Circular RNA circDDX17 suppression to gastric cancer progression via the sponging miR-1208/miR-1279/FKBP5 axis encodes a novel circDDX17-63aa protein

doi:10.21203/rs.3.rs-4746391/v1

Download PDF

Article

Circular RNA circDDX17 suppression to gastric cancer progression via the sponging miR-1208/miR-1279/FKBP5 axis encodes a novel circDDX17-63aa protein

https://doi.org/10.21203/rs.3.rs-4746391/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Mounting evidence indicates that circular RNAs (circRNAs) are dysregulated in human gastric cancer (GC). The downregulation of circDDX17 is linked to GC progression. However, the role and specific mechanism of circDDX17-mediated GC progression remains elusive. Herein, we report that the downregulation of circDDX17 was correlating with tumor growth and lymph node metastasis in patients with GC. CircDDX17 inhibited GC cell proliferation, migration, and epithelial-mesenchymal transition (EMT) while promoting apoptosis both in vitro and in vivo. Acting as a sponge for miR-1208 and miR-1279, circDDX17 regulated FKBP5 expression in GC cells. FKBP5, in turn, interacted with ERK1/2, influencing GC development through the ERK1/2 pathway. What is more, circDDX17 encoded circDDX17-63aa, which inhibited GC cell proliferation, migration, and EMT. In sum, CircDDX17 exhibits low-expressed in GC via the miR-1208/miR-1279/FKBP5 axis and circDDX17-63aa.

Health sciences/Diseases/Cancer

Biological sciences/Cell biology/Cell death

Gastric cancer

circRNA

ceRNA

FKBP Prolyl Isomerase 5

Gastric cancer (GC) stands as one of the most prevalent malignancies globally, with 1.1 million cases reported in 2022, disproportionately affecting men (66%) over women (34%)¹. GC manifests a highly aggressive malignancy, with a median survival rate of less than 12 months in advanced stage². In 2020 alone, 770,000 deaths were attributed to stomach cancer worldwide, with males constituting 65% of fatalities ³. Noncoding RNAs (ncRNAs) represent over 98% of the human genome ^4,5, encompassing diverse RNA species such as microRNAs (miRNAs), long ncRNAs (lncRNAs), and circular RNAs (circRNAs). CircRNAs are extensively expressed in various organs and cells. They are single-stranded, covalently closed ncRNAs lacking 5' end caps or 3' end poly (A) tails ^6,7. Single-stranded noncoding RNAs called miRNAs, approximately 22 nt long, inhibit gene expression by interacting with the 3′-untranslated region (3′UTR)⁸. CircRNAs, miRNA’s upstream molecules, bind to different miRNAs to block activity through miRNA sponging via miRNA response elements (MER). Furthermore, circRNAs can competitively bind miRNAs and operate as intracellular competitive endogenous RNA (ceRNA), which prevents miRNAs from inhibiting their target genes and regulating miRNA activity and associated gene expression⁹. Owing to a lack of clear open reading frames (ORFs) in organisms, circRNAs are not translated into proteins. However, recent studies have challenged the notion that circRNAs cannot encode proteins ^10–12.

CircRNAs emerge as critical regulators of cancer cell proliferation, apoptosis, migration, and invasion. Our investigation revealed reduced expression of circDDX17 in GC tissues and cells, which impeded GC progression through the encoding of circDDX17-63aa and regulation of circDDX17-miR-1208/miR-1279-FKBP5 axis.

Result 1: Characterization of circDDX17 existence, subcellular distribution, and expression in GC cells and tissues

Utilizing the GEO database (https://www.ncbi.nlm.nih.gov/gds/), we identified differentially expressed circRNAs. CircRNA microarrays from GSE181769, GSE121445, and GSE100170 datasets encompass paired GC tissues and adjacent non-tumor tissues, along with the GSE202538 dataset containing GC cell lines and GES-1 cells. Overlapping the four circRNA microarrays facilitated the isolation of hsa_circ_0063331 (circDDX17) (Fig. 1A). Notably, both GC cells and tissues exhibited low expression levels of circDDX17. The transcript ddx17, which is cyclized from exons 2–5, has a length of 451 bp and is located on chromosome 22 (Fig. 1B). Amplification of circular transcripts employed divergent primers, while linear transcripts were analyzed using convergent primers. Moreover, circDDX17 exhibited resistance to RNase R treatment, confirmed by the inability of divergent primers to amplify circDDX17 from the cDNA of HGC-27 cells (Fig. 1C, D). Subsequent nuclear mass separation assay (Figs. 1E) and FISH analysis (Figs. 1F) demonstrated the cytoplasmic presence of circDDX17 in HGC-27 and MKN-45 cells.

Expression analysis revealed lower circDDX17 levels in gastric tumor tissues compared to 51 pairs of neighboring non-tumor tissues and normal tissues (Fig. 1G). Importantly, the expression of circDDX17 in tumor tissues was negative and substantially correlated with the size of tumor tissues and lymph node metastases in patients, as indicated by the clinicopathological analysis of circDDX17 (Table 1). Furthermore, circDDX17 gene expression in GC cell lines was notably diminished compared to GES-1 cells (Fig. 1H).

Table 1

The clinicopathological features of GC patients with differential expressions of circDDX17
Clinical Parameters	Cases(51)	Expression of circDDX17		P value
Clinical Parameters	Cases(51)	High (n = 14)	Low (n = 37)	P value
Gender				ns
Male	38	10	28
Female	13	4	9
Age (years)				ns
> 65	37	12	25
≤ 65	14	2	12
Tumor size (cm)				< 0.05
> 4	24	10	14
≤ 4	27	4	23
Lymphatic Metastasis				< 0.05
Yes	22	9	13
No	29	5	24
TNM stage				ns
I + II	23	4	19
III + IV	28	10	18

Result 2: CircDDX17 promotes cell apoptosis, and inhibits cell proliferation, migration, and EMT GC cells

To elucidate the function of circDDX17 in GC, circDDX17 was either silenced in MGC-803 cells or overexpressed in HGC-27/MKN-45 cells. Successful modulation of circDDX17 expression was confirmed by qRT-PCR (Fig. 2A), with no alternation observed in ddx17 mRNA levels (Fig. 2B). Colony formation (Figs. 2C and 2D), CCK8 (Figs. 2E-2G), and flow cytometry (Fig. 2H) assays revealed that GC cells overexpressing circDDX17 decreased cell proliferation and promoted apoptosis, whereas silencing circDDX17 increased cell proliferation and inhibited cell apoptosis.

Investigating the role of circDDX17 in GC cell migration and EMT revealed that overexpression of circDDX17 significantly attenuated migration in HGC-27 and MKN-45 cells (Fig. 2I) while enhancing migration in MGC-803 cells (Fig. 2J). Transwell assays corroborated these findings, showing reduced migration in GC cells overexpressing circDDX17 (Fig. 2K) and enhanced migration upon circDDX17 silencing (Fig. 2L).

Western blot analysis of proliferation and apoptosis-related proteins (Fig. 2M) indicated that HGC-27 and MKN-45 cells overexpressing circDDX17 upregulated the expression of cleaved-PARP and BAX while suppressing the expression of BCL and PCNA. Conversely, circDDX17 silence in MDC-803 cells downregulated cleaved PARP and BAX and reduced BCL and PCNA expression. Similarly, Western blot data showed that circDDX17 decreased EMT, with the opposite effect observed upon circDDX17 silencing (Fig. 2N). In vivo, circDDX17-overexpressing reduced GC cell proliferation, migration and EMT, by IHC and Western blot, and decreased serum levels of TGF-β and TNF-α expression by ELISA (Figure S1).

Results 3 CircDDX17 functioned as a miR-1208 and miR-1279 sponge

Our investigation delved into whether circDDX17 modulated GC cell behavior by acting as a sponge for specific miRNAs, a pivotal role attributed to circRNAs. Initially, two miRNAs, miR-1208 and miR-1279, were identified from circBank (http://www.circbank.cn) using bioinformatics analysis, both potentially interacting with circDDX17. qRT-PCR analysis unveiled a negative regulatory effect of circDDX17 on miR-1208 and miR-1279 expression in GC cells (Figs. 3A and 3B). The full-length circDDX17-wild-type (wt) and circDDX17-mutant (mut) sequences were then cloned into the luciferase vector in the absence of miR-1208 or miR-1279 binding sites (Fig. 3C). Luciferase assays confirmed that miR-1208 and miR-1279 significantly decreased the luciferase activity of circDDX17-wt but not circDDX17-mut compared to the miR-NC group (Figs. 3D and 3E).

Further exploration of miR-1208 and miR-1279 expression in GC cell lines, adjacent non-tumor tissues, and gastric tumor tissues was performed using qRT-PCR. Results revealed elevated expression levels of miR-1208 and miR-1279 in GC cell lines and gastric tumor tissues compared to surrounding non-tumor tissues (Fig. 3F–3I). Table S1 shows a correlation between miR-1208 expression level and lymph node metastasis, and Table S2 shows a correlation between miR-1279 expression level and tumor size.

Results 4 miR-1208 and miR-1279 reversed the ability of circDDX17 on GC cell apoptosis, proliferation, migration, and EMT

miRNAs play pivotal roles in GC pathogenesis, prompting an investigation into their functions through either overexpressing or silencing in GC cells. Colony formation, CCK8, Transwell, wound healing, and Western blot collectively revealed that miR-1208 and miR-1279 mimics enhanced GC cell proliferation, migration, and EMT, while miR-1208 and miR-1279 inhibitors suppressed GC cell proliferation (Figure S2), affirming their tumor-promoting impact on GC.

To ascertain if circDDX17 exerted biological functions by sequestering miR-1208 and miR-1279, rescue experiments were conducted wherein circDDX17 and miR-1208/miR-1279 mimics co-transfected in HGC-27 cells. Colony formation (Fig. 4A and 4F), CCK8 assay (Fig. 4B and 4G), and Western blot assays demonstrated that miR-1208/miR-1279 reversed the trend of circDDX17 in apoptosis and proliferation (Fig. 4C and 4H). Moreover, Transwell, wound healing, and Western blot data indicated that miR-1208/miR-1279 reversed the trend of circDDX17 on migration and EMT (Fig. 4D-4E and 4I-4J). Additionally, si-circDDX17 enhanced proliferation and migration in MGC-803 cells, while miR-1208-in or miR-1279-in reduced proliferation and migration ability (Figure S3).

Results 5. CircDDX17 regulates FKBP5 by miR-1208 and miR-1279

To elucidate the downstream mechanisms of miR-1208 and miR-1279 downstream factors, bioinformatics tools (Targetscan and miRDB) were employed to predict the potential targets of miR-1208 and miR-1279. As shown in Fig. 5A, FKBP5 acts as the miR-1208 and miR-1279 target gene. Expression analysis in HGC-27 and MGC-803 cells revealed that miR-1208 and miR-1279 negatively regulated FKBP mRNA (Fig. 5B and 5C) and protein (Fig. 5D) expression. The expression of FKBP5 mRNA in human tissues was also identified. Compared to control tissues, the expression of FKBP5 was significantly downregulated in tumor tissues (Fig. 5E). Moreover, the expression of FKBP5 in tumor tissues was negatively and significantly associated with the size of tumor tissues (Table 2). IHC data confirmed low FKBP5 expression in gastric tumor tissues (Fig. 5F). Additionally, the expression of protein FKBP5 was lower in the GC cell line than in GES-1 cells (Fig. 5G), suggesting FKBP5 is a target gene of miR-1208 and miR-1279.

Table 2

The clinicopathological features of GC patients with differential expressions of FKBP5
Clinical Parameters	Cases(51)	Expression of FKBP5		P value
Clinical Parameters	Cases(51)	High (n = 15)	Low (n = 36)	P value
Gender				ns
Male	38	10	28
Female	13	5	8
Age (years)				ns
> 65	37	9	28
≤ 65	14	6	8
Tumor size (cm)				< 0.05
> 4	24	11	13
≤ 4	27	4	23
Lymphatic Metastasis				ns
Yes	22	8	14
No	29	7	22
TNM stage				ns
I + II	23	5	18
III + IV	28	10	18

Table S3

Primers sequences
Primers	Sequences(5'-3')
CircDDX17-F	ATTTCCGTTGGCTCTTAGTG
CircDDX17-R	CCTCTTGCTCCAAATGATTG
circDDX17-mRNA-F	ATTTGGAGCAAGAGGTGGTG
circDDX17-mRNA-R	CACTAAGAGCCAACGGAAAT
GAPDH-F	AGGTGAAGGTCGGAGTCAAC
GAPDH-R	GGGTGGAATCATATTGGAACA
GAPDH-circ-F	TTGCCCTCAACGACCACTTT
GAPDH-circ-R	ACCAAATCCGTTGACTCCGA
U6-F	CTCGCTTCGGCAGCACA
U6-R	AACGCTTCACGAATTTGCGT
18s-F	ACACGGACAGGATTGACAGA
18s-R	GGACATCTAAGGGCATCACA
miR-1208-F	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCGCCTG-3
miR-1208-R	ACACTCCAGCTGGGTCACTGTTCAGACA
miR-1279-F	CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGAAAGAA
miR-1279-R	ACACTCCAGCTGGGTCATATTGCTT
FKBP5-F	AACCCCCAGAATAAGGCTGC
FKBP5-R	TTGGCGTATATCCTGCGGTC

Further investigation into the impact of miR-1208/miR-1279-FKBP5 on GC cell phenotype revealed that FKBP5 overexpression in HGC-27 cells reduced the healing ability and migratory capacity, and to some degree, decreased proliferation and formed smaller clones compared to control cells. Contrary to the above results, si-FKBP5 promotes GC cell migration and proliferation (Figure S4).

Rescue experiments were conducted to analyze how FKBP5 influenced the effects of miR-1208/miR-1279 on GC development. Functionally, FKBP5 abolished the effects of miR-1208/miR-1279 on GC cell proliferation, migration, and apoptosis (Fig. 5H-5J, 5N-5P). Furthermore, the abnormal FKBP5 levels within GC cells restored miR-1208/miR-1279 role in migration and EMT (Fig. 5K-5M, 5Q-5S). Conversely, miR-1208-inhibitor/miR-1279-inhibitor reversed the effects of si-FKBP5 on GC (Figure S5).

Results 6. FKBP5 regulated GC progression by the ERK1/2 pathway

FKBP5 was initially identified in the HeLa cell cDNA library¹³. According to the Oncomine database, FKBP5 expression varies across different cancer types. For example, FKBP5 is highly expressed in brain cancer, prostate cancer, and lymphoma but is expressed at low levels in pancreatic¹⁴, colon, testicular, and gastric cancers ¹⁵. Our study found that FKBP5 expression was low in both GC cell lines and tissues and is inversely correlated with tumor size in patients with GC. Overexpression of FKBP5 decreased GC cell migration, EMT, and proliferation while promoting apoptosis. Abnormal activation of the ERK pathway contributes to the growth of various tumor types and affects cellular functions like metastasis, cell survival, and proliferation ¹⁶.

To explore the underlying mechanism by which FKBP5 facilitates GC progression, we used bioinformatics tools (STRING, https://cn.string-db.org/cgi/network) to predict interacting proteins and identified ERK1/2 as a target protein of FKBP5. To confirm the interaction between ERK1/2 and FKBP5, we performed IP/Western blot analysis using an anti-FKBP5 antibody. Results showed that exogenous FKBP5 and ERK1/2 bind in HGC-27 and MKN-45 cells (Fig. 6A). An IF assay and confocal imaging revealed that FKBP5 and ERK1/2 co-localized in the cytoplasm of HGC-27 cells (Fig. 6B). When ERK1/2 was inactivated in HGC-27 cells using PD98059, Western blot (Fig. 6C) and IF (Fig. 6D-6F) data revealed that FKBP5, t-ERK1/2, and p-ERK1/2 were significantly decreased. This suggests that PD98059 can concurrently reduce the expression of FKBP5 and ERK1/2. Figures 6G illustrate that FKBP5 overexpression decreased the expression of p-ERK1/2/t-ERK1/2 and p-STAT3/t-STAT3 in intracellular. Figures 6H and 6I show that the overexpression of FKBP5 inhibited the expression of p-ERK1/2 in cells, with the inhibitory effect being particularly noticeable in the nucleus. Conversely, MGC-803 knockdown FKBP5 improved p-ERK1/2 activated in the nucleus and elevated p-ERK1/2/t-ERK1/2 and p-STAT3/t-STAT3 (Fig. 6J-6L).

To further analyze how circDDX17 affects the ERK1/2 and STAT3 pathway via the miR-1208/miR-1279/FKBP5 axis, we examined the effects of circDDX17 overexpression or knockdown in GC cells. circDDX17 overexpression decreased ERK1/2 and STAT3 phosphorylation in HGC-27 and MKN-45 cells (Fig. 6M), whereas circDDX17 knockdown enhanced ERK1/2 and STAT3 phosphorylation in MGC-803 cells (Fig. 6N). When HGC-27 and control cells were overexpressed and injected into the nude mice, FKBP5 was upregulated in the tumor tissue (Fig. 6O); however, ERK1/2 phosphorylation were downregulated (Fig. 6P). Furthermore, IF results showed that circDDX17 knockdown boosted ERK1/2 and STAT3 activation in the nucleus (Fig. 6Q-6T).

Results 7. CircDDX17 encodes the 63aa tumor-suppressed protein

Based on our previous results, we established that circDDX17 suppresses proliferation, migration, and EMT in GC cells. We further explored whether circDDX17 exerts its function by encoding a peptide. circDDX17 was mainly located in the cytoplasm, indicating the potential for protein encoding. The ability and sequence of the polypeptide encoded by circDDX17 were predicted using the public database ORF Finder (www.ncbi.nlm.nih.gov/orffinder), which revealed that circDDX17 could encode a polypeptide, with a 192nt (63aa) segment identifies as a potential encoding sequence (Fig. 7A).

According to the online prediction results, the peptides encoded by circDDX17 are expressed in eukaryotic plasmids. A novel circDDX17 vector containing the GFP sequence was constructed to further assess the protein-coding ability of circDDX17. The circularization of circDDX17 creates a tandem start codon ‘AUG’, initiating translation with overlapping genetic codes. To differentiate the role of the circDDX17-63aa peptide from circDDX17, we constructed several GFP-tag vectors for circDDX17 (Fig. 7B). Transfection with the Lv- circDDX17 vector and Lv- circDDX17 -mut vector both successfully resulted in the overexpression of circDDX17 and the GFP-tagged proteins were detected using Western blot after extracting total cellular proteins from transfected HEK-293T cells after 48 h. (Fig. 7C). Lv-circDDX17 and Lv-circDDX17-63aa successfully expressed GFP-tag; however, the Lv-vector and Lv-circDDX17-mut did not express the GFP-tag. Vectors transfected in HGC-27 cells, GFP-tag expression on Lv-circDDX17 and Lv-circDDX17-63aa transfected cells, and GFP-tag were observed in the cytoplasm (Fig. 9D). SDS-PAGE and Western blot analysis identified the circDDX17-63aa protein at the 10-kDa band, confirming its translation from circDDX17 (Figs. 7E and 7F).

To further explore the biological function of circDDX17-63aa, we transfected HGC-27 cells within the four aforementioned vectors. Overexpression of wild-type circDDX17-63aa decreased proliferation ability, as evidenced by colony formation (Fig. 7G and 7H) and CCK8 assay (Fig. 7I). Moreover, circDDX17-63aa suppressed GC cell migration, evidenced by Transwell (Fig. 7J and 7L) and wound healing assay (Fig. 7K and 7M).

CircRNAs have been shown to play significant roles in regulating several cellular processes, including cancer development and metastasis. Numerous studies have highlighted aberrant expression patterns of ncRNAs, such as miRNAs, lncRNAs, and circRNAs, in different cancer types. Differentially expressed circRNAs are particularly important in the context of GC as they contribute to diagnosis, therapy, and drug sensitivity^17–19. For instance, the upregulation of CircFAM73A enhances stem cell-like characteristics in GC through the miR-490-3p/HMGA2 axis, forming a positive feedback loop. Recruitment of HNRNPK to promote beta-catenin stabilization results in improved cell proliferation, migration, and cisplatin resistance²⁰. Similarly, CircORC5, a downstream target of METTL14, is upregulated when METTL14 is knocked down, reversing miR-30c-2-3p mediated suppression of GC progression and the downregulation of AKT1S1 and EIF4B ²¹. Our study identified circDDX17 as a circRNA with low expression in GC tissue and GC cells, based on data from an online circRNA microarray database. Our findings demonstrate that circDDX17 inhibits GC cell proliferation, migration, and EMT while inducing apoptosis. Moreover, FISH and the nuclear and cytoplasmic isolation assay indicated that circDDX17 is present in both the cytoplasm and the nucleus, predominately in the cytoplasm. These findings suggested that circDDX17 may act as a miRNA sponge, regulating mRNA expression. We further identified miR-1208 and miR-1279 as target miRNAs of circDDX17, both of which promote GC cell proliferation, migration, and EMT (Fig. 8).

Traditionally, eukaryotic mRNA is translated through the conventional cap system, with eIF4E playing a crucial role in the translation initiation process ^22,23. The 5′ UTR of mRNAs contains sequences known as internal ribosome entry sites (IRESs), which directly attract ribosomes to initiate translation. IRES can directly begin mRNA translation ^24,25. High throughput screening has identified IRES elements in approximately 10% of human mRNAs ²⁶. CircRNAs, lacking both 3′ and 5′ end, may primarily utilize IRES-mediated translation²⁷. CircRNAs have the potential to encode proteins since they contain start codons (AUG) and ORFs of sufficient length ²⁸. Emerging studies have linked circRNA-encoded proteins to disease progression in mammals. CircPPP1R12A encodes a 73aa peptide that promotes colon cancer cell growth, migration, and invasion ¹⁰. In our study, the 63aa protein encoded by circDDX17 exhibited similar same tumor-suppressing functions. The cytoplasmic expression of circDDX17-63aa in GC cells enhanced apoptosis while inhibiting cell proliferation and migration.

Immunophilins play a distinctive role as scaffold proteins by interacting with other proteins to direct appropriate protein assembly ²⁹. The first identified proteins in this category, related to the immunosuppressive drug cyclosporin, were cyclophilins and FK506 binding proteins (FKBPs) ³⁰. FKBPs and the tetratricopeptide repeat (TPR) domain. FKBP5 serves as a molecular chaperone for peptidyl steroid hormone receptors like progesterone, androgen, and glucocorticoid receptors³¹. Recent studies have underscored the importance of immunophilins in tumorigenesis, revealing their crucial role in the intrinsic characteristics of tumors ^32–34. For instance, FKBP5 is downregulated in pancreatic cancer ¹⁴, colon cancer, testicular cancer, and gastric cancers ¹⁵, but upregulated in brain cancer, prostate cancer, lymphoma, and melanoma. Notably, the FKBP5 gene is the only immunophilin family member with a known splicing variation ³⁵. FKBP5 affects several essential elements of an organism's cell biology and physiology, including development, differentiation, metabolism, and immunological responses ^36–39, demonstrating pleiotropic activities. In our study, FKBP5 was found to be expressed at low levels in both GC cells and tissues. This low expression correlated with the inhibition of GC cell proliferation, migration, and EMT. Additionally, FKBP5 participates in the NF-κB, AKT, AMPK/mTOR, and TGF-/EMT signaling pathways⁴⁰. The ERK protein is a crucial component of the MAPK pathway, which plays a significant role in the development of GC by regulating the cell cycle, migration, apoptosis, and proliferation. Moreover, among the many isoforms of the ERK family, only ERK1 and ERK2 (also known as the p44 and p42 kinases, respectively) are involved in the RAS/MAPK signaling pathway. Active-ERK1/2 regulates a wide range of cytoplasmic and nuclear targets via phosphorylation, which significantly influences cell proliferation, differentiation, survival, and death ⁴¹. Anomalous activation of the ERK-1/2 pathway has been associated with tumorigenesis ⁴², with hyperactivation reported in several malignancies, including pancreatic ⁴³, breast ⁴⁴, and prostate cancers ⁴⁵. In this study, we demonstrated that FKBP5 interacts with ERK1/2, with both proteins co-localizing in GC cells. This interaction resulted in the downregulation of FKBP5. Our findings suggest that FKBP5 controls GC development through the ERK1/2 pathway.

CircDDX17 functions as an oncogenic factor in the development of GC. Influences key biological activities of GC cells through the circDDX17-miR-1208/miR-1279-FKBP5 axis and by encoding the circDDX17-63aa peptide. Thus, our findings provide a novel target for GC treatment that warrants further investigation.

Patients, tissue samples, and ethics statement.

Between 2018 and 2020, 51 pairs of human GC and neighboring non-tumor tissues were gathered at Jiangsu University's First Affiliated Hospital. All patients gave their written, agreement for the use of their clinical records for investigational purposes. The Jiangsu University Ethical Committee gave its approval to all experimental methods.

Cells and Animals

Jiangsu University maintained the cell lines GES-1, HGC-27, MKN-45, MGC-803, and HEK-293T. All of the cells were grown in DMEM, which contains 10% fetal bovine serum (FBS; Becton, Dickinson and Company, USA). In a cell culture incubator with 5% CO₂, all cell lines were cultured at 37°C.

BALB/c nude mice that were 4 weeks old and weighed 15–20 g were acquired from Nanjing University's Model Animal Research Center. The "Guide for the Care and Use of Laboratory Animals" and the "Principles for the Utilization and Care of Vertebrate Animals" were strictly followed during animal care and experimentation. All animal testing was authorized by Jiangsu University's ethics committee.

Plasmid and Oligonucleotides transfection

Prof. Zhou (Nantong University) donated the pcicR-3.0 vector, which was utilized to overexpress circDDX17. Hanbio Biotech (Shanghai, China) provided the PcDNA-3.0 vector that was utilized to overexpress FKBP5. GenePharma (Shanghai, China) provided the si-circDDX17, si-FKBP5, miR-1208 mimics/inhibitors, and miR-1279 mimics/inhibitors. Sangon Biotech (Shanghai, China) supplied Lv-circDDX17, Lv-circDDX17-63aa, and Lv-circDDX17-mut, with Lv-vector serving as a negative control. Plasmid and oligonucleotide transfection was carried out using Lipofectamine 3000 (Invitrogen, Carlsbad, USA) in accordance with the manufacturer's instructions.

RNA extraction, gDNA extraction, quantitative Real-Time PCR, and RNase R Treatment

Following the manufacturer's instructions, total RNA was isolated using the TRIzol reagent (Invitrogen, Carlsbad, USA). PrimeScript RT Reagent Kit from Takara, Japan was used for reverse transcription, and TB Green Premix Ex TaqII from Takara, Japan was used for quantitative Real-Time PCR. Sangon Biotech (Shanghai, China) created and created the primers. Table S3 contains a list of the PCR primer sequences. Following the manufacturer's instructions, PureLink Genomic DNA Mini Kit (Thermo Fisher Scientific, CA, USA) was used to extract genomic DNA (gDNA) from tissues. 2 mg of total RNA was treated with or without 3 U/mg RNase R for 30 min at 37°C as part of the RNase treatment.

Fluorescence in situ hybridization (FISH)

GC cells were found to have Cy3-labeled circDDX17 probe using a Fluorescent In Situ Hybridization Kit (GenePharma Biotech, China) in accordance with the manufacturer's instructions. In a 24-well plate that had been grown for 12 hours with 3×10³ HGC-27 and MKN-45 cells, circDDX17-specific probes were hybridized overnight at 37°C. Then, for a further five minutes, the cell nuclei were counterstained with DAPI (4,6-diamidino-2-phenylindole). Leica, Mannheim, Germany, fluorescence microscope was used to analyze the data and record the photographs.

Transwell and wound healing assays

Transwell assay (BD Falcon, Franklin Lakes, USA) was examined with 8 m pores. 3×10⁴ HGC-27 cells, 4×10⁴ MKN-45 cells, or 2×10⁴ MGC-803 cells were planted into the cell culture inserts in 150 µL of serum-free DMEM before 10% FBS-containing culture media was added to the bottom chamber. The cells on the lower side of the filter were fixed, stained, and seen under a microscope after 24–48 hours of incubation. Cells were sown in a 6 or 12-well plate and cultured in DMEM containing 10% FBS for wound healing tests. The single cell layer was then scratched with a sterile 10 mL plastic pipette tip and refilled with serum-free DMEM. Images were taken with an Olympus light microscope at the specified periods (0 and 24 hours). All experiments were performed in duplicate and repeated three times.

Colony formation and CCK8 assays

A 12-well plate with 500 cells per well, culture media containing 10% FBS, and an incubator were used for the colony formation test. The cells were then stained with crystal violet after being fixed with methanol, and colonies were photographed and counted. 1000 cells/well of culture media with 10% FBS were planted in 96-well plates for the CCK8 test. Following the addition of 10 µL of CCK8 reagent (Tongren, Shanghai, China) to each well and a 1-hour incubation period, the absorbance of the wells was spectrophotometrically determined at 450 nm at 24, 48, 72, 96, and 120 hours.

Flow cytometry

An Annexin V-FITC/PI kit from Vazyme, China, was used to conduct the cell apoptosis experiment. Following a 48-hour transfection, adherent cells were digested with trypsin without the addition of EDTA, and recovered cells were resuspended in pre-chilled PBS. By adding annexin V-fluorescein isothiocyanate solution (FITC, 5 µL) and PI (5 µL) in suspension, the BD FACS Calibur flow cytometer (BD Falcon, Franklin Lakes, USA) was able to detect apoptosis.

Western blot assay

Cells were collected, lysed with RIPA buffer (Invitrogen, Carlsbad, USA) containing 1% PMSF, and centrifuged at 4°C for 20 min at 12000 rpm. SDS-PAGE was used to load and separate proteins. The gels were transferred to PVDF membranes (Millipore, USA), then blocked overnight at 4°C with primary antibodies and 5% nonfat milk (BD Falcon, Franklin Lakes, USA). An enhanced chemiluminescence (ECL) system (Image Quant LAS 4000 mini, Pittsburgh, USA) was employed, and secondary HRP-conjugated antibodies were applied.

Immunohistochemistry (IHC) assay

The experiment was conducted in accordance with the IHC kit is manufacturer's instructions at Boster Bioengineering (Wuhan, China). On 4 µm slices that had been deparaffinized with xylene and rehydrated with ethanol, IHC staining was carried out. To decrease endogenous peroxidase activity, sections were treated to 3% hydrogen peroxide for 10 minutes. Following this, sections were blocked with 5% BSA and incubated with the primary antibody at 4°C for an overnight period. Sections were incubated using IgG-biotin and SABC, followed by counterstaining with 3,3-diaminobenzidine and hematoxylin and microscope viewing.

Luciferase reporter assay

At Jiangsu University, the plasmid PmirGLO vector was kept on hand. Sangon Biotech (Shanghai, China) created CircDDX17-wild-type (wt) and CircDDX17-mutant (mut). For 36 hours, the HEK-293T cells were co-transfected with the plasmids and miR-1208/miR-1279 mimics. Using a dual-luciferase reporter assay (Promega, WI, USA), the luciferase activities were found.

Immunofluorescence assay

GC cells cultured on slides were fixed for at least 30 minutes with 4% paraformaldehyde. 5% BSA is used for blocking and 0.5% Triton-X-100 (Sigma-Aldrich, USA) is used for permeabilization. primary antibodies were incubated overnight at 4°C. DAPI and fluorescent secondary antibodies (from Beyotime, China) were then added. Leica, Mannheim, Germany, fluorescence microscope was used to analyze the data and record the photographs.

Enzyme-linked immunosorbent assay (ELISA)

According to the manufacturer's instructions, commercial ELISA kits from Meimian (Jiangsu, China) were used to evaluate the expression levels of the cytokines TGF-, TNF-, and IL-1. A microplate reader (Thermo Fisher Scientific, CA, USA) was used to measure the optical density (OD) values after the supernatants were collected, incubated with reaction solution, and then stopped with a stop solution.

Statistical analysis

GraphPad Prism 9 was used to examine experimental findings using a t-test (two-tailed) or an ANOVA. Using the chi-square test or Fisher's exact test, the connection between the expression of circDDX17, miR-1208, miR-1279, and FKBP5 and clinicopathological traits was computed and examined. Statistical significance for the differences was determined by < 0.05, **P < 0.01, or ***P < 0.001.

Ethics approval and consent to participate

The use of clinical samples was approved by the ethics committee of Jiangsu University and informed consent was obtained from all patients.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

All authors gave their consent for the publication of identifiable details, which includes the text, figures, and other materials in this manuscript

Funding

The National Natural Science Foundation of China (Grant No. 81772157).

Authors’ contributions

Shihe Shao and Feilun Cui provided ideas for the article. Tingjun Liu, Haoliang Zhang, Jiaxin Xue, and Linqi Zhu researched data for the article. Tingjun Liu and Tieliang Ma edited the manuscript before submission. All authors approved the final version of the manuscript.

Acknowledgments

Not applicable.

Availability of data and materials

All the data in this article are included in the manuscript.

Sung H, Ferlay J, Siegel RL, et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. May 2021;71(3):209-249. https://doi.org10.3322/caac.21660.
Gao JP, Xu W, Liu WT, Yan M, Zhu ZG. Tumor heterogeneity of gastric cancer: From the perspective of tumor-initiating cell. World J Gastroenterol. Jun 28 2018;24(24):2567-2581. https://doi.org10.3748/wjg.v24.i24.2567.
Morgan E, Arnold M, Camargo MC, et al. The current and future incidence and mortality of gastric cancer in 185 countries, 2020-40: A population-based modelling study. EClinicalMedicine. May 2022;47:101404. https://doi.org10.1016/j.eclinm.2022.101404.
Saw PE, Xu X, Chen J, Song EW. Non-coding RNAs: the new central dogma of cancer biology. Sci China Life Sci. Jan 2021;64(1):22-50. https://doi.org10.1007/s11427-020-1700-9.
Lu S, Zhang J, Lian X, et al. A hidden human proteome encoded by 'non-coding' genes. Nucleic Acids Res. Sep 5 2019;47(15):8111-8125. https://doi.org10.1093/nar/gkz646.
Meng S, Zhou H, Feng Z, et al. CircRNA: functions and properties of a novel potential biomarker for cancer. Mol Cancer. May 23 2017;16(1):94. https://doi.org10.1186/s12943-017-0663-2.
Huang A, Zheng H, Wu Z, Chen M, Huang Y. Circular RNA-protein interactions: functions, mechanisms, and identification. Theranostics. 2020;10(8):3503-3517. https://doi.org10.7150/thno.42174.
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. Jan 23 2004;116(2):281-97. https://doi.org10.1016/s0092-8674(04)00045-5.
Hansen TB, Jensen TI, Clausen BH, et al. Natural RNA circles function as efficient microRNA sponges. Nature. Mar 21 2013;495(7441):384-8. https://doi.org10.1038/nature11993.
Zheng X, Chen L, Zhou Y, et al. A novel protein encoded by a circular RNA circPPP1R12A promotes tumor pathogenesis and metastasis of colon cancer via Hippo-YAP signaling. Mol Cancer. Mar 29 2019;18(1):47. https://doi.org10.1186/s12943-019-1010-6.
Pan Z, Cai J, Lin J, et al. A novel protein encoded by circFNDC3B inhibits tumor progression and EMT through regulating Snail in colon cancer. Mol Cancer. Apr 2 2020;19(1):71. https://doi.org10.1186/s12943-020-01179-5.
Liu Y, Cao J, Zhu L, et al. Circular RNA circPGD contributes to gastric cancer progression via the sponging miR-16-5p/ABL2 axis and encodes a novel PGD-219aa protein. Cell Death Discov. Sep 14 2022;8(1):384. https://doi.org10.1038/s41420-022-01177-0.
Baughman G, Wiederrecht GJ, Campbell NF, Martin MM, Bourgeois S. FKBP51, a novel T-cell-specific immunophilin capable of calcineurin inhibition. Mol Cell Biol. Aug 1995;15(8):4395-402. https://doi.org10.1128/mcb.15.8.4395.
Pei H, Li L, Fridley BL, et al. FKBP51 affects cancer cell response to chemotherapy by negatively regulating Akt. Cancer Cell. Sep 8 2009;16(3):259-66. https://doi.org10.1016/j.ccr.2009.07.016.
Wang Y, Li T, Yang L, et al. Cancer-associated fibroblast-released extracellular vesicles carrying miR-199a-5p induces the progression of gastric cancer through regulation of FKBP5-mediated AKT1/mTORC1 signaling pathway. Cell Cycle. Dec 2022;21(24):2590-2601. https://doi.org10.1080/15384101.2022.2105092.
Ponsioen B, Post JB, Buissant des Amorie JR, et al. Quantifying single-cell ERK dynamics in colorectal cancer organoids reveals EGFR as an amplifier of oncogenic MAPK pathway signalling. Nat Cell Biol. Apr 2021;23(4):377-390. https://doi.org10.1038/s41556-021-00654-5.
Xu J, Lin H, Li G, et al. The miR-367-3p Increases Sorafenib Chemotherapy Efficacy to Suppress Hepatocellular Carcinoma Metastasis through Altering the Androgen Receptor Signals. EBioMedicine. Oct 2016;12:55-67. https://doi.org10.1016/j.ebiom.2016.07.013.
Huang YS, Jie N, Zou KJ, Weng Y. Expression profile of circular RNAs in human gastric cancer tissues. Mol Med Rep. Sep 2017;16(3):2469-2476. https://doi.org10.3892/mmr.2017.6916.
Jie M, Wu Y, Gao M, et al. CircMRPS35 suppresses gastric cancer progression via recruiting KAT7 to govern histone modification. Mol Cancer. Mar 12 2020;19(1):56. https://doi.org10.1186/s12943-020-01160-2.
Xia Y, Lv J, Jiang T, et al. CircFAM73A promotes the cancer stem cell-like properties of gastric cancer through the miR-490-3p/HMGA2 positive feedback loop and HNRNPK-mediated β-catenin stabilization. J Exp Clin Cancer Res. Mar 17 2021;40(1):103. https://doi.org10.1186/s13046-021-01896-9.
Fan HN, Chen ZY, Chen XY, et al. METTL14-mediated m(6)A modification of circORC5 suppresses gastric cancer progression by regulating miR-30c-2-3p/AKT1S1 axis. Mol Cancer. Feb 14 2022;21(1):51. https://doi.org10.1186/s12943-022-01521-z.
Marintchev A, Edmonds KA, Marintcheva B, et al. Topology and regulation of the human eIF4A/4G/4H helicase complex in translation initiation. Cell. Feb 6 2009;136(3):447-60. https://doi.org10.1016/j.cell.2009.01.014.
Gross JD, Moerke NJ, von der Haar T, et al. Ribosome loading onto the mRNA cap is driven by conformational coupling between eIF4G and eIF4E. Cell. Dec 12 2003;115(6):739-50. https://doi.org10.1016/s0092-8674(03)00975-9.
Shatsky IN, Dmitriev SE, Terenin IM, Andreev DE. Cap- and IRES-independent scanning mechanism of translation initiation as an alternative to the concept of cellular IRESs. Mol Cells. Oct 2010;30(4):285-93. https://doi.org10.1007/s10059-010-0149-1.
Macejak DG, Sarnow P. Internal initiation of translation mediated by the 5' leader of a cellular mRNA. Nature. Sep 5 1991;353(6339):90-4. https://doi.org10.1038/353090a0.
Spriggs KA, Stoneley M, Bushell M, Willis AE. Re-programming of translation following cell stress allows IRES-mediated translation to predominate. Biol Cell. Jan 2008;100(1):27-38. https://doi.org10.1042/bc20070098.
Pamudurti NR, Bartok O, Jens M, et al. Translation of CircRNAs. Mol Cell. Apr 6 2017;66(1):9-21.e7. https://doi.org10.1016/j.molcel.2017.02.021.
Wilusz JE. Circular RNAs: Unexpected outputs of many protein-coding genes. RNA Biol. Aug 3 2017;14(8):1007-1017. https://doi.org10.1080/15476286.2016.1227905.
Rein T. Peptidylprolylisomerases, Protein Folders, or Scaffolders? The Example of FKBP51 and FKBP52. Bioessays. Jul 2020;42(7):e1900250. https://doi.org10.1002/bies.201900250.
Dornan J, Taylor P, Walkinshaw MD. Structures of immunophilins and their ligand complexes. Curr Top Med Chem. 2003;3(12):1392-409. https://doi.org10.2174/1568026033451899.
Li L, Lou Z, Wang L. The role of FKBP5 in cancer aetiology and chemoresistance. Br J Cancer. Jan 4 2011;104(1):19-23. https://doi.org10.1038/sj.bjc.6606014.
Peterson AA, Rangwala AM, Thakur MK, et al. Discovery and molecular basis of subtype-selective cyclophilin inhibitors. Nat Chem Biol. Nov 2022;18(11):1184-1195. https://doi.org10.1038/s41589-022-01116-1.
Romano S, D'Angelillo A, Romano MF. Pleiotropic roles in cancer biology for multifaceted proteins FKBPs. Biochim Biophys Acta. Oct 2015;1850(10):2061-8. https://doi.org10.1016/j.bbagen.2015.01.004.
Zhu Z, Hou Q, Wang B, et al. FKBP4 regulates 5-fluorouracil sensitivity in colon cancer by controlling mitochondrial respiration. Life Sci Alliance. Nov 2022;5(11). https://doi.org10.26508/lsa.202201413.
Romano S, D'Angelillo A, Staibano S, et al. Immunomodulatory pathways regulate expression of a spliced FKBP51 isoform in lymphocytes of melanoma patients. Pigment Cell Melanoma Res. Jul 2015;28(4):442-52. https://doi.org10.1111/pcmr.12378.
Vittorioso P, Cowling R, Faure JD, Caboche M, Bellini C. Mutation in the Arabidopsis PASTICCINO1 gene, which encodes a new FK506-binding protein-like protein, has a dramatic effect on plant development. Mol Cell Biol. May 1998;18(5):3034-43. https://doi.org10.1128/mcb.18.5.3034.
Liu TM, Martina M, Hutmacher DW, Hui JH, Lee EH, Lim B. Identification of common pathways mediating differentiation of bone marrow- and adipose tissue-derived human mesenchymal stem cells into three mesenchymal lineages. Stem Cells. Mar 2007;25(3):750-60. https://doi.org10.1634/stemcells.2006-0394.
Smedlund KB, Sanchez ER, Hinds TD, Jr. FKBP51 and the molecular chaperoning of metabolism. Trends Endocrinol Metab. Nov 2021;32(11):862-874. https://doi.org10.1016/j.tem.2021.08.003.
Marrone L, D'Agostino M, Cesaro E, et al. Alternative splicing of FKBP5 gene exerts control over T lymphocyte expansion. J Cell Biochem. Jan 16 2023. https://doi.org10.1002/jcb.30364.
Marrone L, D'Agostino M, Giordano C, et al. Scaffold proteins of cancer signaling networks: The paradigm of FK506 binding protein 51 (FKBP51) supporting tumor intrinsic properties and immune escape. Oncol Res. 2023;31(4):423-436. https://doi.org10.32604/or.2023.028392.
Mlakar V, Morel E, Mlakar SJ, Ansari M, Gumy-Pause F. A review of the biological and clinical implications of RAS-MAPK pathway alterations in neuroblastoma. J Exp Clin Cancer Res. Jun 8 2021;40(1):189. https://doi.org10.1186/s13046-021-01967-x.
Deschênes-Simard X, Kottakis F, Meloche S, Ferbeyre G. ERKs in cancer: friends or foes? Cancer Res. Jan 15 2014;74(2):412-9. https://doi.org10.1158/0008-5472.Can-13-2381.
Yan Z, Ohuchida K, Fei S, et al. Inhibition of ERK1/2 in cancer-associated pancreatic stellate cells suppresses cancer-stromal interaction and metastasis. J Exp Clin Cancer Res. May 27 2019;38(1):221. https://doi.org10.1186/s13046-019-1226-8.
Wu D, Jia HY, Wei N, Li SJ. POU4F1 confers trastuzumab resistance in HER2-positive breast cancer through regulating ERK1/2 signaling pathway. Biochem Biophys Res Commun. Dec 10 2020;533(3):533-539. https://doi.org10.1016/j.bbrc.2020.09.003.
Xu CJ, Dong LL, Kang XL, Li ZM, Zhang HY. Leptin promotes proliferation and inhibits apoptosis of prostate cancer cells by regulating ERK1/2 signaling pathway. Eur Rev Med Pharmacol Sci. Aug 2020;24(16):8341-8348. https://doi.org10.26355/eurrev_202008_22630.

(Not answered)

Download PDF

Version 1

posted

You are reading this latest preprint version

Circular RNA circDDX17 suppression to gastric cancer progression via the sponging miR-1208/miR-1279/FKBP5 axis encodes a novel circDDX17-63aa protein

Status:

Version 1

Abstract

Figures

Introduction

Results

Result 1: Characterization of circDDX17 existence, subcellular distribution, and expression in GC cells and tissues

Result 2: CircDDX17 promotes cell apoptosis, and inhibits cell proliferation, migration, and EMT GC cells

Results 3 CircDDX17 functioned as a miR-1208 and miR-1279 sponge

Results 5. CircDDX17 regulates FKBP5 by miR-1208 and miR-1279

Results 6. FKBP5 regulated GC progression by the ERK1/2 pathway

Results 7. CircDDX17 encodes the 63aa tumor-suppressed protein

Discussion

Conclusion

Methods

Cells and Animals

Plasmid and Oligonucleotides transfection

RNA extraction, gDNA extraction, quantitative Real-Time PCR, and RNase R Treatment

Fluorescence in situ hybridization (FISH)

Transwell and wound healing assays

Colony formation and CCK8 assays

Flow cytometry

Western blot assay

Immunohistochemistry (IHC) assay

Luciferase reporter assay

Immunofluorescence assay

Enzyme-linked immunosorbent assay (ELISA)

Statistical analysis

Declarations

Ethics approval and consent to participate

Funding

Authors’ contributions

Acknowledgments

Availability of data and materials

References

Additional Declarations

Supplementary Files

Status:

Version 1