Plant material
Sphaeralcea angustifolia seeds were collected at Huichapan, Hidalgo State, Mexico, and taxonomically identified by Santiago Xolalpa Molina, M.Sc., responsible for the medicinal plants Herbarium of the Mexican Institute of Social Security from Mexico City (Herbarium, IMSSM) with voucher number 16,412.
Aseptic culture
Seeds of S. angustifolia were disinfected with 70% ethanol for 3 min, then with 1.2% sodium hypochlorite solution for 10 min, and finally washed four times with sterile distilled water for 10 min. The sterile seeds were sprouted in glass bottles with 50% nutrients of Murashige and Skoog (MS) medium (Murashige and Skoog, 1962), supplemented with 30 g/L sucrose, pH 5.7 and 3.0 g/L phytagel. Before use, the culture medium was autoclaved at 121°C and 1.2 kg/cm2 pressure for 18 min. The glass containers with the seeds were incubated for their germination in a culture room at 25 ± 2°C with a light/dark (16 h:8 h) photoperiod under 50 µM m-2 s-1 of warm white-fluorescent light intensity.
Transformation procedure
Leaves and nodal segments were obtained from 2-month-old seedlings. The explants were dipped in a suspension of the bacterial strains A. rhizogenes K599/pTDT (cucumopine type; OD550 = 0.5), A4/pTDT or ATCC 15834/pTDT (agropin type; OD550 = 0.5) for 10 min. The binary vector pTDT contains the gene that encodes the tomato threonine deaminase enzyme, which gives a red fluorescence to the transformed plant tissue. Subsequently, each explant was dried on sterile filter paper to remove excess of bacterial suspension and transferred to a glass bottle with co-culture medium based on MS medium, pH 5.7 and 3.0 g/L phytagel, and incubated at previously described conditions for 48 h. At the end of this time, the bacteria were eliminated with three washes with sterile distilled water containing the antibiotics ceftriaxone and cefotaxime (300 mg/L each) for 10 min each. Consecutively, the explants were dried on a piece of sterile filter paper and then transferred to a glass bottle with MS medium supplemented with 10 g/L of sucrose and the above-mentioned antibiotics at the same concentrations and incubation conditions described.
Selection of putatively transformed roots
The number of nodal segments and leaf explants infected with the A. rhizogenes strain ATCC 15834/pTDT, A4/pTDT, and K599/pTDT generated hairy root were recorded.
Each hairy root sprouting from any explant infected with A. rhizogenes strain was individualized when reaching a length of approximately 1.0 cm and considered a putatively transformed root line. Root and explant numbers were used for classification and identification. The roots were cultured individually in new glass bottles containing semi-solid MS medium supplemented with 10 g/L sucrose, 3.0 g/L phytagel, pH 5.7, and 300 mg/L cefotaxime and ceftriaxone; in the subsequent subculture, the antibiotic concentration was reduced to 100 mg/L. Finally, hairy roots free of A. rhizogenes were transferred to glass bottles with basal MS medium added with 30 g/L, pH 5.7, 2.5 g/L of phytagel without antibiotics and incubated under the conditions previously described.
The selection criteria for hairy roots were: 1) physical characteristics (plagiotropic roots and increased branching), 2) growth capacity in the absence of growth regulators, and 3) emission of red fluorescence under an epifluorescence microscope (Carl Zeiss V8).
Each hairy root line (2 g) was cultivated into 250 ml Erlenmeyer flasks with 80 mL of liquid MS medium added with 30 g/L sucrose and incubated at 25 ± 2°C with light/darkness (16 h:8 h) photoperiod under 50 µM m-2 s-1 intensity of warm white-fluorescent light in an orbital shaker at 110 rpm (New Brunswick Scientific Co., Inc.). Every 4 weeks, hairy root cultures were vacuum filtered using a Buchner funnel (Whatman filter paper No. 1, 9-cm diameter), and the retained roots weighted and transferred (2 g) to flasks with fresh medium.
Growth of hairy root lines
From selected hairy root lines, the growth was evaluated after 2 and 3 weeks in culture; three flasks were taken at the beginning of the culture and at each time of culture. Each flask was vacuum filtered using a Buchner funnel (Whatman filter paper No. 1, 9-cm diameter) and the retained roots washed with sterile distilled water; the fresh weight (FW) was determined, and the roots dried in an oven (Thelco 160 DM) at 65°C for 48 h. The growth index (GI) at 2 and 3 weeks of growth was determined in dry weight (DW) considering the following formula:
Transformation confirmation
Total DNA samples of each hairy root line were isolated and used as a template for PCR analysis to determine the presence of the rolC gene (Bonhomme et al., 2000) and the absence of virD2 gene (Haas et al., 1995) in transformed hairy roots using specific primers: the forward primer 5’ TGTGACAAGCAGCGATGAGC 3’ and reverse 5’ GATTGCAAACTTGCACTCGC 3’ was used to amplify a 490 bp fragment of the rolC gene, and the second one forward 5’ ATGCCCGATCGAGCTCAAGT 3’ and reverse 5’ ACCGTCGGCTCTACAAACCCAGTCC 3’ to amplify a 338 bp fragment of the virD2 gene, this gene was used as a control since it is not transferred to the plant cell during the transformation process. A DNA amplification kit from Vivantis was used following the manufacturer directions. Each sample was prepared in 200 µL PCR tubes on ice to obtain a total reaction volume of 50 µL, comprising 1 µL DNA template, 5 µL 10X Taq DNA polymerase reaction buffer, 2 µL 50 mM MgCl2, 1 µL of each primer (10 µM), 2 µL dNTPs mixture (2 mM), 0.5 µL of recombinant Taq DNA polymerase (5 U/µL) and 37.5 µL of nuclease free water. PCR amplification for both genes was carried out in an Mastercycler Gradient device (Eppendorf, Hamburg, Germany) under the following conditions: 1 cycle of 5 min at 95°C, 35 cycles of 1 min denaturing at 95°C, 1 min annealing at 50°C, and 1 min extension at 72°C; as a final point, one cycle of 5 min final extension at 72°C (Moreno-Anzúrez et al., 2017).
The PCR products were subjected to electrophoresis in 1% agarose gel at 100 volts for 60 min and visualized on a UV transilluminator (BioDoc-It™ Imaging System, Upland, CA, USA) using ethidium bromide staining for visualization and documentation.
Chemical analysis
Extract preparation
The dry biomass of three flasks from each line of hair roots was extracted three times by maceration (24 h for each procedure) at room temperature with a mixture of reactive grade solvents (CH2Cl2:CH3OH 9:1; Merck) in a ratio of 1:50 (w/v). The extracts were filtered, pooled, and concentrated to dryness under reduced pressure. The content of sphaeralcic acid and scopoletin in the CH2Cl2:CH3OH extract was determined by high-performance liquid chromatography (HPLC, Pérez-Hernández et al., 2014; Nicasio-Torres et al., 2016; Nicasio-Torres et al., 2017; Pérez-Hernández et al., 2019a).
HPLC conditions
HPLC analyses were performed using a Waters system (2695 Separation Module) coupled to a diode array detector (2996) with a 190–600-nm detection range and operated through the Manager Millennium software system (Empower 1; Waters Corp., Boston, MA, USA). Separations were performed on a Spherisorb RP-18 column (250 × 4.6 mm, 5.0 µm; Waters Corporation) using a constant temperature of 25 °C during analyses. Samples (20 µL) were eluted at a flow rate of 1.0 mL/min with a mobile phase gradient of high purity: (A) H2O with TFA (0.5%, Sigma Aldrich) and (B) CH3CN high purity (Merck). The compounds were detected by monitoring scopoletin and tomentin absorbance l= 344 nm and sphaeralcic acid l= 357 nm. The identification of scopoletin (99% purity; Sigma-Aldrich Chemical, Mexico), tomentin (93%), and sphaeralcic acid (95%) was carried out by comparing their absorption spectra and their retention times (scopoletin 10.3 min, tomentin 10.2 min, and sphaeralcic acid 22.8 min). The concentration ratio for scopoletin quantification ranges from 1.25 to 20 µg/mL and sphaeralcic acid from 2.5 to 40 µg/mL. The regression equation for scopoletin was (y) = 165407 (x) +16720, r2 = 0.9993, and for sphaeralcic acid it was (y) = 7381.9 (x) + 1362.2, r2 = 0.9998, with r2> 0.99 (Nicasio-Torres et al., 2016; Serrano-Román et al., 2020).