NUCKS1 promotes invasion and metastasis of colorectal cancer by stabilizing HDAC2 and activating AKT

doi:10.21203/rs.3.rs-4742056/v1

Download PDF

Article

NUCKS1 promotes invasion and metastasis of colorectal cancer by stabilizing HDAC2 and activating AKT

https://doi.org/10.21203/rs.3.rs-4742056/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Nuclear ubiquitous casein and cyclin-dependent kinase substrate 1 (NUCKS1) functions as an oncogene in colorectal cancer (CRC), promotes the progression of CRC, and is associated with poor prognosis in patients. Studies have found that NUCKS1 promotes tumor cell metastasis, yet its role in CRC invasion and metastasis remains unclear. To investigate this, transwell migration and invasion assay, wound healing assay, and immunofluorescence assay were performed in vitro. Additionally, label-free protein quantification, coimmunoprecipitation (Co-IP), q-PCR, and Western blotting were utilized to analyze NUCKS1's molecular mechanisms in CRC. In vivo, CRC cells were injected into the tail vein to examine NUCKS1's impact on lung and liver metastasis in mice, with hematoxylin-eosin (HE) staining used to evaluate metastatic lesion sizes. Results indicated higher NUCKS1 expression in metastatic CRC compared to non-metastatic samples. Knockdown of NUCKS1 in vitro inhibited CRC invasion and metastasis. Moreover, NUCKS1 was initially found to upregulate HDAC2 expression by inhibiting the lysosomal pathway, activating AKT, and thus promoting CRC invasion and metastasis. In vivo, overexpression of NUCKS1-induced lung and liver metastasis was suppressed by HDAC2 knockdown or intraperitoneal administration of the HDAC2 inhibitor Santacruzamate A. These findings suggest that NUCKS1 contributes to CRC invasion and metastasis by stabilizing HDAC2 and activating AKT, highlighting NUCKS1 and HDAC2 as potential therapeutic targets for CRC.

Biological sciences/Cancer/Tumour biomarkers

Biological sciences/Cell biology/Cell migration

Colorectal cancer (CRC) is the third most common cancer worldwide and the second leading cause of cancer death [1, 2]. CRC is characterized by its heterogeneous nature and early asymptomatic presentation. As the disease progresses to a certain extent, it manifests through various symptoms such as changes in stool shape and bowel habits, bloody or purulent stools, painful urination, weight loss, and fatigue [3]. Although early screening programs can reduce the incidence of CRC, early-stage CRC often remains undetected due to the lack of symptoms, leading to missed diagnoses. Surgical resection is the primary treatment for CRC, yet 30–40% of postoperative patients still experience tumor metastasis [4]. Hence, understanding the mechanisms of CRC metastasis, identifying related proteins and pathways, and developing effective therapeutic drugs are crucial for improving patient outcomes. Additionally, it provides a basis for research and scientific evidence for establishing biomarkers for early diagnosis of CRC. It also offers feasible and effective strategies for the clinical treatment of advanced metastatic CRC.

Nuclear ubiquitous casein and cyclin-dependent kinase substrate 1 (NUCKS1) is a member of the high mobility group family, highly expressed in various tumor cell types and tissues [5, 6]. NUCKS1 functions as an oncogene in several cancers, including CRC [7], cervical squamous cell carcinoma [8], breast cancer [9], gastric cancer [10], and lung cancer [11]. Additionally, NUCKS1 acts as a transcription factor to promote the growth and metastasis of osteosarcoma cells [12] and regulates tumor cells' entry into the S phase [13]. Previous research demonstrated that NUCKS1 is highly expressed in CRC and promotes its proliferation [14]. However, its role in CRC invasion and metastasis remains unclear.

Zn²⁺-dependent histone deacetylases (HDACs) are classified into classes I to IV, with histone deacetylase 2 (HDAC2), a class I enzyme, located in the nucleus [15]. HDAC2 is crucial in tumorigenesis, promoting cancer cell proliferation by regulating signaling pathways, apoptosis, and cell cycle progression [16–18]. Moreover, HDAC2 triggers migration and invasion in non-small cell lung cancer via activation of nuclear factor-κB (NF-κB) [19]. When ubiquitinated by Rho GTPase-activating protein 4, HDAC2 inhibits β-catenin activation, reducing pancreatic cancer cell invasion and migration [20]. Consequently, HDAC2 is a target for preventing pancreatic cancer metastasis [21]. In CRC, HDAC2 is highly expressed and promotes epithelial-mesenchymal transition (EMT) by binding HDAC1 and EZH2 [22], playing a significant role in CRC development [23]. Thus, HDAC2 emerges as a potential therapeutic target for CRC treatment. At present, over 300 HDAC inhibitors are under clinical research, with over 10 approved drugs. HDAC2 inhibitors exert anti-tumor effects by inhibiting HDAC activity, regulating histone acetylation status, promoting transcription and expression of anti-tumor transcription factors, and modulating related signaling pathways. The primary indications for these inhibitors include tumors, neurological diseases, metabolic diseases, autoimmune diseases, and cardiovascular diseases [24].

This study revealed that NUCKS1 promotes CRC invasion and metastasis in vitro and in vivo. NUCKS1 influences CRC invasion and metastasis by stabilizing HDAC2 and enhancing AKT phosphorylation. Importantly, NUCKS1 interacts with HDAC2, regulating its protein levels through the lysosomal pathway. Additionally, HDAC2 inhibitors may serve as effective clinical treatments for patients with CRC exhibiting high NUCKS1 expression.

NUCKS1 promotes the invasion and metastasis of CRC

Expression of NUCKS1 in metastatic and non-metastatic CRC was analyzed using the human cancer metastasis database (HCMDB). Databases GSE71222 and GSE14095 indicated that NUCKS1 is highly expressed in metastatic CRC (Fig. 1a, b). To evaluate the function of NUCKS1 in CRC, stable NUCKS1-silenced HCT116 cells and NUCKS1-overexpressing SW480 and DLD1 cells were constructed (Fig. 1c, d). Transwell assays revealed that NUCKS1 silencing significantly reduced the migration and invasion abilities of tumor cells compared to controls (Fig. 1e). Conversely, NUCKS1 overexpression markedly promoted the migration and invasion of SW480 and DLD1 cells (Fig. 1f). Wound healing assays further demonstrated that NUCKS1 silencing decreased migration in HCT116 cells (Fig. 1g), whereas NUCKS1 overexpression enhanced migration in SW480 and DLD1 cells (Fig. 1h). Additionally, FITC phalloidin staining showed that NUCKS1 silencing reduced the distribution of central actin microfilaments and their connection with dense peripheral bands in HCT116 cells (Fig. 1i). Control SW480 and DLD1 cells exhibited dense peripheral bands, and NUCKS1 overexpression increased peripheral actin staining (Fig. 1j). These findings suggest that NUCKS1 plays a crucial role in promoting CRC invasion and metastasis.

NUCKS1 regulates the invasion and metastasis of CRC via the HDAC2/AKT signaling pathway

To elucidate the molecular mechanism by which NUCKS1 promotes CRC invasion and metastasis, label-free quantitative proteomics identified differentially expressed proteins mediated by NUCKS1. Results showed 643 differentially expressed proteins in NUCKS1-knockdown cells compared to controls (Supplementary Table S1). A literature review further screened 183 tumor-related proteins (Supplementary Table S2). GEPIA analysis identified 28 differentially expressed proteins significantly associated with NUCKS1 and highly expressed in CRC (Fig. 2a). Among these, HDAC2 is known to promote EMT in CRC cells [22, 23], and NUCKS1 has been found to mediate the PI3K/AKT signaling pathway [14]. NUCKS1 silencing in HCT116 cells reduced HDAC2 and phosphorylated AKT levels, whereas NUCKS1 overexpression increased these levels (Fig. 2b and Supplementary Fig. S1a).

To investigate HDAC2's role in CRC invasion and metastasis, HDAC2-silenced HCT116 cells and HDAC2-overexpressing SW480 and DLD1 cells were constructed. HDAC2 silencing reduced phosphorylated AKT levels in HCT116 cells, while HDAC2 overexpression increased phosphorylated AKT levels (Fig. 2c and Supplementary Fig. S1b). Transwell assays demonstrated that HDAC2 silencing significantly reduced HCT116 cell invasion and migration (Fig. 2d), whereas HDAC2 overexpression enhanced the invasion and migration of SW480 and DLD1 cells (Fig. 2e and Supplementary Fig. S1c).

To confirm whether NUCKS1 promotes CRC invasion and metastasis via HDAC2, HDAC2 was overexpressed in NUCKS1-silenced HCT116 cells. This rescued the expression levels of HDAC2 and phosphorylated AKT (Fig. 2f). Conversely, knocking out HDAC2 in NUCKS1-overexpressing SW480 and DLD1 cells significantly reduced HDAC2 and phosphorylated AKT levels (Fig. 2g and Supplementary Fig. S1d). Transwell assays showed that the suppression of migration and invasion by shNUCKS1 in HCT116 cells was partially reversed by HDAC2 overexpression (Fig. 2h). Similarly, HDAC2 silencing reduced the invasion and migration of NUCKS1-overexpressing SW480 and DLD1 cells (Fig. 2i and Supplementary Fig. S1e). These results indicate that NUCKS1 induces CRC cell invasion and metastasis by regulating HDAC2/AKT.

HDAC2 inhibitor Santacruzamate A reduces the invasion and metastasis caused by NUCKS1 overexpression

Santacruzamate A, a selective and potent HDAC2 inhibitor, was employed to further investigate the role of NUCKS1 in promoting CRC invasion and metastasis through HDAC2 [25, 26]. In NUCKS1-overexpressing SW480 and DLD1 cells, Santacruzamate A significantly inhibited invasion and metastasis abilities, as shown by transwell assays (Fig. 3a, b). Additionally, wound healing assays demonstrated increased migration in NUCKS1-overexpressing cells compared to controls, which was inhibited by Santacruzamate A (Fig. 3c, d). F-actin analysis further confirmed that Santacruzamate A reduced the distribution of central actin microfilaments in NUCKS1-overexpressing cells compared to untreated cells (Fig. 3e, f). While Santacruzamate A inhibited HDAC2 protein expression, it did not affect NUCKS1 protein levels (Supplementary Fig. S2a). In NUCKS1-silenced HCT116 cells, treatment with Santacruzamate A further decreased migration and invasion abilities (Supplementary Fig. S2b). These findings suggest that NUCKS1 promotes CRC invasion and metastasis by regulating HDAC2, whereas HDAC2 does not regulate NUCKS1 protein expression.

NUCKS1 interacts with and stabilizes HDAC2

To confirm the interaction between NUCKS1 and HDAC2, a correlation analysis of NUCKS1 and HDAC2 mRNA levels was performed using GEPIA, revealing a significant positive correlation (Fig. 4a). Co-IP and Western blotting were utilized to validate the interaction, with total protein immunoprecipitated using an anti-HDAC2 antibody. NUCKS1 was co-immunoprecipitated in HCT116 and SW480 cells (Fig. 4b). Additionally, stable HEK 293T cells overexpressing flag-tagged NUCKS1 demonstrated binding of HDAC2 to exogenous NUCKS1 via Co-IP and Western blotting (Fig. 4c), indicating their interaction. Immunofluorescence assays showed colocalization of NUCKS1 and HDAC2 in the nucleus (Fig. 4d, e and Supplementary Fig. S3a), consistent with previous reports on NUCKS1 [27] and HDAC2 [28] localization. Mean fluorescence intensity (MFI) analysis indicated that NUCKS1 silencing in HCT116 cells significantly reduced the MFI of NUCKS1 and HDAC2, while NUCKS1 overexpression in SW480 and DLD1 cells increased their MFI compared to controls (Fig. 4f, g and Supplementary Fig. S3b). HDAC2 mRNA levels remained unchanged after NUCKS1 silencing or overexpression (Fig. 4h). Protein synthesis inhibitor cycloheximide (CHX) was used to assess HDAC2 stability, revealing greater stability in control cells compared to NUCKS1-silenced HCT116 cells (Fig. 4i). These findings suggest that NUCKS1 interacts with and stabilizes HDAC2.

NUCKS1 inhibits lysosome-dependent degradation of HDAC2.

Destruction of NUCKS1 significantly increases HDAC2 degradation. To explore the protein degradation pathways through which NUCKS1 affects HDAC2 levels, the effects of specific inhibitors were investigated. Lysosomal inhibitor chloroquine (CQ) inhibited HDAC2 degradation mediated by NUCKS1 silencing (shNUCKS1) (Fig. 5a), whereas the proteasome inhibitor MG132 had no effect (Fig. 5b). These findings suggest that NUCKS1 regulates HDAC2 in a lysosome-dependent manner. Previous studies indicated that shNUCKS1 promotes autophagy [14], while NUCKS1 suppresses autophagy [10]. Therefore, the expression and distribution of HDAC2 to lysosomes were examined. LC3B and LAMP2, markers for autophagy and lysosomes [29, 30], respectively, were analyzed. Knockdown of NUCKS1 significantly reduced the mean fluorescence intensity (MFI) of HDAC2, while increasing LC3B and LAMP2 distribution (Fig. 5c, d and g). Conversely, NUCKS1 overexpression increased HDAC2 MFI and decreased LC3B and LAMP2 distribution (Fig. 5e, f and h and Supplementary Fig. S3c, f). These findings consistently demonstrate that NUCKS1 mediates lysosomal degradation of HDAC2.

NUCKS1 promotes CRC metastasis in vivo

To verify the role of NUCKS1 in CRC metastasis in vivo, SW480 cells overexpressing NUCKS1 and control cells were injected into nude mice via the tail vein. Four weeks later, NUCKS1 overexpression significantly promoted liver and lung metastasis compared to controls, whereas HDAC2 knockdown significantly inhibited metastasis induced by NUCKS1 overexpression. Additionally, one week after injecting SW480 cells overexpressing NUCKS1, intraperitoneal administration of the HDAC2 inhibitor Santacruzamate A resulted in reduced liver and lung metastasis compared to the NUCKS1 overexpression group. This reduction is evident in the liver and lung images from four groups of nude mice (Fig. 6a) and the number of liver and lung metastatic lesions (Fig. 6b). Furthermore, HE staining of liver and lung metastases revealed more and larger metastatic nests in mice injected with NUCKS1-overexpressing SW480 cells compared to controls. However, the combination of NUCKS1 overexpression and HDAC2 knockdown or Santacruzamate A treatment significantly reduced the number and size of metastatic nests (Fig. 6c). These data suggest that NUCKS1 significantly promotes CRC liver and lung metastasis in vivo, while HDAC2 knockdown or Santacruzamate A administration can reverse this effect.

NUCKS1 enhances CRC cell invasion and metastasis by interacting with HDAC2. Overexpression of NUCKS1 elevates HDAC2 levels, whereas the HDAC2 inhibitor Santacruzamate A reduces HDAC2 expression, leading to decreased AKT phosphorylation and suppression of CRC invasion and metastasis. Conversely, low NUCKS1 expression induces lysosomal degradation of HDAC2, thereby inhibiting AKT activation and CRC metastasis. These findings suggest that Santacruzamate A could be an effective therapeutic agent for patients with CRC exhibiting elevated NUCKS1 expression (Fig. 6d)

CRC is a leading cause of cancer-related deaths globally. Despite rising survival rates, metastatic CRC remains deadly, with a 5-year survival rate of approximately 14% [31]. Liver metastasis occurs in over 50% of patients with CRC, making it extremely common [32]. Lung metastasis, particularly in middle and lower rectal cancer, follows, with an incidence rate of approximately 30% [33]. Exploring the molecular mechanisms of CRC metastasis is crucial for identifying new targets for early diagnosis and treatment.

NUCKS1 has been identified as a biomarker for several cancers [27]. Previous studies indicated that NUCKS1 significantly promotes CRC development [14], but its role in invasion and metastasis was unclear. HCMDB database analysis revealed significantly higher NUCKS1 expression in patients with metastatic CRC compared to non-metastatic ones, suggesting its involvement in CRC metastasis. Further experiments demonstrated that NUCKS1 overexpression enhances CRC cell invasion and metastasis, while its knockdown inhibits these processes. This is consistent with findings in other tumors, such as non-small cell lung cancer [34] and osteosarcoma [12]. Mechanistically, NUCKS1 regulates CRC invasion and metastasis through the HDAC2/AKT pathway, as label-free quantitative proteomics identified 643 differentially regulated proteins, with HDAC2 being particularly noteworthy.

HDAC2 is pivotal in cell proliferation, signaling, and cancer progression, serving as a prognostic marker for various cancers [15]. Upregulation of HDAC2 is noted in metastatic CRC [35]. This study demonstrates that HDAC2 overexpression promotes CRC invasion and metastasis, while HDAC2 knockdown significantly inhibits these processes. Experiments confirmed the interaction between NUCKS1 and HDAC2, showing that HDAC2 degrades via the lysosomal pathway when NUCKS1 is knocked down and is overexpressed when NUCKS1 is highly expressed. Additionally, the HDAC2 inhibitor Santacruzamate A reduces HDAC2 expression in NUCKS1-overexpressing CRC cells. Literature indicates NUCKS1 promotes tumor invasion and migration through AKT activation [36, 37]. HDAC2 facilitates tumor metastasis via pathways like Wnt/β-catenin [38], PI3K/AKT/mTOR [39], and NF-κB [40]. This study reveals that NUCKS1 knockdown leads to decreased HDAC2 expression, inhibiting AKT phosphorylation and CRC metastasis. Moreover, HDAC2 overexpression induced by NUCKS1 is counteracted by Santacruzamate A, which reduces HDAC2 levels and inhibits AKT activity, thereby suppressing CRC metastasis.

Despite the development of 22 HDAC2 inhibitors, successful anti-cancer drugs have not emerged from clinical trials due to issues like lack of specificity, leading to adverse effects. The Zn²⁺ binding groups in these inhibitors can also bind with other metalloenzymes, causing cytotoxicity and limiting clinical application [41]. Solutions may include screening inhibitors for full-length HDAC2 structures or designing HDAC2-selective chemistries/peptides with anti-cancer activity without off-target effects [15]. Combining HDAC2 inhibitors with immune checkpoint inhibitors has shown promising therapeutic effects in mouse models [42, 43].

In summary, this study reveals a significant correlation between high expression levels of NUCKS1 and HDAC2 and the invasion and metastasis of CRC. NUCKS1 and HDAC2 have the potential to serve as biomarkers for early detection of CRC metastasis. Furthermore, HDAC inhibitors show promise as clinical treatments for metastatic CRC with elevated NUCKS1 expression.

Cell culture and lentivirus infection

CRC cell lines HCT116, SW480, and DLD1 were obtained from Procell Life Science & Technology Company (Wuhan, China) and verified through STR profiling analysis. HCT116 cells were cultured in McCoy’s 5A medium (HyClone, Utah, USA), SW480 cells in Leibovitz’s L15 medium (HyClone, Utah, USA), and DLD1 cells in RPMI-1640 medium (HyClone, Utah, USA), each supplemented with 10% fetal bovine serum (Gibco, South America, SA, USA). HEK 293T cells were maintained in complete DMEM (HyClone, Utah, USA).

For cell treatments, 20 µg/mL cycloheximide (CHX, Glpbio) was added for 8, 24, and 48 hours. Cells were incubated with 5 µM MG132 (Selleckchem) for 4 hours and treated with 20 µM chloroquine (CQ, MCE) for 8 hours. In vitro treatments with Santacruzamate A (Sellechem) were conducted at 50 µM for 6 hours.

Lentivirus packaging involved co-transfection of HEK 293T cells (6×10^6 cells/10 cm plate) with psPAX2 (9 µg), pMD2G (3 µg), and target gene plasmid (12 µg) using 76.8 µL HiGene (Applygen, Beijing, China) for 24 hours. Lentivirus supernatant was collected after 48 hours and used to infect cancer cells for 12 hours, followed by selection of positive cells with puromycin (Yeasen, Shanghai, China). The shRNA sequences are detailed in Table 1.

Table 1

The sequences of different shRNAs used in the study.
shRNA	Sequence
shNUCKS1#1	CCGGGTTGTTGATTACTCACAGTTTCTCGAGAAACTGTGAGTAATCAACAACTTTTTG
shNUCKS1#2	CCGGCACTCAGCAGAGGATAGTGAACTCGAGTTCACTATCCTCTGCTGAGTGTTTTTG
shHDAC2	CAGTCTCACCAATTTCAGAAA

The transwell migration and invasion assays

The experiment utilized 8 µm pore transwell chambers (BD Biosciences). For cell migration assays, cells were seeded into the chamber with 200 µL of serum-free medium, while culture medium containing 10% FBS was added to the lower chamber. For invasion assays, matrigel (BD Biosciences) diluted 1:20 with serum-free medium was added to the chamber, followed by incubation for 4 hours to allow solidification before adding cells. After 24 hours, cells were fixed with 95% ethanol for 15 minutes and stained with 1% crystal violet for 30 minutes. The chambers were rinsed with tap water, and the cells on the upper surface were removed using a cotton swab. Then, an inverted microscope was used for observation, and ImageJ was used to count the number of migrated or invaded cells in five randomly selected fields of view.

Wound healing assay

Cells were seeded in 6-well plates and allowed to adhere for 24 hours. A pipette tip was used to create a scratch in the cell monolayer. Cells were then incubated with cell tracker green CMFDA (Invitrogen) for 15 minutes in the incubator. After washing with PBS (HyClone, Utah, USA), the cells were observed and photographed under a fluorescence microscope. The medium was replaced with 1% FBS culture medium, and the cells were observed and photographed again after 24 hours.

Immunofluorescence staining and confocal microscopy

Cells were seeded in a confocal dish and fixed with 4% paraformaldehyde (Biosharp, Shanghai, China) for 15 minutes after washing with PBS. Permeabilization was performed with 0.5% Triton X-100 at room temperature for 20 minutes, followed by blocking for 30 minutes. Cells were then incubated with primary antibodies overnight at 4°C. After washing three times with PBS, secondary antibodies were added and incubated for 1 hour at room temperature in the dark. After a final wash with PBS, an anti-fade reagent was added, and cells were observed under a confocal microscope, selecting three fields of view for statistical analysis. Mean fluorescence intensity (MFI) was calculated using ImageJ software. Primary antibodies used included NUCKS1 (catalog# 12023-2-AP, Proteintech) at 1:400 dilution; HDAC2 (catalog# 67165-1-Ig, Proteintech) at 1:800 dilution; HDAC2 (catalog# ET1607-78, HUABIO) at 1:100 dilution; LC3B (catalog# 81004-1-RR, Proteintech) at 1:1000 dilution; LAMP2 (catalog# M1603-5, HUABIO) at 1:100 dilution. Secondary antibodies used: anti-rabbit IgG (H + L) Alexa FluorTM 594 (catalog# A-21207, Thermo Fisher) at 1:500 dilution; anti-rabbit IgG (H + L) Alexa FluorTM 488 (catalog# A-21206, Thermo Fisher) at 1:500 dilution; anti-mouse IgG (H + L) Alexa FluorTM 594 (catalog# A-21203, Thermo Fisher) at 1:500 dilution; and anti-mouse IgG (H + L) Alexa FluorTM 488 (catalog# A-21202, Thermo Fisher) at 1:500 dilution.

For FITC-phalloidin staining of F-actin, the TraKind™ F-actin staining kit (Abbkine, Wuhan, China) was used, and cells were observed under a confocal microscope.

Coimmunoprecipitation (Co-IP) and Western blotting

Cells were lysed using IP lysis buffer (Applygen, Beijing, China) supplemented with phosphatase and protease inhibitor cocktails (Roche, USA). After 30 minutes on ice, lysates were centrifuged at 4°C and 12,000 rpm for 20 minutes. A 100 µL aliquot of the supernatant was mixed with a loading buffer as input. The remaining supernatant was divided into two parts, with IgG and HDAC2 antibodies added to each. Following overnight incubation at 4°C, protein A/G magnetic beads (Bimake, Texas, USA) were added and incubated at 4°C for 4 hours. Magnetic beads were collected using a magnetic rack, washed five times with cold PBS, and mixed with loading buffer. Samples were boiled at 100°C for 10 minutes, and magnetic beads were removed to obtain protein samples. For HEK 293T cells overexpressing NUCKS1-flag, anti-flag magnetic beads (Bimake, Texas, USA) were directly added to the protein supernatant, followed by magnetic bead collection and sample preparation.

Western blotting analysis was conducted as previously described (14). ImageJ software was used to perform grayscale analysis on protein bands, and the experiment was repeated at least three times. Primary antibodies used: NUCKS1 (catalog# 12023-2-AP, Proteintech) at 1:500 dilution; HDAC2 (catalog# ET1607-78, HUABIO) at 1:1000 dilution; AKT (catalog# 4691, Cell Signaling Technology) at 1:1000 dilution; p-AKT (Ser-473) (catalog# 4060, Cell Signaling Technology) at 1:1000 dilution; GAPDH (catalog# 60004-1-Ig, Proteintech) at 1:10000 dilution. Secondary antibodies used: anti-rabbit-HRP (catalog# AS014, ABclonal) at 1:4000 dilution; anti-mouse-HRP (catalog# AS003, ABclonal) at 1:4000 dilution.

Quantitative real-time PCR (q-PCR)

Cells were collected and washed twice with PBS, followed by the removal of the supernatant. RNA was extracted from cell pellet using the M5 Universal RNA Mini Kit (Mei5Bio, Beijing, China). Complementary DNA (cDNA) was synthesized using the Evo M-MLV RT Mix Kit (Accurate Biotechnology, Changsha, China). Real-time PCR was performed with the SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biotechnology, Changsha, China). All experimental procedures were conducted according to the manufacturer's instructions. Primer sequences are listed in Table 2.

Table 2

The primers used in the study.
Primer	Forward/ reverse	Sequence (5’-3’)
HDAC2	Forward	ATGGCGTACAGTCAAGGAGG
HDAC2	Reverse	TGCGGATTCTATGAGGCTTCA
GAPDH	Forward	GGAGTCCACTGGCGTCTTCA
GAPDH	Reverse	GTCATGAGTCCTTCCACGATACC

Animal experiments

Female nude mice (6–8 weeks old, 18–22 g) were supplied by the Air Force Medical University Animal Center and randomly divided into four groups (n = 6 per group). Each mouse was injected with 1×10⁶ CRC cells via the tail vein. Four weeks later, the mice were euthanized, and lung and liver tissues were collected, embedded in paraffin, and sliced for hematoxylin–eosin (HE) staining using the Hematoxylin and Eosin Staining Kit (Beyotime, Shanghai, China). HDAC2 inhibitor Santacruzamate A (Sellechem) was administered by intraperitoneal injection at a dose of 25 mg/kg once daily for three weeks, with a one-day break each week. All experimental procedures were approved by the Institutional Animal Care and Use Committee of Tangdu Hospital (Number: 20230743).

Statistical analysis

Quantitative data are presented as mean ± SD and analyzed using GraphPad Prism 8.0 and SPSS Statistics 25.0. Statistical analyses utilized two-tailed Student's t-test or one-way ANOVA. Significance levels were defined as *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001.

Conflict of interest

The authors have no conflict of interest.

Authors’ Disclosures

This study was supported by Shaanxi Provincial Natural Science Basic Research Program to Yang Song (2023-JC-YB-782), and the Key Research and Development Projects of Shaanxi Province

to Haichuan Su (No.2022ZDLSF03-01) and Shaanxi Provincial Health Research Innovation Team Project (2024TD-04). No disclosures were reported by the other authors.

Authors’ Contributions

Study concept and design: Yang Song, Jun Chen and Haichuan Su. Performing the experiments and data analysis: Liaoliao Zhu, Ting Zhao, Xiangjing Shen. Animal experiment: Xiangjing Shen and Liang Zhang. Writing-review and editing: Liaoliao Zhu, Junqiang Li, Yang Song, and Jun Chen. All authors read and approved the final manuscript.

Acknowledgments

The authors thanks EditChecks (https://editchecks.com.cn/) for providing professional language polishing services.

Siegel RL, Wagle NS, Cercek A, Smith RA, Jemal A. Colorectal cancer statistics, 2023. CA Cancer J Clin. 2023;73:233–54.
Siegel RL, Miller KD, Wagle NS, Jemal A. Cancer statistics, 2023. CA Cancer J Clin. 2023;73:17–48.
Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, et al. Genetic alterations during colorectal-tumor development. N Engl J Med. 1988;319:525–32.
Amin MB, Greene FL, Edge SB, Compton CC, Gershenwald JE, Brookland RK, et al. The Eighth Edition AJCC Cancer Staging Manual: Continuing to build a bridge from a population-based to a more "personalized" approach to cancer staging. CA Cancer J Clin. 2017;67:93–9.
Huang P, Cai Y, Zhao B, Cui L. Roles of NUCKS1 in Diseases: Susceptibility, Potential Biomarker, and Regulatory Mechanisms. Biomed Res Int. 2018;2018:7969068.
Bianchi ME, Agresti A. HMG proteins: dynamic players in gene regulation and differentiation. Curr Opin Genet Dev. 2005;15:496–506.
Zhou Y, Zhang Q, Qiu X, Tian T, Xu Q, Liao B. Hsa_circ_0001550 facilitates colorectal cancer progression through mediating microRNA-4262/nuclear casein kinase and cyclin-dependent kinase substrate 1 cascade. J Clin Lab Anal. 2022;36:e24532.
Gu L, Xia B, Zhong L, Ma Y, Liu L, Yang L, et al. NUCKS1 overexpression is a novel biomarker for recurrence-free survival in cervical squamous cell carcinoma. Tumour Biol. 2014;35:7831–36.
Li L, Wei D, Zhang J, Deng R, Tang J, Su D. miR-641 Inhibited Cell Proliferation and Induced Apoptosis by Targeting NUCKS1/PI3K/AKT Signaling Pathway in Breast Cancer. Comput Math Methods Med. 2022;2022:5203839.
Zhao E, Feng L, Bai L, Cui H. NUCKS promotes cell proliferation and suppresses autophagy through the mTOR-Beclin1 pathway in gastric cancer. J Exp Clin Cancer Res. 2020;39:194.
Ma H, Xu J, Zhao R, Qi Y, Ji Y, Ma K. Upregulation of NUCKS1 in Lung Adenocarcinoma is Associated with a Poor Prognosis. Cancer Invest. 2021;39:435–44.
Zheng S, Ji R, He H, Li N, Han C, Han J, et al. NUCKS1, a LINC00629-upregulated gene, facilitated osteosarcoma progression and metastasis by elevating asparagine synthesis. Cell Death Dis. 2023;14:489.
Hume S, Grou CP, Lascaux P, D'Angiolella V, Legrand AJ, Ramadan K, et al. The NUCKS1-SKP2-p21/p27 axis controls S phase entry. Nat Commun. 2021;12:6959.
Zhu LL, Shi JJ, Guo YD, Yang C, Wang RL, Li SS, et al. NUCKS1 promotes the progression of colorectal cancer via activating PI3K/AKT/mTOR signaling pathway. Neoplasma. 2023;70:272–86.
Jo H, Shim K, Kim HU, Jung HS, Jeoung D. HDAC2 as a target for developing anti-cancer drugs. Comput Struct Biotechnol J. 2023;21:2048–57.
Zhang H, Zhao B, Huang C, Meng XM, Bian EB, Li J. Melittin restores PTEN expression by down-regulating HDAC2 in human hepatocelluar carcinoma HepG2 cells. PLoS One. 2014;9:e95520.
Jung KH, Noh JH, Kim JK, Eun JW, Bae HJ, Xie HJ, et al. HDAC2 overexpression confers oncogenic potential to human lung cancer cells by deregulating expression of apoptosis and cell cycle proteins. J Cell Biochem. 2012;113:2167–77.
Harms KL, Chen X. Histone deacetylase 2 modulates p53 transcriptional activities through regulation of p53-DNA binding activity. Cancer Res. 2007;67:3145–52.
Li L, Mei DT, Zeng Y. HDAC2 promotes the migration and invasion of non-small cell lung cancer cells via upregulation of fibronectin. Biomed Pharmacother. 2016;84:284–90.
Shen Y, Xu L, Ning Z, Liu L, Lin J, Chen H, et al. ARHGAP4 regulates the cell migration and invasion of pancreatic cancer by the HDAC2/beta-catenin signaling pathway. Carcinogenesis. 2019;40:1405–14.
Krauss L, Urban BC, Hastreiter S, Schneider C, Wenzel P, Hassan Z, et al. HDAC2 Facilitates Pancreatic Cancer Metastasis. Cancer Res. 2022;82:695–707.
Qi ZP, Yalikong A, Zhang JW, Cai SL, Li B, Di S, Lv ZT, et al. HDAC2 promotes the EMT of colorectal cancer cells and via the modular scaffold function of ENSG00000274093.1. J Cell Mol Med. 2021;25:1190–97.
Zhu P, Martin E, Mengwasser J, Schlag P, Janssen KP, Gottlicher M. Induction of HDAC2 expression upon loss of APC in colorectal tumorigenesis. Cancer Cell. 2004;5:455–63.
Khadempar S, Lotfi M, Haghiralsadat F, Saidijam M, Ghasemi N, Afshar S. Lansoprazole as a potent HDAC2 inhibitor for treatment of colorectal cancer: An in-silico analysis and experimental validation. Comput Biol Med. 2023;166:107518.
Zhang T, Wei D, Lu T, Ma D, Yu K, Fang Q, et al. CAY10683 and imatinib have synergistic effects in overcoming imatinib resistance via HDAC2 inhibition in chronic myeloid leukemia. RSC Adv. 2020;10:828–44.
Gromek SM, DeMayo JA, Maxwell AT, West AM, Pavlik CM, Zhao Z, et al. Synthesis and biological evaluation of santacruzamate A analogues for anti-proliferative and immunomodulatory activity. Bioorg Med Chem. 2016;24:5183–96.
Østvold AC, Grundt K, Wiese C. NUCKS1 is a highly modified, chromatin-associated protein involved in a diverse set of biological and pathophysiological processes. Biochem J. 2022;479:1205–20.
Kumar V, Kundu S, Singh A, Singh S. Understanding the Role of Histone Deacetylase and their Inhibitors in Neurodegenerative Disorders: Current Targets and Future Perspective. Curr Neuropharmacol. 2022;20:158–78.
Yu X, Wu J, Wu Q, Sun S. Quantitative analysis of autophagy-related protein LC3B by quantum-dot-based molecular imaging. Methods Cell Biol. 2021;165:177–85.
Hubert V, Peschel A, Langer B, Groger M, Rees A, Kain R. LAMP-2 is required for incorporating syntaxin-17 into autophagosomes and for their fusion with lysosomes. Biol Open. 2016;5:1516–29.
Shin AE, Giancotti FG, Rustgi AK. Metastatic colorectal cancer: mechanisms and emerging therapeutics. Trends Pharmacol Sci. 2023;44:222–36.
Hernandez-Alejandro R, Ruffolo LI, Sasaki K, Tomiyama K, Orloff MS, Pineda-Solis K, et al. Recipient and Donor Outcomes After Living-Donor Liver Transplant for Unresectable Colorectal Liver Metastases. JAMA Surg. 2022;157:524–30.
Mitry E, Guiu B, Cosconea S, Jooste V, Faivre J, Bouvier AM. Epidemiology, management and prognosis of colorectal cancer with lung metastases: a 30-year population-based study. Gut. 2010;59:1383–88.
Zhao S, Wang B, Ma Y, Kuang J, Liang J, Yuan Y. NUCKS1 Promotes Proliferation, Invasion and Migration of Non-Small Cell Lung Cancer by Upregulating CDK1 Expression. Cancer Manag Res. 2020;12:13311–23.
Stypula-Cyrus Y, Damania D, Kunte DP, Cruz MD, Subramanian H, Roy HK, et al. HDAC up-regulation in early colon field carcinogenesis is involved in cell tumorigenicity through regulation of chromatin structure. PLoS One. 2013;8:e64600.
Hu C, Zha Q, Hua P, Xiao L, Pan D. NUCKS Promotes the Proliferation, Migration and Invasion of Lung Cancer Cells Through Pi3k/Akt Signalling Pathway. Clin Invest Med. 2021;44:E55-E61.
Huang YK, Kang WM, Ma ZQ, Liu YQ, Zhou L, Yu JC. NUCKS1 promotes gastric cancer cell aggressiveness by upregulating IGF-1R and subsequently activating the PI3K/Akt/mTOR signaling pathway. Carcinogenesis. 2019;40:370–79.
Pei L, Zhao F, Zhang Y. USP43 impairs cisplatin sensitivity in epithelial ovarian cancer through HDAC2-dependent regulation of Wnt/beta-catenin signaling pathway. Apoptosis. 2024;29:210–28.
Tu T, Huang J, Lin M, Gao Z, Wu X, Zhang W, et al. CUDC–907 reverses pathological phenotype of keloid fibroblasts in vitro and in vivo via dual inhibition of PI3K/Akt/mTOR signaling and HDAC2. Int J Mol Med. 2019;44:1789–1800.
Dong J, Chen J, Li Q, Qiu S. Knockdown of FKBP3 suppresses nasopharyngeal carcinoma cell growth, invasion and migration, deactivated NF-kappaB/IL-6 signaling pathway through inhibiting histone deacetylase 2 expression. Chin J Physiol. 2023;66:85–92.
Sacks FM, Lichtenstein A, Van Horn L, Harris W, Kris-Etherton P, Winston M. Soy protein, isoflavones, and cardiovascular health: an American Heart Association Science Advisory for professionals from the Nutrition Committee. Circulation. 2006;113:1034–44.
Han R, Ling C, Wang Y, Lu L. Enhancing HCC Treatment: innovatively combining HDAC2 inhibitor with PD-1/PD-L1 inhibition. Cancer Cell Int. 2023;23:203.
Gao Y, Nihira NT, Bu X, Chu C, Zhang J, Kolodziejczyk A, et al. Acetylation-dependent regulation of PD-L1 nuclear translocation dictates the efficacy of anti-PD-1 immunotherapy. Nat Cell Biol. 2020;22:1064–75.

There is NO conflict of interest to disclose.

S1.tif
Figure S1
S2.tif
Figure S2
S3.tif
Figure S3

Download PDF

Editorial decision: revise
13 Sep, 2024
Review #2 received at journal
07 Sep, 2024
Reviewer #2 agreed at journal
06 Sep, 2024
Review #1 received at journal
20 Aug, 2024
Reviewer #1 agreed at journal
05 Aug, 2024
Reviewers invited by journal
05 Aug, 2024
Submission checks completed at journal
16 Jul, 2024
Editor assigned by journal
15 Jul, 2024
First submitted to journal
15 Jul, 2024

You are reading this latest preprint version

NUCKS1 promotes invasion and metastasis of colorectal cancer by stabilizing HDAC2 and activating AKT

Status:

Version 1

Abstract

Figures

Introduction

Results

NUCKS1 promotes the invasion and metastasis of CRC

NUCKS1 regulates the invasion and metastasis of CRC via the HDAC2/AKT signaling pathway

HDAC2 inhibitor Santacruzamate A reduces the invasion and metastasis caused by NUCKS1 overexpression

NUCKS1 interacts with and stabilizes HDAC2

Discussion

CONCLUSIONS

Materials and Methods

Cell culture and lentivirus infection

The transwell migration and invasion assays

Wound healing assay

Immunofluorescence staining and confocal microscopy

Coimmunoprecipitation (Co-IP) and Western blotting

Quantitative real-time PCR (q-PCR)

Animal experiments

Statistical analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1