Chemical materials
DMBA (7,12-dimethyl benzanthracene) was obtained from Sigma Chemicals. The hydrophilic photosensitizers zinc phthalocyanine tetrasulfonic acid (ZnPcS4) and α,β,χ,δ porphyrin-Tetrakis (1-methylpyridinium-4-yl) p-Toluenesulfonate porphyrin (TMPyP) were purchased from Sigma-Aldrich. Adricin (doxorubicin HCL solution) was from Hikma Specialized Pharmaceuticals (Cairo, Egypt). All other chemicals were of reagent grade.
Optimization and Setup of Femtosecond Laser System
Photodynamic therapy was performed on mice with DMBA-induced breast cancer using a 690 nm femtosecond laser with an average output of 300 mW. The INSPIRE HF100 laser system was utilized to emit laser pulses powered by a mode-locked femtosecond Ti: sapphire MAI TAI HP laser (Spectra-Physics). The laser system has an average power of approximately 1.5–2.9 W, a repetition rate of 80 MHz, and emits light with wavelengths spanning from 690 to 1040 nm. As shown in Fig. 2, we employed a beam expander consisting of two converging lenses to expand the initial laser beam from a diameter of around 2 mm to a diameter of 1 cm, covering the entire region of the breast tissue. In addition, highly reflective mirrors were employed to direct the laser beam towards the target tissue. A laser beam attenuator (A) was also employed to adjust the laser intensity provided to the breast tissue, as shown in Fig. 2. The power meter (Newport 843R) was used for measuring the ultimate laser beam power.
Animals
Sixty healthy Swiss female albino mice (average weight 25 ± 3 g) were obtained from the National Research Centre, Cairo, Egypt. All mice were maintained in clean cages under typical laboratory conditions of room temperature (22 ± 3°C) and light (12 h of light and 12 h of darkness). They were supplied with access to a standard pellet diet and a loose approach to water.
Ethical approval
The experimental protocol was approved by the Research Ethics Committee for Animal Research at the National Hepatology and Tropical Medicine Research Institute (NHTMRI), approval No. A1-2024. This study was reported according to ARRIVE guidelines and animal handling and experiments were conducted in consonance with the guidelines of the National Institutes of Health (NIH) for animal care and use in experimental procedures.
Doses determination
Mammary tumors were induced in mice using the carcinogen DMBA (40 mg/kg BW) dissolved in olive oil. The hydrophilic ZnPcS4 and TMPyP photosensitizers were dissolved in a saline solution at a concentration of 0.5 mg/mL (for a dose of 2 mg/kg body weight) freshly before injection, and 0.1 mL of each photosensitizer solution was calculated to be intravenously injected into the tail vein of a 25-g mouse. The commercial Adricin drug (doxorubicin hydrochloride, 50 mg/25 ml) was intravenously injected at a dose of 3 mg/kg/week diluted in saline. The typical DOXO dose for human breast cancer patients is 40–75 mg/m2 in combination with other drugs (https://www.drugs.com/dosage/doxorubicin.html; last updated March 14, 2023). The selected DOXO dose of 3 mg/kg/week for two weeks, with a cumulative dose of 6 mg/kg, corresponds to a human dose of 0.48 mg/kg (or 18 mg/m2) [14], which is lower than the usual dosage for breast cancer patients.
Experimental design
After acclimatization, the 60 mice were divided randomly into the main four groups, and the experimental design is illustrated in Figure 3 as follows:
Group I (n = 7): healthy female mice received saline intravenously via the vein tail.
Group II (Toxicity, n = 7): healthy female mice were intravenously injected with a combination of Doxorubicin, ZnPcS4, and TMPyP at doses of 3 mg/kg, 2 mg/kg, and 2 mg/kg, respectively, once weekly for two weeks via the tail vein.
Group III (control, n = 7): normal mice only received olive oil as a vehicle by oral gavage.
Group IV (DMBA, n = 39): mice treated with 40 mg/kg of DMBA dissolved in olive oil by oral gavage once a week for 5 weeks. Following a 10-week period since the last dose of DMBA, the existence of breast tumors was verified through histopathological examination of breast tissues from three DMBA-treated mice. Subsequently, the remaining DMBA-treated mice were randomly divided into five subgroups (n = 7 each) as follows:
Group A (DMBA): The DMBA-treated control group did not receive any treatment (no drug or light).
Group B (DOXO only): DMBA-treated mice were given 3 mg/kg of Doxorubicin once per week for two weeks (for a cumulative dose of 6 mg/kg).
Group C (ZnPcS4-PDT+DOXO): DMBA-treated mice were given 2 mg/kg of ZnPcS4 and 3 mg/kg of Doxorubicin once per week for two weeks.
Group D (TMPyP-PDT+DOXO): DMBA-treated mice were given 2 mg/kg of TMPyP and 3 mg/kg of Doxorubicin once per week for two weeks.
Group E (ZnPcS4/TMPyP-PDT + DOXO): DMBA-treated mice were given ZnPcS4 and TMPyP at a dose of 2 mg/kg BW, along with 3 mg/kg of Doxorubicin, once per week for two weeks.
Regarding PDT-mediated treatment groups (C, D, and E), laser exposure was performed 24 hours after each IV injection of photosensitizers. The animals in these groups were anesthetized with ketamine/xylazine (80/10 mg/kg), and breast tissues were irradiated with a femtosecond pulsed 690-nm laser with a power of 300 mW and an exposure time of 5 min (115 J/cm2). The mice in groups A and B were anesthetized without being exposed to the laser.
Animal blood and tissue harvesting
After 2 days of the last laser dose, all animals were anesthetized by diethyl ether. Blood samples were collected by cardiac puncture from mice, and serum samples were separated. Afterwards, the animals were euthanized via cervical dislocation under diethyl ether anesthesia, and mammary glands from healthy mice (Group III) and mammary tumors from subgroups of Group IV were collected.
Toxicity assessment
An approximate 1 mL portion of blood from healthy mice injected with either saline (group I) or a mixture of Doxorubicin + ZnPcS4 + TMPyP (group II) was collected for a blood chemistry test and complete blood count (CBC) analysis before euthanasia. Hepatotoxicity was assessed by recording the activity of serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) using commercial colorimetric assay kits (Spectrum, Egypt). In addition, the serum levels of renal function markers, including urea and creatinine, were measured using commercially available kits from Abcam (UK) and Biodiagnostic (Egypt), respectively.
TGF-β and CA 15-3 enzyme-linked immunoassay (ELISA)
Blood samples for transforming growth factor beta (TGF-β) and carcinoma antigen 15-3 (CA 15-3) were collected from the control group (Group III) and all DMBA subgroups (untreated and treated) in a clot activator vacutainer for serum separation. The serum was separated immediately by centrifugation and stored at -80°C. Sera was only thawed once, just before the analysis. The serum levels of TGF-β and CA 15-3 were analyzed using a sandwich enzyme-linked immunosorbent assay method using TGF-β1 (MyBioSorces, USA) and CA 15-3 (LSBio, USA) ELISA kits. The analysis was conducted according to the manufacturer’s methodology. The reaction was halted by the addition of a stop solution; absorbance is quantified at 450 nm utilizing a Microplate Reader Spectrophotometer (Thermo Scientific). The absorbance is directly proportional to the quantity of TGF-β and CA 15-3 present in each sample. A standard curve was generated by plotting the relative absorbance of each standard solution versus its respective concentration.
Histology examination and immunohistochemistry
For histological analysis, mammary glands were harvested from euthanized mice 48 hours after the last light dose and preserved in 10% formalin, followed by embedding in paraffin. Tissue sections were dewaxed in xylene, rehydrated by gradient ethanol, rinsed with distilled water, and then stained with hematoxylin and eosin (H&E). After staining, the slices were dehydrated with increasing concentrations of ethanol and xylene. The morphological images of the tissues were captured using a Leica fluorescence microscope.
The immunohistochemical staining was performed with rabbit anti-ki-67 (ab833; Abcam) and anti-Bcl2 (ab182858; Abcam) antibodies, diluted at a ratio of 1:100. The reactions were identified by utilizing horseradish peroxidase-conjugated goat anti-rabbit IgG (Santa Cruz, USA), and the color was generated using 3,3-diaminobenzidine tetrahydrochloride (DAB, Santa Cruz, USA) and halted by rinsing in deionized water followed by microscopy.
Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
Total RNA was isolated from mammary glands and tumors using TRIzol reagent (Thermo Fisher Scientific, USA) following the instructions provided by the manufacturer. The concentration, purity, and integrity of the isolated purified total RNA were assessed by measuring the absorbance at A260 nm/A280 nm using Nanodrop. Complementary DNA was synthesized using High-Capacity cDNA reverse transcription kit (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Finally, the cDNA was employed for fluorescence-based relative quantitative PCR using SYBR Green qPCR Master Mix (Thermo Fisher Scientific, USA) to detect the relative mRNA expression of EGFR, NRAS, NF-κB, mTERT, c-Myc, and Caspase-3 normalized with GABDH as a housekeeping gene. The gene-specific primers were designed using the IDT-PrimerQuest tool ((http://eu.idtdna.com/primerquest/ home/index) and validated using the IDT-OligoAnalyzer Tool (https://www.idtdna.com/calc/analyzer) to analyze their melting temperature (Tm), guanine and cytosine content (percent GC), primer hairpin (ΔG), and primer dimerization (ΔG). The primers sequences are listed in Table 1. The RT-PCR reaction was prepared in a final volume of 25 µL by mixing 2 µL of each cDNA sample (diluted 1:5), 12.5 µL of SYBR Green, 1 µL of each primer, and 0.05 µL of ROX solution, and the final volume was adjusted through the addition of nuclease-free water. The amplification program was adjusted as follows: initial denaturation step for 10 min at 95°C, followed by 40 cycles (denaturation at 94°C for 15 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec). Melting curves were performed by rapid heating to 95°C for 15 sec to denature the DNA, followed by cooling to 60°C to assure the purity and specificity of the amplified products. The relative quantification of mRNA was calculated using the comparative CT method (n = 2–ΔΔCt).
Table 1: The primer sequences used in quantitative real-time PCR.
Gene
|
Forward primer (5’-3’)
|
Reverse primer (5’-3’)
|
EGFR
|
ACTGCTGGTGTTGCTGACCG
|
GTTGGGTGAGCCTGTTACTT
|
NRAS
|
GCCTTGACGATCCAGCTAAT
|
CCATCAATCACCACTTGCTTTC
|
NF-κB
|
CATCCTCGTCCGCCTATTAC
|
CCCAATTCTCCAATCCTCTCTC
|
mTERT
|
TACATCACAGAGAGCACATTCC
|
CTCAAGGTGTTGCCTGACT
|
c-Myc
|
TCCTTTGGGCGTTGGAAA
|
CGCAGATGAAATAGGGCTGTA
|
Caspase-3
|
GTGTGCGAGATGAGGTGTT
|
TTCTTAGCGTACCGTTCCAAG
|
GAPDH
|
TGAGCCTCCTCCAATTCAACC
|
AAATCCGTTCACACCGACCT
|
Statistical analysis
Data are presented as mean ± standard error of the mean (SEM). All the data were tested for normality of distribution using the Shapiro-Wilk test. Statistical analysis and multiple comparisons of normally distributed data were performed by one-way ANOVA and Tukey's post-hoc test using the Statistical Package for Social Science version 20 (SPSS software package, Chicago, USA). A P-value of <0.05 was considered statistically significant.