Survival of Adipose-Derived Stem Cells. Stem Cells Int. 2017;2017:5946527.
Irastorza I, Luzuriaga J, Martinez-Conde R, Ibarretxe G, Unda F. Adhesion, integration and osteogenesis of human dental pulp stem cells on biomimetic implant surfaces combined with plasma derived products. Eur Cell Mater. 2019;38:201-14.
Yokonishi T, Sato T, Komeya M, Katagiri K, Kubota Y, Nakabayashi K, et al. Offspring production with sperm grown in vitro from cryopreserved testis tissues. Nat Commun. 2014;5:4320.
Chapin RE, Winton T, Nowland W, Danis N, Kumpf S, Johnson K, et al. Lost in translation: The search for an in vitro screen for spermatogenic toxicity. Birth Defects Res B Dev Reprod Toxicol. 2016;107(6):225-42.
Reda A, Hou M, Winton TR, Chapin RE, Söder O, Stukenborg JB. In vitro differentiation of rat spermatogonia into round spermatids in tissue culture. Mol Hum Reprod. 2016;22(9):601-12.
Portela JMD, de Winter-Korver CM, van Daalen SKM, Meißner A, de Melker AA, Repping S, et al. Assessment of fresh and cryopreserved testicular tissues from (pre)pubertal boys during organ culture as a strategy for in vitro spermatogenesis. Hum Reprod. 2019;34(12):2443-55.
Yuan Y, Li L, Cheng Q, Diao F, Zeng Q, Yang X, et al. In vitro testicular organogenesis from human fetal gonads produces fertilization-competent spermatids. Cell Res. 2020;30(3):244-55.
Astori G, Amati E, Bambi F, Bernardi M, Chieregato K, Schäfer R, et al. Platelet lysate as a substitute for animal serum for the ex-vivo expansion of mesenchymal stem/stromal cells: present and future. Stem Cell Res Ther. 2016;7(1):93.
Hemeda H, Giebel B, Wagner W. Evaluation of human platelet lysate versus fetal bovine serum for culture of mesenchymal stromal cells. Cytotherapy. 2014;16(2):170-80.
Anitua E, Zalduendo M, Troya M. Autologous plasma rich in growth factors technology for isolation and ex vivo expansion of human dental pulp stem cells for clinical translation. Regen Med. 2019;14(2):97-111.
Burnouf T, Strunk D, Koh MB, Schallmoser K. Human platelet lysate: Replacing fetal bovine serum as a gold standard for human cell propagation? Biomaterials. 2016;76:371-87.
Kandoi S, L PK, Patra B, Vidyasekar P, Sivanesan D, S V, et al. Evaluation of platelet lysate as a substitute for FBS in explant and enzymatic isolation methods of human umbilical cord MSCs. Sci Rep. 2018;8(1):12439.
Shen H, Wang M, Li D, Yuan ST, Liu QH. A novel xeno-free culture system for human retinal pigment epithelium cells. Int J Ophthalmol. 2019;12(4):563-70.
Vogenberg FR, Isaacson Barash C, Pursel M. Personalized medicine: part 1: evolution and development into theranostics. P t. 2010;35(10):560-76.
Anitua E, Fuente M, Troya M, Zalduendo M, Alkhraisat MH. Autologous Platelet Rich Plasma (PRGF) Preserves Genomic Stability of Gingival Fibroblasts and Alveolar Osteoblasts after Long-Term Cell Culture. Dent J (Basel). 2022;10(9).

Download PDF

Reviewers agreed at journal
11 Sep, 2024
Reviewers invited by journal
30 Aug, 2024
Editor assigned by journal
06 Aug, 2024
First submitted to journal
05 Aug, 2024
Editorial decision: Major Revision
27 Jul, 2024

You are reading this latest preprint version

In Vitro Sperm Generation from Immature Mouse Testicular Tissue Using Plasma Rich in Growth Factors

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials and Methods

Ethics

Culture Media and Reagents

Determining the Optimized Concentration of PRGF by Short-term Testicular Culture (14 Days)

Evaluating the Efficiency of Optimal PRGF Concentration in Long-term Testicular Culture (42 Days)

PRGF Preparation

Testicular Tissue Culture Method

Histological Examination

Quantitative Real-time PCR

Dissociation of Testicular Tissues

Immunofluorescence Staining

Integrity of Seminiferous Tubules

Statistical Analysis

Results

Histological and Tubular Integrity Evaluation to Determine Optimal PRGF Concentration

Histological and Tubular Integrity Evaluation: Assessing the Efficiency of 5% PRGF Media for Long-term Culture

Expression of genes involved in spermatogenesis and proliferation

Assessment of Immunofluorescence Staining Following 42 Days of Testicular Tissue Culture

Discussion

Conclusion

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1