Inhibition of type 3 iodothyronine deiodinase enhances differentiation of human induced pluripotent stem cells to β cells

doi:10.21203/rs.3.rs-4745956/v1

Download PDF

Article

Inhibition of type 3 iodothyronine deiodinase enhances differentiation of human induced pluripotent stem cells to β cells

https://doi.org/10.21203/rs.3.rs-4745956/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Intracellular triiodothyronine (T3) level is up-regulated by type 2 iodothyronine deiodinase (Dio2), which converts thyroxine (T4) to T3, or is down-regulated by type 3 iodothyronine deiodinase (Dio3), which converts T3 to diiodothyronine. β cells derived from human induced pluripotent stem cells (hiPSCs) were examined to investigate the potential roles of deiodinases during differentiation of human pancreatic β cells. hiPSCs were differentiated stepwise over 29 days. The T3 level in the differentiated cells was determined by the T3 supplied to the medium, and the Dio3 in the cells as the differentiation medium contained T3 but not T4. The Dio3 expression significantly changed during the differentiation. Iopanoic acid (IOP), an inhibitor of Dio3 activity, was used to investigate the involvement of Dio3 during differentiation. The proportion of β cells that expressed both C-peptide and NKX6 homeobox 1 that differentiated in the presence of IOP (+IOP) on day (D) 29 (D-29) was significantly higher than that expressed in the absence of IOP (−IOP). The insulin content of differentiated+IOP cells on D-29 was significantly higher than that differentiated−IOP cells. These results suggest that Dio3 inhibition by IOP from D-0 to D-29 enhances the differentiation of hiPSCs to β cells.

Biological sciences/Stem cells

Health sciences/Endocrinology

β cell

human induced pluripotent stem cell

iodothyronine deiodinase

Diabetes, which leads to increased blood glucose levels, is caused by insufficient action of insulin secreted from pancreatic β cells. Moreover, type 1 diabetes (T1D) is caused by complete loss of function of the pancreatic β cells. Most patients with T1D are given daily insulin injections to control their blood glucose levels and avoid lifetime complications. Islet transplantation is a treatment that achieves insulin independence in patients with T1D; however, it is not widely adopted owing to the limited availability of donors [1]. Human embryonic stem cells (hESCs) and human induced pluripotent stem cell (hiPSC)-derived β cells are potential sources of transplantable cells for treating patients with T1D [1].

3,5,3´-Triiodothyronine (T3) enhances the expression of transcription factor V-Maf avian musculoaponeurotic fibrosarcoma oncogene homolog A (MAFA), which is important for the functional maturation of β cells. MAFA also promotes postnatal rat β-cell development and glucose-stimulated insulin secretion (GSIS) [2–4]. However, hESC-derived progenitor cells transplanted in hypothyroid mice differentiated toward glucagon-producing α and ghrelin-producing ε cell lineages [5]. Furthermore, the maturation of human stem cell-derived pancreatic endoderm (PE) cells implanted in patients with T1D is correlated with thyroid hormone levels [6]. Thus, T3 is important for the differentiation of stem cells into matured β cells. In vitro differentiation protocols that generate β cells from hiPSCs use T3 after formation of PE to increase insulin and MAFA expression [1, 7, 8].

Thyroid hormone transmembrane transporters, intracellular deiodination of thyroid hormone, and thyroid hormone receptors are important for thyroid hormone signaling in cells [9–11]. Intracellular T3 level is up-regulated in the presence of type 2 iodothyronine deiodinase (Dio2), which catalyzes 5´-deiodination and converts thyroxine (T4) to T3. Meanwhile, intracellular T3 level is down-regulated by type 3 iodothyronine deiodinase (Dio3), which catalyzes 5-deiodination and converts T3 to 3,3´-diiodothyronine (T2) [9, 10]. Dio2 and Dio3 regulate intracellular T3 levels in a temporal- and spatial-specific manner and are important for controlling thyroid hormone action in cells [11].

Dio3 is highly expressed in embryonic and adult pancreatic islets, predominantly in β cells in both humans and mice [12]. Mice with targeted disruption of the Dio3 gene (Dio3KO) were found to exhibit glucose intolerance due to in vitro and in vivo impaired GSIS [12, 13]. Thus, for normal β-cell differentiation in mice, preventing untimely exposure to T3 is important. However, the critical period, which prevents exposure to T3, with respect to normal β-cell differentiation has not yet been identified.

Dio3 is expressed in hiPSCs and hiPSC-derived cardiomyocytes [14]. Moreover, Dio2 modifies the transcriptome and promotes a hepatocyte-like lineage in hiPSC-derived hepatic organoids [15]. These results suggest that alterations in intracellular T3 levels induced by deiodinases modify the differentiation of hiPSCs. This study aimed to investigate the potential role of deiodinases in the differentiation of hiPSC into β cells using iopanoic acid (IOP), an inhibitor of deiodinases [16–18].

Differentiation of hiPSCs into β cells

The hiPSCs were differentiated into β cells according to previously described protocol (Fig. 1a). To monitor the progression of the differentiating hiPSCs into β cells, the expression of the stage-specific cell markers were studied over time (Fig. 1a). SRY (sex determining region Y)-box 17 (SOX17) is a definitive endoderm cell marker, and the proportion of SOX17 positive cells (SOX17⁺) was 96.4%±3.3% on day (D) 4 (D-4) (stage 1). Hepatocyte nuclear factor 4α (HNF4α) is a primitive gut tube cell marker, and the proportion of HNF4α positive cells (HNF4α⁺) was 72.2%±13.5% on D-8 (stage 2). Pancreas/duodenum homeobox protein 1 (PDX1) is a posterior foregut cell marker, and the proportion of PDX1 positive cells (PDX1⁺) was 95.2%±6.2% on D-11 (stage 3). On D-16, the cells were dissociated and aggregated on a low-binding plate (Greiner, Frickenhausen, Germany) as described previously [19]. PDX1 and NK6 homeobox 1 (NKX6.1) are PE cell markers, and the proportion of both PDX1⁺and NKX6.1-positive cells (PDX1⁺/NKX6.1⁺) was 43.7%±8.0% on D-18 (stage 4). Chromogranin A (CHGA) and NKX6.1 are endocrine precursor cell markers, and the proportion of both CHGA- and NKX6.1-positive cells (CHGA⁺/NKX6.1⁺) was 14.0%±2.2% on D-22 (stage 5). Finally, C-peptide (CPR) and NKX6.1 are β-cell markers, and the proportion of both CPR-positive cells and NKX6.1⁺(CPR⁺/NKX6.1⁺) was 9.6%±1.9% on D-29 (Stage 6) (Fig. 1b and c).

mRNA levels of deiodinases, thyroid hormone receptors, and monocarboxylate transporter 8

The expressions of Dio2 and Dio3, thyroid hormone receptors (TRα and TRβ), and thyroid hormone transporter (monocarboxylate transporter 8 [MCT8]) mRNA at each stage of differentiation was compared with the values obtained on D-0. A peak for Dio3 at D-4 (stage 1) was identified. Dio3 mRNA levels increased by approximately 530-fold on D-4 and subsequently decreased (Fig. 2). It then increased by approximately 200-fold on D-22 (stage 5). Dio2 mRNA levels increased to an approximately 40-fold expression peak on D-8 (stage 2) and subsequently decreased (Fig. 2). However, TRα mRNA gradually increased to an approximately 8-fold expression peak on D-22 (stage 5) (Fig. 2). TRβ mRNA gradually increased to reach an approximately 40-fold expression peak on D-29 (stage 6). However, the MCT8 mRNA levels did not change significantly from D-0 to D-29.

Effects of IOP on the proportion of marker-positive cells at each stage

The IOP concentration used (20 μM) was optimized in prior experiments to inhibit cellular deiodination by whole-cell in situ deiodination assay [17]. First, the proportions of SOX17⁺ on D-4 (stage 1), HNF4α⁺on D-8 (stage 2), and PDX1⁺ on D-11 (stage 3) that differentiated in the presence of IOP (+IOP) (Tokyo Chemical Industry, Tokyo, Japan) were not significantly different compared with those that differentiated in the absence of IOP (−IOP) (Fig. 3). Next, the proportions of PDX1⁺, NKX6.1⁺, and PDX1⁺/NKX6.1⁺ on D-18 (stage 4) in differentiated+IOP cells were not significantly different from those in differentiated−IOP cells (Fig. 3). Meanwhile, the proportions of CHGA⁺ and CHGA⁺/NKX6.1⁺ on D-22 (stage 5) in differentiated+IOP cells were significantly higher than those in differentiated−IOP cells (Fig. 3). Finally, the proportions of NKX6.1⁺ and CPR⁺/NKX6.1⁺ on D-29 (stage 6) in differentiated+IOP cells were significantly higher than those in differentiated−IOP cells (Fig. 3).

Effects of IOP on the expression of markers at each stage

The effects of IOP on the expression of marker transcription factors and proteins at each stage were investigated. The expressions of SOX17 on D-4 and D-8, HNF4α from D-4 to D-11, PDX1 from D-8 to D-29, NKX6.1 from D-11 to D-29, insulin from D-18 to D-29, and MAFA from D-18 to D-29 in differentiated+IOP cells were not significantly different when compared with those in differentiated−IOP cells (Fig. 4).

Effects of IOP on the insulin contents and GSIS

The insulin contents in differentiated+IOP cells (9.36±2.3 μIU/10³ cells) were significantly higher than in differentiated−IOP cells (5.44±0.6 μIU/10³ cells) (Fig. 5a). The GSIS in differentiated+IOP cells on D-29 (stage 6) was compared with that in differentiated−IOP cells (Fig. 5b-d). The ratio of the insulin secreted in response to the second high (20 mM) glucose concentrations (High2) versus second low (2.8 mM) glucose concentrations (Low2) in differentiated+IOP cells (1.06±0.28) was not significantly different from that in differentiated−IOP cells (0.97±0.27) (Fig. 5d).

Effect of IOP on Dio3 activity in the cells

The Dio3 activity in differentiated−IOP cells on D-4 was compared with that on D-0, as the Dio3 mRNA level on D-4 was the highest in the present study. The Dio3 activity in differentiated−IOP cells on D-4 was significantly higher than that on D-0 (357.50±51.67 vs 2.56±3.30 fmol T2 produced/mg protein/min) (Fig. 6a). Meanwhile, the Dio3 activity in differentiated+IOP cells on D-4 (246.95±80.21) was significantly lower than that in differentiated−IOP cells (Fig. 6b).

Effect of IOP on T3 levels in the cells and medium

The T3 levels in differentiated+IOP and differentiated−IOP cells on D-4, D-8, D-11, D-18, D-22, and D-29 were below measurement sensitivity (<1 nM). Meanwhile, the T3 levels in the medium of differentiated+IOP cells (85.61±3.27 nM/10³ cells) were significantly higher than those in the medium of differentiated−IOP cells (62.42±3.26 nM/10³ cells) on D-29 (Fig. 7).

The changes in the expression of Dio2, Dio3, TRα, TRβ, and MCT8, which are important in thyroid hormone signaling in cells, were investigated during the differentiation of hiPSCs into β cells. Interestingly, the expression of Dio3, which decreases the intracellular T3 level, remarkably increased during differentiation, especially on D-4 (stage 1). Moreover, the Dio3 activity of the cells also increased significantly on D-4. Meanwhile, the expression of Dio2, which increases intracellular T3 level, increased on D-8 (stage 2). In the present study, the differentiation medium from D-0 to D-29 contained T3 but not T4, because B-27, which contains T3 but not T4 [20], was supplemented. The Dio2 pathway was active only when T4 was available in the medium. Therefore, Dio2 did not affect the intracellular T3 levels in the present study, despite the increase in Dio2 expression on D-8 (stage 2). These results suggested that the intracellular T3 level in the differentiated cells was determined by the T3 supplied to the medium and the Dio3 activity in the cells. Furthermore, the expression of TRα and TRβ also significantly increased during differentiation. However, the increase in the expression of TRα and TRβ was lower than that of Dio3. Additionally, the expression of MCT8 did not change significantly during differentiation. These results suggest that thyroid hormone signaling in the cells during differentiation was mainly dependent on intracellular T3 levels, as determined by the T3 content supplied in the medium and Dio3 activity in the cells.

In the present study, to investigate the effects of Dio3 on the differentiation of hiPSCs into β cells, hiPSCs were differentiated in the presence of IOP, an inhibitor of Dio3 activity. As expected, the Dio3 activity in differentiated+IOP cells on D-4 was significantly lower than that in differentiated−IOP cells. Furthermore, the T3 levels in the medium of differentiated+IOP cells on D-29 were significantly higher than those in the medium of differentiated−IOP cells, but the T3 levels in differentiated+IOP and differentiated−IOP cells could not be measured. These results suggest that intracellular T3 levels in differentiated+IOP cells should be higher than those in differentiated−IOP cells owing to the inhibition of conversion from T3 into T2 by Dio3.

Notably, the proportion of the cells that expressed CPR⁺/NKX6.1⁺ on D-29 in differentiated+IOP cells was significantly higher than that in differentiated−IOP cells. As the proportion of the cells that expressed CPR⁺ was not increased but that of NKX6.1⁺ was increased, we suggest that the increase in intracellular T3 level due to inhibition of Dio3 activity increases the proportion of cells that expressed NKX6.1⁺. NKX6.1 is a transcription factor and crucial regulator of pancreatic β-cell development and proliferation [21]. However, little is known about the pathways controlling the expression of NKX6.1 during β-cell development, particularly in humans. Further investigations are necessary to clarify the mechanisms that induce NKX6.1⁺ expression by increment of intracellular T3 level.

Furthermore, the insulin contents of differentiated+IOP cells on D-29 were higher than those in differentiated−IOP cells. As the population of CPR⁺ in differentiated+IOP cells was not significantly higher than that in differentiated−IOP cells, it is suggested that the insulin contents in differentiated+IOP and CPR⁺ cells on D-29 were higher than that in differentiated−IOP and CPR⁺ cells. The insulin mRNA levels of differentiated+IOP cells on D-29 were not higher than those in differentiated−IOP cells. Therefore, it is suggested that the insulin contents in differentiated+IOP and CPR⁺ cells on D-29 were increased at the translational and/or posttranslational level owing to the increase in intracellular T3 level by inhibition of Dio3. The mechanisms that control preproinsulin mRNA translation and posttranslational modification of insulin remain largely unknown [22]. Further investigations are necessary to clarify the mechanisms that induces the translation of preproinsulin mRNA and decreases the degradation of insulin by T3.

GSIS is a function of maturated β cells. In the present study, GSIS of differentiated+IOP cells was not significantly different from that of differentiated−IOP cells on D-29. Therefore, it is suggested that the maturity of differentiated+IOP cells was not significantly different from that of differentiated−IOP cells on D-29. MAFA is an important transcription factor for β-cell maturation, and its expression is regulated by T3 [23]. T3 enhances GSIS by inducing MAFA [3,4]. In the present study, the mRNA levels of MAFA in differentiated+IOP cells were not significantly different from those in differentiated−IOP cells, but we did not analyze the protein levels of MAFA. The absence of an increase in MAFA expression in differentiated+IOP cells may explain the absence of an increase in GSIS in differentiated+IOP cells in the present study.

In summary, we found that the population of β cells (CPR⁺/NKX6.1⁺) in differentiated+IOP cells on D-29 was higher than that in differentiated−IOP cells. These results suggest that the increase in intracellular T3 levels due to the inhibition of Dio3 activity by IOP in differentiated cells enhances their differentiation into β cells. We suggest that inhibition of Dio3 activity by IOP during the differentiation is effective for the differentiation from hiPSCs into β cells.

Cell culture and differentiation

Experiments with hiPSCs were approved by the Ethics Committee of Kansai Medical University (approval number: 2021014). The hiPSC line 1231A3 (RRID:CVCLA_LJ39) was purchased from RIKEN BioResource Research Center (Ibaraki, Japan) and maintained in StemFit AK02N (Reprocell, Kanagawa, Japan) [24]. The hiPSCs were differentiated into insulin-producing cells as previously described [19, 25-27]. The composition of the medium was as follows:

Stage 1 (4 days): RPMI (Nacalai Tesque, Kyoto, Japan) supplemented with 1×B27 (Thermo Fisher Scientific, Waltham, MA, USA), 100 U/mL penicillin/streptomycin (P/S) (Fujifilm Wako Chemicals, Osaka, Japan), 100 ng/mL Activin A (R&D Systems, Minneapolis, MN, USA), and 3 μM CHIR99021 (Axon Medchem, Reston, VA, USA) for D-1, 1 μM for D-2 and D-3, and 0 μM for D-4.

Stage 2 (4 days): Improved MEM (IMEM; Thermo Fisher Scientific) supplemented with 0.5×B27, 100 U/mL P/S, 50 ng/mL keratinocyte growth factor (KGF) (R&D Systems).

Stage 3 (3 days): IMEM supplemented with 0.5×B27, 100 U/mL P/S, 50 ng/mL KGF, 10 nM 4-[(E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl] benzoic acid (Santa Cruz Biotechnology, Dallas, TX, USA), 0.5 μM 3-keto-N-(aminoethyl-aminocaproyl-dihydrocinnamoyl) cyclopamine (Toronto Research Chemicals, Tronto, ON, Canada), and 0.2 μM LDN193189 (Fujifilm Wako Chemicals).

Stage 4 (7 days): IMEM supplemented with 0.5×B27, 100 U/mL P/S, 100 ng/mL KGF, 50 ng/mL epidermal growth factor (R&D Systems) and 10 mM nicotinamide (STEMCELL Technologies, Vancouver, BC, Canada).

Stage 5 (4 days): IMEM supplemented with 0.5×B27, 100 U/mL P/S, 1 μM RO4929097 (Selleck Chemicals, Houston, TX, USA), 10 μM Alk5 inhibitor II (Fujifilm Wako Chemicals), 1 μM T3 (Sigma-Aldrich, St Louis, MO, USA), and 0.1 μM LDN193189.

Stage 6 (7 days): stage 5 medium without RO4929097.

The T3 concentration in the differentiation medium was 2.6 nM during stage 1, 1.3 nM during stages 2, 3, and 4, and 1.0 μM during stages 5 and 6.

Flow cytometry analysis

Differentiated cells were dissociated into single cells using 0.25% trypsin-ethylenediaminetetraacetic acid (EDTA). Dissociated cells were fixed using a Cytofix/Cytoperm Kit (BD Biosciences, Franklin Lakes, NJ, USA) according to the manufacturer’s protocol. The cells were blocked with 2% donkey serum in permeabilization solution. Primary antibodies were diluted with blocking solution and incubated at 4°C for 16 h. The primary antibodies used for the flow cytometry analysis included goat anti-SOX17 (R&D Systems; AF 1924, 1:200; RRID:AB_355060), mouse anti-HNF4α (Santa Cruz Biotechnology; sc-374229, 1:500; RRID:AB_10989766), goat anti-PDX1 (R&D Systems; AF 2419, 1:200; RRID:AB_355257), mouse anti-NKX6.1 (DSHB, Iowa City, IA, USA; F55A12, 1:100; RRID:AB_532379), rabbit anti-CHGA (Abcam, Cambridge, UK; ab68271, 1:500; RRID:AB_11154750), and rat anti-CPR (DSHB; GN-ID4, 1:200; RRID:AB_2255626). The cells were washed and incubated with fluorescent secondary antibodies at room temperature for 30−60 min. The stained cells were then analyzed using a FACS Aria III flow cytometer (BD Biosciences).

Quantitative real-time polymerase chain reaction

Total RNA was isolated from cells using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions and reverse-transcribed using the ReverTra Ace qPCR Master Mix (Toyobo, Osaka, Japan) and oligo dT primers. SYBR Premix Ex Taq II (Takara, Shiga, Japan) was used for quantitative PCR using Rotor-Gene 2 (Qiagen). The expression levels of each target gene were normalized to glyceraldehyde-3-phosphate dehydrogenase expression from the same template and then compared with the expression level of the D-0 sample from the same biological replicates [14]. The primer sequences are listed in Table 1.

Measurement of Dio3 activity

Cells were sonicated in 0.1 M potassium phosphate, pH 6.9, and 1 mM EDTA. Dio3 activity was performed as previously described using 1−100 μg cellular protein, 20 mM dithiothreitol (Nacalai Tesque, Kyoto, Japan), and varied concentrations of T3 in the presence or absence of 20 μM IOP. After incubation at 37°C for 2 h, the reaction was stopped by adding equal volumes of cold methanol. The mixture was then centrifuged at 12,000 rpm and 4°C for 10 min. The supernatant was decanted into a fresh tube and was stored at −25°C until further use. The deiodination products were quantified by liquid chromatography−tandem mass spectrometry (LC−MS/MS). The protein concentration was measured according to the Bradford method using bovine serum albumin as a standard. Deiodination activity was calculated as femtomoles of T2 produced/mg protein/min from T3[14].

Measurement of thyroid hormone levels by LC−MS/MS

A stock solution (1 mg/mL) of each thyroid hormone standard was prepared using 40% ammonium hydroxide (v/v) in methanol. The calibration standards ranging from 0.1 to 100 ng/mL were freshly prepared from the stock solution for each batch of samples that was injected into the LC−MS/MS instrument.

An API 3200 tandem mass spectrometer system (AB Sciex, Framingham, MA, USA) equipped with a Shimadzu HPLC system and a ZORBAX Extend-C18 chromatographic column (Agilent, Santa Barbara, CA, USA) was used to measure the thyroid hormones. Negative ion multiple reaction monitoring was used. Nitrogen was used as both the curtain and the collision gas. MS/MS parameters were optimized for every thyroid hormone standard by infusion of 1 µg/mL standard solution as described previously [14]. The mobile phase used was 0.01% (v/v) ammonium hydroxide in methanol and deionized water. For analysis, the gradient method was followed, and the parameters of which have been described previously [14]. The sensitivity of the LC−MS/MS for T3 and 3,3´-T2 concentrations were 1 nM in the present study.

Measurement of insulin contents in the cells

Cell clusters on D-29 were washed twice with phosphate-buffered saline and resuspended in radio-immunoprecipitation assay buffer (Fujifilm Wako Chemicals) to prepare the cell lysates. The insulin content of the cell lysates was determined using a human ultrasensitive insulin enzyme-linked immunoassay (ELISA) kit (ALPCO Diagnostics, Salem, NH, USA) according to the manufacturer’s instructions.

Glucose-stimulated insulin secretion

Cell clusters on D-29 were washed twice with low-glucose (2.8 mM) Krebs buffer (KRB); after which, they were incubated in low-glucose KRB for 1 h at 37°C to remove residual insulin. The clusters were washed twice with low-glucose KRB and then incubated in low-glucose KRB for 1 h. The supernatants were collected after incubation and called Low1. The clusters were washed twice with low-glucose KRB and then incubated in high-glucose (20 mM) KRB for 1 h; the supernatant was collected and called High1. This sequence was repeated, and the samples were named Low2 and High2, and the clusters were washed once between the high-glucose and second low-glucose incubations to remove residual glucose. Finally, the clusters were incubated in KRB containing 2.8 mM glucose and 30 mM KCl (depolarization challenge) for 1 h, and the supernatant was collected and called KCl. Clusters were then dispersed into single cells using 0.25% trypsin−EDTA, and the cell number was counted to normalize the insulin levels by the cell number. Supernatants containing secreted insulin were measured using a human ultrasensitive insulin ELISA kit (ALPCO Diagnostics) according to the manufacturer’s instructions.

Statistical analyses

All quantitative data are presented as mean±standard deviation. Data were analyzed for statistical significance using Prism 9 (GraphPad Software, San Diego, CA, USA). Student’s t-test or Dunn’s test was used to compare the means of two groups, and one-way analysis of variance with Dunnett’s test was used for multiple comparisons between groups. Significance was accepted at P<0.05, and the different significance levels were *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001.

Acknowledgements

This work was supported by the Smoking Research Foundation of Japan (grant no.2019G023).

Author contributions

A.M. performed all experiments and data analysis, wrote and prepared the manuscript figures and table, and discussed the results; A.K., F.H., and H.H. taught the experimental techniques and discussed the results; K.O. and I.S. discussed the results; N.T. planned and directed all studies and discussed the results. All authors approved the final version of the manuscript.

Additional information

Competing interests

Kenji Osafune is a founder and member of the scientific advisory boards of iPS Portal, Inc., and a founder and chief scientific advisor of RegeNephro Co., Ltd. The rest of the authors declare no competing interest.

Data availability

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Ramzy, A. et al. A century-long journey from the discovery of insulin to the implantation of stem cell-derived islets. Endocr Rev. 44, 222-253 (2023).
Aguayo-Mazzucato, C. et al. Mafa expression enhances glucose-responsive insulin secretion in neonatal rat beta cells. Diabetologia. 54, 583-593 (2011).
Aguayo-Mazzucato, C. et al. Thyroid hormone promotes postnatal rat pancreatic β-cell development and glucose-responsive insulin secretion through MAFA. Diabetes. 62, 1569-1580 (2013).
Aguayo-Mazzucato, C. et al. MAFA and T3 drive maturation of both fetal human islets and insulin-producing cells differentiated from hESC. J Clin Endocrinol Metab. 100, 3651-3659 (2015).
Bruin, J.E. et al. Hypothyroidism impairs human stem cell-derived pancreatic progenitor cell maturation in mice. Diabetes.65, 1297-1309 (2016).
Ramzy, A. et al. Thyroid hormone levels correlate with the maturation of implanted pancreatic endoderm cells in patients with type 1 diabetes. J Clin Endocrinol Metab. 109, 413-423 (2024).
Pagliuca, F.W. et al. Generation of functional human pancreatic beta cells in vitro. Cell. 159, 428-439 (2014).
Rezania, A. et al. Reversal of diabetes with insulin-producing cells derived in vitro from human pluripotent stem cells. Nat Biotechnol. 32, 1121-1133 (2014).
Gereben, B. et al. Cellular and molecular basis of deiodinase-regulated thyroid hormone signaling. Endocr Rev.29, 898-938 (2008).
Bianco, A.C. et al. Paradigmas of dynamic control of thyroid hormone signaling. Endocr Rev. 40, 1000-1047 (2019).
Brent, G.A. Mechanisms of thyroid hormone action. J Clin Invest. 122, 3035-3043 (2012).
Medina, M.C. et al. The thyroid hormone-inactivating type III deiodinase is expressed in mouse and human β-cells and its targeted inactivation impairs insulin secretion. Endocrinology. 152, 3717-3727 (2011).
Medina, M.C. et al. Maternal inheritance of an inactive type III deiodinase gene allele affects mouse pancreatic β-cells and disrupts glucose homeostasis. Endocrinology. 155, 3160-3171 (2014).
Nishimura, K., Takeda, M., Yamahita, J.K., Shiojima, I., Toyoda, N. Type 3 iodothyronine deiodinase is expressed in human pluripotent stem cell derived cardiomyocytes. Life Science. 203, 276-281 (2018).
Hidalgo-Alvarez, J., salas-Lucia, F., Cruz, D.V., Fonseca T.L., Bianco. A.C. Localized T3 production modifies the transcriptome and promotes the hepatocyte-like lineage in iPSC-derived hapatic organoides. JCI Insight. 8, e173780 (2023).
Silva, J.E., Larsen, P.R. Regulation of thyroid hormone expression at the prereceptor and receptor levels. In: Henneman G, eds, Thyroid hormone metabolism. (Marcel Dekker, 1986).
Huang, S.A. et al. Transforming growth factor-β promotes inactivation of extracellular thyroid hormone via transcriptional stimulation of type 3 iodothyronine deiodinase. Mol Endocrinol. 19, 3126-3136 (2005).
Simonides, W.S. et al. Hypoxia-inducible factor induces local thyroid hormone inactivation during hypoxic-ischemic disease in rats. J Clin Invest. 118, 975-983 (2008).
Toyoda, T. et al. Cell aggregation optimizes the differentiation of human ESCs and iPSCs into pancreatic bud-like progenitor cells. Stem Cell Res. 14, 185-197 (2015).
Chen, Y. et al. NS21:re-defined and modified supplenment B27 for neuronal cultures. J Neurosci Methods. 171, 239-247 (2008).
Aigha, I.I. and Abdelalim E.M. Nkx6.1 transcription factor: a crucial regulator of pancreatic β cell development, identity, and proliferation. Stem Cell Res Ther. 11:459 (2020).
Vasiljevic, J., Torkko, J.M., Knoch, K-P., Solimena M. The making of insulin in health and disease. Diabetologia.63, 1981-1989 (2020).
Liang. J., Chirikjian, M., Pajvani, U.P., Bartolome, A. MafA regulation in β-cells: From transcription to post-transcriptional mechanisms. Biomolecules. 12, 535 (2022).
Nakagawa, M. et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
Kimura, A. et al. Small molecule AT7867 proliferates PDX1-expressing pancreatic progenitor cells derived from human pluripotent stem cells. Stem Cell Res. 24, 61-68 (2017).
Toyoda, T., Kimura, A., Tanaka, H., Osafune K. Efficient generation of pancreas/duodenum homeobox protein 1^＋posterior goregut/pancreatic progenitors from hPSCs in adhesion cultures. Journal of Visualized Experiments145, e57641 (2019).
Kimura, A., Toyoda, T., Iwasaki, M., Hirama, R., Osafune, K. Combind omics approaches reveal the roles of non-canonical WNT7B signaling and YY1 in the proliferation of human pancreatic progenitor cells. Cell Chemical Biology. 27, 1561-1572 (2020).
Kondo, Y. et al. Identification of a small molecule that facilitates the differentiation of human iPSCs/ESCs and mouse embryonic pancreatic explants into pancreatic endocrine cells. Diabetologia. 60, 1454-1466 (2017).
Wajner, S.M., Goemann, I.M., Bueno, A.L., Larsen, P.R., Maia, A.L. IL-6 promotes nonthyroidal illness syndrome by blocking thyroxine activation while promoting thyroid hormone inactivation in human cells. J Clin Invest. 121, 1834-1845 (2011).
Ortega, F.J. et al. Subcutaneous fat shows higher thyroid hormone receptor-α1 gene expression than omental fat. Obesity. 17, 2134-2141 (2009).
Tagami, T. et al. Aberrant Expression of thyroid hormone receptor β isoform may cause inappropriate secretion of TSH in a TSH-secreting pituitary adenoma. J Clin Endocrinol Metab.96, E948-952 (2011).
Jansen, J., Friesema, E.C.H., Kester, M.H.A., Schwartz, C.E., Visser, T.J. Genotype-phenotype relationship in patients with mutations in thyroid hormone transporter MCT8. Endocrinology. 149, 2184-2190 (2008).

Table 1. Gene specific primers
Gene	Forward (5’-3’)	Reverse (5’-3’)	Reference
SOX17	CGCACGGAATTTGAACAGTA	TTAGCTCCTCCAGGAAGTGTG	(26)
HNF4α	GAGCTGCAGATCGATGACAA	TACTGGCGGTCGTTGATGTA	(26)
PDX1	AGCAGTGCAAGAGTCCCTGT	CACAGCCTCTACCTCGGAAC	(26)
NKX6.1	ATTCGTTGGGGATGACAGAG	TGGGATCCAGAGGCTTATTG	(26)
INSULIN	CTACCTAGTGTGCGGGGAAC	GCTGGTAGAGGGAGCAGATG	(26)
MAFA	TTCAGCAAGGAGGAGGTCAT	CGCCAGCTTCTCGTATTTCT	(28)
DIO2	ACTTCCTGCTGGTCTACATTGATG	CTTCCTGGTTCTGGTGCTTCTTC	(29)
DIO3	TCCAGAGCCAGCACATCCT	ACGTCGCGCTGGTACTTAGTG	(29)
TRα	GTTCCCAGGACCCCATCCT	GGGTGAGTTGAGGGCATCTTC	(30)
TRβ	GGAAATTCCTGCCAGAAGAC	CACATGGCAGCTCACAAAAC	(31)
MCT8	CCATAACTCTGTCGGGATCCTC	ACTCACAATGGGAGAACAGAAGAAG	(32)
GAPDH	GAAGGTGAAGGTCGGAGTC	GAAGATGGTGATGGGATTTC	(26)

Competing interest reported. Kenji Osafune is a founder and member of the scientific advisory boards of iPS Portal, Inc., and a founder and chief scientific advisor of RegeNephro Co., Ltd. The rest of the authors declare no competing interest.

Download PDF

Version 1

posted

You are reading this latest preprint version

Inhibition of type 3 iodothyronine deiodinase enhances differentiation of human induced pluripotent stem cells to β cells

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Methods

Declarations

References

Table

Additional Declarations

Status:

Version 1