sgRNA and LAMP primers designing:
NDM variant gene sequences were downloaded from databases such as the Comprehensive Antibiotic Resistance Database (CARD)17 and the National Center for Biotechnology Information (NCBI)18, and aligned using Clustal Omega19. The aligned sequences were then viewed using AliView20. sgRNA was designed in the conserved region, and six LAMP primers were designed around the sgRNA. (see Table 1 for sequences).
Table 1
Details of the Oligo sequences used in the study
Primer name | Sequence |
NDM_Cas12a_g1_F | TAATTTCTACTAAGTGTAGATGCCGCCAATGGCTGGGTCGAA |
NDM_F3 (NDM outer primer) | CGCAAGAGGGGATGGTTG |
NDM_B3 (NDM outer primer) | TGTCGGCATCACCGAGAT |
NDM_LF (NDM Loop primer) | TTCGACCCAGCCATTGGC |
NDM_LB (NDM Loop primer) | GCTTTTGGTGGCTGCCTG |
NDM_FIP (NDM inner primer) | GTTGGGCGCGGTTGCTGG-GCAACACAGCCTGACTTTCG |
NDM_BIP (NDM inner primer) | CACCGTTGGGATCGACGGC-ACTTGGCCTTGCTGTCCTTG |
NDM_ref_F | GGTTTGGCGATCTGGTTTTC |
NDM_ref_R | CGGAATGGCTCATCACGATC |
NDM_F4 | TTGCGACTTATGCCAATGCGTTG |
NDM_B4 | ATCACGATCATGCTGGCCTTGG |
Testing the conservation of designed oligos and Ethical statement:
This was done using the genomic sequence data from 122 isolates. Briefly, these isolates are part of a multi-centre study mapping the prevalence of AMR, as well as its genetic underpinnings, across India. With this goal, genomic DNA of three pathogenic species, namely Escherichia coli, Klebsiella pneumoniae and Acinetobacter baumanii, from diverse specimens were extracted in two different tertiary healthcare centers using a DNeasy Blood & Tissue Kit (69504, Qiagen).
Library was prepared using Nextera XT DNA Library Preparation Kit − 96 samples (CAT No: FC-131-1096) at the sequencing facility of the National Center for Biological Sciences. Sequencing was done at the same place using the Illumina NovaSeq 6000 platform with 2x100bp sequencing read length. The raw sequence data was filtered and assembled using a GitHub pipeline21.
We used the fasta files of the genomic assemblies to screen for the presence of the NDM gene. For the screening, we first used ResFinder 22 to determine the overall antibiotic-resistance genes and their positions in the 122 assembled genomes. Using python (v 3.9.13) and RStudio (R v4.2.1) 23, the samples positive for NDM gene variants were screened and the NDM gene sequences (ranging from 793 to 813 base pairs in length) were extracted. Jalview (v 2.11.3.3)24 was used to view and align these sequences and check for the designed oligos conservation. The details of the NDM-positive isolates are given in Table S1.
Institutional ethics committee approval for the multi-centre study was obtained at Ashoka University. Additionally, both clinical partners viz. Max Healthcare and Sahyadri Hospital obtained ethical clearances from their respective ethics committees.
Isothermal Amplification:
Multi-Purpose LAMP Master Mix (DNA) (ABT-025S, Aurabiotech) was used to set up isothermal amplification. Briefly, 1 µl of the sample was added to the LAMP reaction mix containing, 5 µl of 2X reaction buffer, 0.4 µl of Bst1.0 enzyme, 0.2 µM of outer primers, 0.4 µM of loop primers, and 1.6 µM of inner primers. The reaction was incubated at 60oC for one hour.
Trans-cleavage assay:
The detection mix was prepared by pre-incubating 1.3 µM of the sgRNA, 1.3 µM of Cas12a (Alt-RTM L.b. Cas12a (Cpf1) Ultra, (10007923, IDT)), 5 µM ssDNA-FQ (/56-FAM/TT ATT /3IABkFQ, IDT) in 1X NEBuffer™ 2 (B7002S, NEB) at room temperature for 10 mins to facilitate RNP complex formation. Following incubation, the detection mix was introduced to the template and incubated at 37OC for both cis and trans-cleavage activity in the Tecan Infinite MPlex with an excitation wavelength of 480 nm. Relative fluorescence units were recorded for every 2.5 minutes at 520 nm emission wavelength.
PathCrisp assay- isothermal amplification followed by trans-cleavage assay (two-step)
For UDG-free amplification of the target, a Multi-Purpose LAMP Master Mix (DNA) (ABT-025S, Aurabiotech) was used. Briefly, 1 µl of the sample was added to the LAMP reaction mix containing, 5 µl of 2X reaction buffer, 0.4 µl of Bst1.0 enzyme, 0.2 µM of outer primers, 0.4 µM of loop primers and 1.6 µM of inner primers.
For amplification with UDG, WarmStart Multi-Purpose LAMP/RT-LAMP 4x Master Mix (with UDG) (M1718B, NEB) was used. Briefly, 1 µl of the sample was added to the LAMP reaction mix containing, 3.5ul of master mix, 0.2 µM of outer primers, 0.4 µM of loop primers and 1.6 µM of inner primers.
LAMP reaction was carried out at 60oC for 1 hour. No template control (NTC) was used as a negative control for the LAMP reaction in each batch.
For detection, 10 µl of amplified product was treated with the detection Mix for the trans-cleavage assay. The detection Mix was prepared as described previously in trans-cleavage assay using Cas12a (Alt-R™ A.s. Cas12a (Cpf1) Ultra, (10001272, IDT) or Alt-R™ L.b. Cas12a (Cpf1) Ultra, (10007923, IDT)) and incubated at 60oC for Cis- and Trans-cleavage activity for 30 mins. An end-point reading at the 30th minute was recorded in a Tecan Infinite MPlex (Sl. No: 2203009710) with 480 nm wavelength excitation and 520 nm wavelength emission.
Known NDM controls were used to study the specificity of our assay: NDM-1 positive K.pneumoniae (NDM-1) DNA CONTROL (MBC107-R, Vircell) and NDM negative controls: genomic DNA of P.aeruginosa, A.baumannii, K.pneumoniae, E.coli (O157:H7) from Himedia. Further, pJET1.2 backbone plasmid negative for NDM was used as a negative plasmid control, and a human sample's genomic DNA was also included in the study.
No template control (Detection negative) and 0.3nM pJET1.2_NDM plasmid (Detection positive) were used in each batch as trans-cleavage controls. This pJET1.2_NDM plasmid details are mentioned in the next segment
Limit of Detection of PathCrisp assay:
To analyze the limit of detection of our developed assay, the NDM partial gene was amplified using NDM F4 and NDM B4 primers (sequences available in Table 1), which are located outside of outer LAMP primers, using Q5 High-Fidelity 2X Master Mix (M0492S, NEB). The amplified product was cloned into the pJET1.2/blunt plasmid using CloneJET PCR Cloning Kit (K1231, Thermo Scientific). The sequence-confirmed (sequence available in Supplementary data-1), pJET1.2_NDM plasmid was quantified using NanoDrop One™ (Thermo Scientific, USA). The concentration was 28.6 pg/µl, roughly corresponding to 7.36E + 06 copies/µl (calculated through NEBioCalculator25). This plasmid was further 10-fold serial diluted to obtain dilutions as low as 7 copies/µl. The diluted plasmid was used to set up the PathCrisp assay. The assay was replicated 5 times: 3 times with Alt-R™ A.s. Cas12a (Cpf1) Ultra, (10001272, IDT) and 2 times with Alt-RTM L.b. Cas12a (Cpf1) Ultra, (10007923, IDT) at Trans-cleavage step of PathCrisp.
Clinical sample preparation and Ethical statement:
Clinical Samples were collected from patients, from which the pathogens were then isolated post-culture. These pathogens were further cultured, and bacterial cultures with VITEK-2 reports were obtained from Sri Venkateswara Institute of Medical Sciences, Tirupati. The DNeasy Blood & Tissue Kit (69504, Qiagen) was used for DNA extraction.
Institutional Ethics Committee approval was obtained from Sri Sathya Sai Institute of Higher Learning (SSSIHL/IEC/PSN/BS/2014/03) and Sri Venkateswara Institute of Medical Sciences Tirupati (1121 dated 20.03.2021) in accordance with the ethical standards of the Declaration of Helsinki. Further, the Institutional Biosafety Committee of C-CAMP approved the study
(BT/IBKP/392/2020) and also from the MedStar Speciality Hospital Ethics Committee (Dated 07022024).
Sequencing-based sample validation:
Clinical samples were amplified using Thermo 2X PCR master mix (K0171, Thermo Scientific) as described in Mahalingam et al. 201826. Briefly, a 50 µl PCR amplification was carried out using ~ 20 ng template, 25 µl 2X thermo MM, and 1 µM primer mix: NDM_ref_F and NDM_ref_R. Positive samples were further sequenced to analyze the NDM variant using NCBI’s nucleotide Basic Local Alignment Search Tool (BLAST)27. Negative samples were further amplified by using NDM-F3/B3 and NDM-F4/B4 primers (refer to Table 1 for sequences and Table 2 for thermal cycler conditions)
Table 2
Details of the PCR programme used
Primer | Initial denaturation | Denaturation | Annealing | Extension | Number of cycles | Final extension | Expected Band size |
NDM_ref_F + NDM_ref_R | 94°C for 5 mins | 94°C for 40 sec | 52°C for 40 sec | 72°C for 1 min | 30 | 72°C for 10 min | 629 bp |
NDM_F3 + NDM_B3 | 94°C for 5 mins | 94°C for 40 sec | 53°C for 40 sec | 72°C for 1 min | 30 | 72°C for 10 min | 228 bp |
NDM_F4 + NDM_B4 | 94°C for 5 mins | 94°C for 40 sec | 55°C for 40 sec | 72°C for 1 min | 30 | 72°C for 10 min | 334 bp |
PathCrisp assay from Crude extract:
To analyze the sensitivity of the PathCrisp assay in detecting NDM from crude extract, pJET1.2_NDM plasmid transformed E. coli DH5-alpha were used. Two types of culture were used: (i) streaked colony and (ii) broth culture.
For colony testing: A single bacterial colony was picked up using a 10 µl tip, dissolved in 10 µl of NFW, and boiled at 95oC for 5 mins to prepare the crude extract. One microlitre of crude extract was used to initiate PathCrisp assay-based diagnosis. For the media control, the pipette tip was scratched on a fresh agar plate to represent no colony control. The plasmid transformed E. coli DH5-alpha negative for pJET1.2_NDM was used for the negative control.
For broth testing: two hundred microlitres of overnight cultured broth were spun down at 13000 g for 5 minutes. Ten microliters of the culture from the bottom of the tube were collected in a fresh tube and boiled at 95oC for 5 minutes to prepare crude extract. One microlitre of crude extract was used to initiate PathCrisp assay-based diagnosis. For the broth-only control, 10ul of fresh LB broth was used. For the negative control, Salmonella culture was used. All the work was done in appropriate biosafety cabinets with appropriate controls.
Diagnostic Testing Accuracy of PathCrisp Assay and PCR
Sensitivity and Specificity were calculated according to Shreffler J, Huecker MR, 2024 28. Briefly, Sequenced confirmed samples were considered True positives and the rest were True negatives. Based on this, the following counts were made for each type of test: True positives (A), False positives (B), False negatives (C) and True negatives (D).
Sensitivity (in percentage) was calculated using the following equation:
Sensitivity = 100*(A)/((A)+(C))
Specificity (in percentage) was calculated using the following equation:
Specificity = 100*(D)/((D)+(B))
Analysis
To determine if the sample is positive or negative, its RFU value was compared with the LAMP_NTC. In the case of multiple repeats, the Sum of 3 times the Standard deviation and average RFU value of LAMP was considered to mark the cutoff.