Enhanced anti-cancer efficacy of arginine deaminase expressed by tumor-seeking Salmonella Gallinarum

doi:10.21203/rs.3.rs-4747916/v1

Download PDF

Article

Enhanced anti-cancer efficacy of arginine deaminase expressed by tumor-seeking Salmonella Gallinarum

https://doi.org/10.21203/rs.3.rs-4747916/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 25 Sep, 2024

Read the published version in Oncogene →

You are reading this latest preprint version

Amino acid deprivation, particularly of nonessential amino acids that can be synthesized by normal cells but not by cancer cells with specific defects in the biosynthesis pathway, has emerged as a potential strategy in cancer therapeutics. In normal cells, arginine is synthesized from citrulline in two steps via two enzymes: argininosuccinate synthetase (ASS1) and argininosuccinate lyase. Several cancer cells exhibit arginine auxotrophy due to the loss or down-regulation of ASS1. These cells undergo starvation-induced cell death in the presence of arginine-degrading enzymes such as arginine deaminase (ADI). Thus, ADI has emerged as a potential therapeutic in cancer therapy. However, the use of ADI has two major disadvantages: ADI of bacterial origin is strongly antigenic in mammals, and ADI has a short circulation half-life (∼5 hours). In this study, we engineered tumor-targeting Salmonella Gallinarum to express and secrete ADI and deployed this strain into mice implanted with ASS1-defective mouse colorectal cancer (CT26) through an intravenous route. A notable antitumor effect was observed, suggesting that the disadvantages were overcome as ADI was expressed constitutively by tumor-targeting bacteria. A combination with chloroquine, which inhibits the induction of autophagy, further enhanced the effect.

cancer therapy

Salmonella Gallinarum

arginine deaminase

mouse tumor models

Cancer is a formidable disease that requires a multifaceted approach for effective treatment. The historical use of bacteria as anticancer agents dates back over a century. In its early stages, clinicians employed live bacteria, such as Streptococci and Clostridia, for cancer treatment [1–5]. In recent years, commonly applied bacterial genera include Salmonella, Clostridium, Bifidobacterium, Lactobacillus, Escherichia, Pseudomonas, Caulobacter, Listeria, Proteus, and Streptococcus [6–10]. There are various strategies employed in bacterial cancer therapy that can be broadly categorized into i) use of native bacterial toxicity and ii) synergistic combinations with other therapies, where bacteria have been exploited as vehicles for delivering proteins that interfere with tumor growth [6, 11–14]. For ease of genetic engineering, Salmonella spp. would be most desirable since various methods (transformation, transduction, and conjugation) can be applied to construct therapeutic strains [15].

The tumor microenvironment (TME) is a complex and dynamic ecosystem that surrounds and interacts with cancer cells within a tumor. Targeting the TME has become an important strategy in cancer therapy, aiming to disrupt the supportive environment that allows tumors to grow and evade the immune system. Among several key targets in the tumor microenvironment that are being explored for anti-cancer therapy, specific metabolic pathways are emerging modalities. Arginine plays a crucial role in various cellular functions, including the synthesis of nitric oxide, polyamines, nucleotides, proline, glutamate, and proteins [16]. In normal cells, arginine is synthesized from citrulline in two steps via the urea cycle enzymes argininosuccinate synthetase (ASS1) and argininosuccinate lyase. Argininosuccinate synthetase catalyzes the conversion of citrulline and aspartic acid to argininosuccinate. Argininosuccinate is then converted to arginine and fumaric acid by argininosuccinate lyase [17]. Several tumors, such as hepatocellular carcinoma, malignant melanoma, malignant pleural mesothelioma, prostate, and renal cancer, exhibit arginine auxotrophy due to variable loss or down-regulation of ASS1 [18]. These cancerous cells depend on the exogenous supply of arginine for survival and would undergo starvation-induced cell death in the presence of arginine-degrading enzymes [19]. Arginine deaminase (ADI) converting arginine into citrulline and ammonia has emerged as a potential therapeutic in cancer therapy, supported by a wealth of studies indicating its multifaceted impact on cancer cells [20]. This arginine deficiency disrupts pivotal cellular processes, including protein synthesis and DNA replication, consequently impeding cancer cell growth [21]. These findings underscore ADI as a promising therapeutic tool in cancer treatment, particularly for malignancies reliant on arginine for sustained growth. However, the use of ADI has two major disadvantages. First, ADI is only found in microorganisms and is strongly antigenic in mammals. Secondly, ADI has a short circulation half-life (∼5 h) and must be frequently administered in large doses to inhibit tumors implanted in mice [22]. To address this, various strategies have been explored to enhance the stability and prolong the circulation time of ADI. One common approach involves pegylation, where polyethylene glycol (PEG) molecules are conjugated to the enzyme [23]. Pegylation has been shown to increase the molecular size of ADI, reducing its clearance by the reticuloendothelial system and extending its half-life in the bloodstream. This modification enhances the pharmacokinetic profile of ADI, leading to improved therapeutic efficacy [24]. Other strategies may involve encapsulating ADI in nanoparticles or liposomes to provide protection and controlled release [25]. These efforts aim to overcome the inherent limitations of ADI and optimize its potential as a targeted therapy for ASS1 deficient cancer cells.

When cancer cells are deprived of essential amino acids, they often respond by activating autophagy, a cellular process that can help cells survive under stress by recycling cellular components. Induction of autophagy provides a mechanism for cancer cells to survive in a nutrient-poor environment and also leads to the biosynthesis of depleted amino acids within the cell to maintain cellular function. Through these activated biosynthesis pathways, cells can synthesize essential amino acids from non-essential precursors or intermediates. For instance, cells can synthesize arginine from citrulline, if possible. Therefore, it would be reasonable to combine amino acid depletion strategies with inhibitors of autophagy or other metabolic pathways.

In this study, we engineered an attenuated strain of Salmonella Gallinarum, known for its tumor-targeting properties, to express arginine deaminase (ADI) in situ. The continuous expression of ADI by tumor-targeting Salmonella resulted in a notable antitumor effect in a colorectal tumor (CT26) xenograft mouse model. This sustained expression of ADI within the tumor microenvironment was proven effective compared to purified ADI administered via conventional methods, offering a straightforward solution to overcome the challenges associated with ADI therapy. In addition, a combination with chloroquine (CQ) that inhibits the induction of autophagy [26] resulted in an enhanced anti-cancer effect. It was conjectured that the chloroquine treatment disrupted autophagy, involved in the degradation and recycling of cellular components, resulting in enhanced effectiveness of arginine depletion therapy.

Construction of Salmonella Gallinarum expressing ADI

In the initial phase of this study, we constructed a plasmid expressing and secreting the arcA gene encoding Arginine Deiminase (ADI) from genomic DNA of Lactococcus lactis ssp. lactis (ATCC 7962). The ADI in the Lactococcus lactis was chosen since it has been shown to be highly suppressive to SNU-1 human gastric adenocarcinoma [27]. The arcA gene was placed under TAC promoter. Additionally, we incorporated a 3xFLAG tag immediately after the arcA gene to facilitate the detection and quantification of ADI using a specific antibody [28]. The TAC promoter in S. Gallinarum lacking Lac repressor expresses constitutively any gene cloned downstream (data not shown). For ADI to operate in TME, it must be secreted from tumor-targeted bacteria. We exploited the 22-amino acid PelB leader sequence from Erwinia chrysanthem that allows secretion of the downstream cargo protein [29]. The ADI gene was first inserted into pET20b, which contains the PelB signaling sequence, using the BamHI and XbaI site of the plasmid, generated PelB-ADI. This was subsequently cloned into the KpnI/XbaI sites of the pTAC at the downstream of TAC promoter, generating a plasmid named pTAC_PelB::ADI (Fig. 1A).

We used ΔppGpp Salmonella Gallinarum SGKS1004, as it is attenuated in a mouse model such that i.v. injection of 5x10⁸ Colony Forming Units (CFU) caused no harm at all [30]. The ppGpp-defective mutant was created by disrupting ppGpp synthetase I and II, encoded by relA and spoT genes, respectively [31]. To maintain the plasmid in the absence of selection pressure, the plasmid carried a balanced-lethal host-vector system in which the glmS gene of S. Gallinarum was incorporated into the plasmid pTAC_PelB::ADI while the host carried a mutation in the chromosomal glmS gene locus, as the GlmS⁻ mutant undergoes lysis unless complemented by the glmS gene on the plasmid [30, 32]. For subsequent studies, ΔppGpp S. Gallinarum transformed with the pTAC_PelB::ADI carrying glmS gene was deployed.

Firstly, this strain was grown in LB overnight, and the bacteria were separated from the medium after centrifugation. The bacterial pellet was sonicated, and the soluble fraction was taken for analysis together with the medium as well as the total cell lysate (Fig. 1B). These were subjected to SDS-PAGE gel electrophoresis and probed for detection of ADI by Western analysis using specific antibody (Fig. 1B). ADI was detected in the medium as well as in the total cell lysate and the soluble fraction of the bacterial pellet. Apparently, ADI was expressed from pTAC as a soluble protein and secreted out of bacteria via the PelB leader sequence. To determine the functionality of ADI, the enzyme activity was assessed using a standard protocol [33]. ADI activities in total cell lysate and the soluble fraction of bacterial pellet of 10 ml bacterial culture grown overnight in LB were 660 IU, while that in the bacterial medium was 73 IU. The PelB mediated secretion of ADI seemed to be 11% (Fig. S1). The effect of expressing and secreting PelB-ADI on the growth of S. Gallinarum was evaluated through a comparison of bacterial growth curves between strains carrying the empty plasmid and those expressing PelB-ADI. The expression and secretion of PelB-ADI did not exert any notable impact on bacterial growth kinetics, indicating that the presence of PelB-ADI did not interfere with bacterial proliferation under the experimental conditions employed in this study (Fig. 1C). This was a favorable characteristic for its potential application as a therapeutic agent in cancer treatment.

Anti-cancer effect of ADI on cancer cell lines in vitro

It is widely acknowledged that ADI exerts its inhibitory effects on de novo protein synthesis predominantly in cells with low ASS1 activity while showing a diminished impact on cells with elevated ASS1 activity. To develop this phenomenon for our approach, we meticulously investigated the effects of ADI expressed and secreted by ΔppGpp S. Gallinarum carrying pTAC_PelB::ADI on four distinct cancer cell lines in vitro (Fig. 1D). The chosen cell lines encompassed ASS1-expressing entities, such as B16F10 mouse melanoma cells and HEK-293 human embryonic kidney cells, alongside ASS1-deficient counterparts, including 4T1 mouse breast cancer cells and CT26 murine colorectal carcinoma cells (Fig. 1E). Employing a systematic approach, cells were cultured in 96-well plates and subjected to sequentially diluted bacterial media grown by the ADI-secreting S. Gallinarum. After a 24-hour incubation period, MTT staining was performed, enabling the quantification of the percentage of viable cells. Notably, ASS1-positive cells exhibited a sustained high percentage of viability across all concentrations of tested ADI, underscoring the protective role of ASS1 in mitigating ADI-induced cytotoxic effects. Conversely, ASS1-negative cells experienced a concentration-dependent increase in ADI-induced cytotoxicity, further corroborating the differential impact of ADI on cells with varying levels of ASS1 expression. While treating ASS1-negative cancers with ADI, there was a theoretical possibility for ASS1 to become reactivated and begin producing arginine. To investigate whether ADI treatment could potentially induce the reactivation of ASS1 expression in CT26 mouse cancer cells, we conducted in vitro experiments to assess ASS1 levels following ADI treatment. Our results revealed no significant activation of ASS1 expression in CT26 cells treated with ADI, as demonstrated by Western blot analysis (Fig. 1F). These findings suggest that ADI treatment does not lead to the restoration of ASS1 expression in ASS1-deficient CT26 cancer cells. This provides valuable insight into the notable response of cancer cells to ADI based on their ASS1 status, shedding light on potential avenues for targeted cancer therapies with ADI-expressing bacteria.

Anti-cancer effect of ADI expressed by ΔppGpp S. Gallinarum on grafted tumor in mouse model.

Subsequently, ΔppGpp S. Gallinarum carrying the pTAC_PelB::ADI construct at a dose of 1×10⁸ CFU/mouse was administered to BALB/c mice bearing CT26 colon carcinoma grafts through the intravenous route when tumor volumes reached ~ 100 mm³. As part of the experimental design, a mock control was included, involving the injection of ΔppGpp S. Gallinarum carrying the parental plasmid lacking PelB::ADI, denoted as pTAC. After 5 days post-injection (dpi), tumor tissues were excised and subjected to Western analysis to assess the expression of ADI. A robust presence of ADI was observed in the soluble fraction of tumor tissue derived from mice treated with ΔppGpp S. Gallinarum carrying pTAC_PelB::ADI, in stark contrast to no ADI expression in the mock control mice (Fig. 2A).

Concurrently, at this 5-day juncture, not only were tumor tissues collected but also vital organs like the liver and spleen. Bacterial colony-forming units (CFU) were enumerated, revealing a striking count of over 10⁹ CFU in the tumor tissues of mice treated with ΔppGpp S. Gallinarum carrying pTAC_PelB::ADI or pTAC (mock) (Fig. 2B). In contrast, ~ 5×10³ CFU and ~ 1×10³ CFU were counted in the spleens and livers, respectively, of the animals treated with ΔppGpp S. Gallinarum carrying either type of plasmid. These results strongly suggested that the expression and secretion of ADI from ΔppGpp S. Gallinarum did not compromise the efficacy of tumor targeting or impede bacterial proliferation within the tumor microenvironment.

Antitumor efficacies were also examined in these animals (Fig. 2C). Notably, mice treated with ΔppGpp S. Gallinarum carrying pTAC_PelB::ADI displayed a significant reduction in tumor size compared to those treated with the bacteria carrying the empty plasmid (mock), the latter still demonstrating notable retardation of tumor growth compared to the PBS control (Fig. 2C, E). Treatment with ΔppGpp S. Gallinarum containing pTAC_PelB::ADI or empty plasmid (mock) did not cause any significant weight loss in the CT26 mice (Fig. 2D). Importantly, this distinct divergence in tumor dynamics translated into a remarkable survival advantage for the group treated with ΔppGpp S. Gallinarum expressing ADI compared to those treated with ΔppGpp S. Gallinarum (mock) or PBS (Fig. 2F). The median overall survival for mice subjected to ΔppGpp S. Gallinarum expressing ADI extended significantly to ~ 34 days, a noteworthy contrast to the ~ 23 days observed in mice treated with the bacteria carrying pTAC (mock). Moreover, in comparison with the PBS control group, which exhibited a median overall survival of ~ 16 days, treatment with ΔppGpp S. Gallinarum expressing ADI conferred an approximately two-fold extension in median overall survival. This result underscored the profound antitumor efficacy of ADI-expressing S. Gallinarum, suggesting its potential as a therapeutic intervention with significant implications for extending survival in CT26 colon carcinoma-bearing mice.

We then designed an experiment to delineate the mechanism underlying the anti-tumor effect of ADI expressed by the bacteria in the tumor microenvironment (TME). Purified ADI (2 IU) was injected directly into tumor tissue every two days, with or without co-injection of ΔppGpp S. Gallinarum carrying pTAC through the intravenous route once at 0 dpi (Fig. 3A). Control experiments included injections of PBS, ΔppGpp S. Gallinarum carrying pTAC, and ΔppGpp S. Gallinarum carrying pTAC-PelB-ADI as before. Tumor sizes in each group of mice were recorded every two days after the treatments. Injection of the purified ADI demonstrated a limited effect only at earlier time points, attributed to the protein's inherent characteristics, including a short serum half-life and marked immunogenicity, as reported previously [22]. Intriguingly, the combined administration of ΔppGpp S. Gallinarum carrying pTAC and purified ADI exhibited a better effect compared to bacteria alone (mock). The most compelling results emerged from the profound impact of ADI expressed by ΔppGpp S. Gallinarum, underscoring its efficacy within the cancer tissue (Fig. 3B). Combination therapy with bacteria as well as treatment with purified ADI did not result in significant weight loss in the treated mice groups (Fig. 3C). As a conclusive measure, on 10 dpi, tumor tissues from all experimental groups were dissected, and their weights were quantified, thereby providing tangible data that substantiates the outcomes of this intricate experiment (Fig. 3D). The results clearly suggested that the observed effect was due to the expression of the ADI by S. Gallinarum on-site in tumor tissue, presumably allowing maintenance of this protein, which otherwise would vanish in a short period.

Enhancement of therapeutic effect of ADI depletion in situ by co-treatment with chloroquine

It has been reported that the depletion of intracellular arginine by ADI induces metabolic stress and subsequent cellular autophagy [34, 35]. The role of autophagy is to protect cancer cells from death, thus playing a cytoprotective role in ADI-based cancer therapy [36]. Chloroquine diphosphate (CQ), renowned for its antimalarial properties, has demonstrated diverse biological effects, including inhibition of cell growth and induction of cell death across various cancer cells [37–41]. Notably, CQ blocks the induction of autophagy [26], thereby disrupting mechanisms that promote tumor survival and growth, potentially enhancing the effectiveness of cancer therapies by amino acid deprivation [42, 43]. We evaluated the therapeutic potential of combined treatment with S. Gallinarum carrying a PelB-ADI-expressing plasmid and CQ in a murine tumor model (Fig. 4).

Following the establishment of CT26 tumors, mice were treated with PBS, CQ alone, bacteria carrying the mock vector (mock), mock plus CQ, bacteria expressing PelB-ADI, or the bacteria expressing PelB-ADI plus CQ. CQ was administered at 50 mg/kg per day, as suggested in previous studies [44], concurrent with bacterial injection (Fig. 4A). While CQ treatment alone or in combination with mock vector-carrying S. Gallinarum revealed some effect due to its anti-cancer activity, the combination of CQ and PelB-ADI-expressing bacteria exhibited greatly enhanced tumor growth inhibition compared to the bacteria expressing PelB-ADI alone (Fig. 4B). Daily chloroquine administration throughout the treatment period did not adversely affect animal weight (Fig. 4C). These findings suggest the potential of combined bacterial therapy and CQ to enhance therapeutic efficacy in cancer treatment.

Stability issues with certain anticancer proteins, such as ADI, are often addressed through pegylation or encapsulation in nanoparticles [45, 46]. In this study, we demonstrated that the short half-life of ADI can be effectively overcome by expressing it in situ using tumor-seeking bacteria (Fig. 3). Notably, bacteria were injected only once via the intravenous route. A sufficient amount of ADI was expressed using the constitutive TAC promoter, surpassing the efficacy of the protein injected directly into the tumor tissue (IT injection) (Fig S2). This suggests that anticancer proteins with similar stability problems could benefit from being expressed by tumor-seeking bacteria in situ.

In bacterial cancer therapy, where bacteria are utilized as an anti-cancer protein delivery system, a common challenge is the secretion of the cargo protein rather than its expression. For ADI to operate in the tumor microenvironment (TME) and deplete arginine, it must be secreted from the bacteria. Bacterial protein secretion systems, essential for transporting proteins across cell membranes and releasing them extracellularly, include various mechanisms, with the Type II secretion system and the PelB system being particularly noteworthy [47]. This system involves a multi-step process, starting with signal sequence recognition, guiding proteins to the Sec translocon for initial translocation across the inner membrane. The Type II secretion system, characterized by a secretin complex in the outer membrane, assembles pseudopili extending from the inner to the outer membrane, facilitating the translocation of folded proteins [48]. The PelB signal sequence, derived from pectate lyase B of Erwinia carotovora, is frequently used in genetic engineering to direct the secretion of heterologous proteins in Gram-negative bacteria [49]. The engineered use of signal sequences like PelB enhances the biotechnological potential of bacteria in secreting specific proteins. With our construct, we detected that approximately 10 percent of the PelB-ADI (~ 70 IU) expressed was secreted as enzymatically active protein, which appeared to be sufficient to confer anti-tumor activity (Fig. 1 and S1).

Arginine deprivation has been shown to suppress the mammalian target of rapamycin complex 1 (mTORC1) and p70S6K, which are needed for protein synthesis and cell proliferation, leading to the inactivation of the PI3K/Akt pathway for cell cycle progression [50, 34]. The suppression of mTOR results in aggressive autophagy and diminished synthesis of proteins, lipids, and nucleotides [34, 51]. Cancer cells deficient in ASS1 are sensitive to arginine deprivation by ADI and consequently undergo autophagy as an initial survival response [34]. Our study highlights the therapeutic potential of combining S. Gallinarum expressing PelB-ADI with chloroquine (CQ) in cancer treatment. CQ inhibits autophagy by impairing the fusion of autophagosomes with lysosomes [52]. The enhanced tumor cell inhibition observed with the combined administration of CQ and PelB-ADI-expressing bacteria suggests a promising approach for improving therapeutic outcomes in cancer treatment through nutrient deprivation (Fig. 4). Importantly, the absence of adverse effects on animal weight during daily administration of CQ alongside bacterial therapy underscores the safety profile of this combination approach. These findings offer valuable insights into the development of novel therapeutic strategies for combating cancer and warrant further investigation into the underlying mechanisms driving the observed additive effect. Future studies exploring the clinical applicability of this combination therapy and its potential for translation into clinical practice are warranted.

The challenges associated with ADI can be addressed by its constitutive expression in tumor-targeting bacteria. This approach ensures a sufficient supply of ADI in the tumor microenvironment (TME), where the immune response to ADI is minimized.

Materials

Common chemicals were of analytical grade and ordered from Sigma-Aldrich Corporation, Carl Roth GmbH & Co. KG or Merck KGaA. Cloning enzymes and chemicals were ordered from New England Biolabs (Ipswich, MA).

Strain construction

S. Gallinarum SG4021 was re-isolated as follows: The original wild-type strain, SG3001 [53], was injected intravenously into a CT26 tumor-bearing BL/6 mouse. After three days of post-infection, the tumor tissue was removed from the infected mouse, and the S. Gallinarum strain grown within it was re-isolated. This re-isolated strain was termed SG4021. DNA sequencing results revealed that SG4021 was identical to SG3001. Construction of attenuated S. Gallinarum strains based on SG4021 involved several genetic modifications using the method developed by Datsenko and Wanner (2000) [54]. The ppGpp deletion mutant was constructed by sequentially inserting relA::kan^R and spoT::cat^R into the genome of SG4021. Similarly, the ssrAB deletion mutant was created by inserting ssrAB::kan^R into the SG4021 genome, and the Gifsy 2 prophage deletion mutant was developed by inserting Gifsy 2 coded gene::cm^R. To generate the ΔrelA, ΔspoT, ΔssrAB deletion mutant, antibiotic resistance genes were removed using pCP20, a helper plasmid expressing FLP recombinase. This resulted in the strain SG4041 (ΔrelA, ΔspoT, ssrAB::kan^R) following the insertion of ssrAB::kan^R into the genome of the ppGpp deletion mutant SG4023. Subsequently, SG4043 (ΔrelA, ΔspoT, ssrAB::kanR, Prophage::cm^R) was produced by inserting Gifsy 2 coded gene::cm^R into SG4041, with unnecessary antibiotic resistance genes removed using pCP20 to yield SG4044 (ΔrelA, ΔspoT, ΔssrAB, ΔProphage). Further modification led to SG4047 (ΔrelA, ΔspoT, ΔssrAB, ΔProphage, glmS::kan^R) by inserting glmS::kan^R into SG4044, followed by the removal of antibiotic resistance genes with pCP20, resulting in SG4048 (ΔrelA, ΔspoT, ΔssrAB, ΔProphage, ΔglmS). Finally, to produce a comprehensive deletion mutant strain, deletions of relA, spoT, ssrA, ssrB, Gifsy 2 prophage, glmS, and three antibiotic resistance genes (aadA1, aac(3)-Via, and sul1) were incorporated. The three antibiotic resistance genes::cm^R cassettes were introduced into the genome of SG4048, and the cm^R cassettes were subsequently removed using pCP20, resulting in the attenuated strain SGKS1004 (ΔrelA, ΔspoT, ΔssrAB, ΔProphage, ΔglmS, ΔaadA1, Δaac(3)-Via, and Δsul1) (Table 1). Primers used are listed in Supplementary Table 1.

Table 1

Bacterial strains generated in this study.
Strain	Description	Reference or source
S. Gallinarum
SG4021	Wild type-clinical isolate	This work.
SG4023	ΔrelA,ΔspoT	This work
SG4030	ΔrelA,ΔspoT, glmS:: kan^R	This work
SG3005	ΔssrAB:: kan^R	This work
SG4041	ΔrelA,ΔspoT, ssrAB:: kan^R	This work
SG4042	Gifsy 2 prophage:: cm^R	This work
SG4043	SG4041, ΔrelA,ΔspoT, ssrAB:: kan^R, Gifsy 2 prophage:: cm^R	This work
SG4044	SG4043, ΔrelA,ΔspoT, ΔssrAB, ΔGifsy 2 prophage	This work
SG4045	SG4041, ΔrelA, ΔspoT, ΔssrAB	This work
SG4046	SG4045, ΔrelA,ΔspoT, ΔssrAB, Gifsy 2 prophage:: cm^R	This work
SG4047	SG4044, ΔrelA,ΔspoT, ΔssrAB, ΔGifsy 2 prophage, glmS:: kan^R	This work
SG4048	SG4047, ΔrelA,ΔspoT, ΔssrAB, ΔGifsy 2 prophage, ΔglmS	This work
SGKS1004	SG4048, ΔrelA,ΔspoT, ΔssrAB, ΔGifsy 2 prophage, ΔglmS, ΔaadA1, Δaac(3)-Via, Δsul1	This work
SG1250	SGKS1004, ΔrelA,ΔspoT, ΔssrAB, ΔGifsy 2 prophage, ΔglmS, ΔaadA1, Δaac(3)-Via, Δsul1, pTAC_PelB::ADI	This work

Construction of expression plasmids

For the construction of the plasmid expressing and secreting the arcA gene encoding Arginine Deiminase (ADI) from genomic DNA of Lactococcus lactis ssp. lactis (ATCC 7962), we initially cloned the ADI gene using the following primer set: 5'-CGCGGATCCGAACAATGGAATTAATGTTAACTCAGAAATTGGGAAA-3' (forward) and 5'-GCTCTAGACTACTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCCAAATCTTCACGCCAAAGTGGTTG-3' (reverse). The gene was then inserted into the BamHI and XbaI sites of the pET20b vector, which contains the PelB signal sequence in front of the insert, resulting in PelB-ADI. Subsequently, this construct was amplified again using the primer set: 5'-CGGGGTACCATGAAATACCTGCTGCCGACC-3' (forward) and 5'-GCTCTAGACTACTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATAATCACCGTCATGGTCTTTGTAGTCCAAATCTTCACGCCAAAGTGGTTG-3' (reverse), and then inserted into the KpnI/XbaI sites of the pTAC plasmid, yielding pTAC_PelB::ADI. ΔppGpp Salmonella Gallinarum SGKS1004 cells were transformed with this plasmid. For protein purification purposes, ADI was inserted into the pET21a(+) vector using the primer set: 5'-CGCGGCTAGCATGAACAATGGAATTAATGTTAACTCAG-3' (forward) and 5'-CATTCTCGAGCAAATCTTCACGCCAAAGTG-3' (reverse). The gene was then inserted into the NheI/XhoI site of the plasmid, resulting in pET21a(+)_ADI. E. coli BL21 cells were transformed with this plasmid.

Purification of ArcA

Protein purification and manipulation steps were conducted either on ice or at 4°C, unless specified otherwise. The pre-equilibrated HisTrap HP column 5ml (GE Healthcare, USA) in 50mM KPi, pH 7.0, with 200mM NaCl containing 10mM imidazole and 10% (v/v) glycerol (buffer A) was employed for the initial phase. Following sonication-induced cell lysis, the resulting cell lysate was introduced to the HisTrap HP column and subjected to washing with 5-column volumes of buffer A. Elution of proteins was accomplished using 10-column volumes of buffer A with a gradient of 500mM imidazole. The fractions with the highest concentration were then subjected to Superdex 200 Increase 10/300 GL size-exclusion column (GE Healthcare, USA) chromatography in 50 KPi, pH 7.0, with 100mM NaCl supplemented with 10% (v/v) glycerol. The fractions containing the target protein were combined, assessed through 12% SDS-PAGE gel electrophoresis, and subsequently aliquoted at concentrations of 1–2 mg mL-1 in 100 µl volumes. These aliquots were flash-frozen and stored at -80°C for future use.

Measurement of arginine deiminase enzymic activity

The quantification of ADI activity was conducted by assessing the production of L-citrulline from L-arginine, following established protocols [33]. In summary, the catalytic reaction was initiated by incubating 0.1 ml ADI (secreted, cytosolic, or purified protein) with 10 mM L-arginine in 100 mM Potassium phosphate buffer (pH 7.2) in a final volume of 0.5 ml, maintaining the reaction at 37°C for 1 hour. To halt the reaction, 0.25 ml of a 1:3 mixture (v/v) of H₂SO₄ and H₃PO₄ was added. Two hundred fifty microliters of 3% diacetyl monoxime were pipetted into each reaction tube. The measurement of the resultant-colored reaction product, formed from the interaction of L-citrulline and diacetyl monoxime, facilitated the determination of the amount of L-citrulline generated during the incubation period. This robust methodology ensured accurate quantification of ADI activity in the experimental setup. One international unit (IU) of ADI is defined as the amount of enzyme that released 1 micromole of citrulline per minute at 37°C. Specific activity was defined as total activity (IU) / protein concentration (mg).

Cell lines and cell culture

Human embryo kidney cell 293 [HEK-293], mouse breast cancer cell line 4T1, mouse colon carcinoma cell line CT26, and mouse melanoma cell line B16-F10 were all purchased from the American Type Culture Collection (ATCC). All cell lines were maintained in the recommended medium (HyClone, Logan, USA) containing 10% heat-inactivated fetal bovine serum (HyClone, Logan, USA) and 1% penicillin/streptomycin (HyClone, Logan, USA) in a humidified (37°C, 5% CO2) incubator. Plastic wares for cell culture were obtained from BD Bioscience (Franklin Lakes, NJ).

Western Blot Analysis

To assess the expression of the ADI protein in vitro, overnight cultures of ΔppGpp S. Gallinarum (SGKS1004)³¹ carrying either the mock vector or the plasmid pTAC_PelB::ADI in ΔppGpp ΔglmS S. Gallinarum were subcultured in LB broth (1:100) and allowed to grow overnight. Bacterial pellets were collected and sonicated in 1X PBS at designated time points. The resulting supernatants were filtered through 0.2 µm filters (GVS Filter Technology, USA). For animal experiments, SGKS1004 (1 X 10⁸ CFU/mouse) carrying pTAC_PelB::ADI or mock vector was injected into mice with CT26 tumors via the tail vein when tumors reached approximately 100 mm³. Tumors were excised at specified time points and homogenized in 1 mL RIPA buffer (Intron Biotechnology, Seongnam, Republic of Korea), supplemented with 1X Protease & Phosphatase Inhibitor Cocktail and 1X EDTA (Thermo Fisher Scientific). The filtered supernatants were combined with SDS sample buffer, boiled at 95 ºC for 10 min, loaded onto 12% SDS-PAGE gels, and transferred to nitrocellulose membranes (GE Healthcare, Solingen, Germany, cat no. 10600002). ADI expression was evaluated through Western blot analysis using a primary polyclonal antibody against the Anti-DDDDK tag (abcam, ab1162, antirabbit, 1:5000). Spontaneous bacterial lysis was examined by detecting GroEL with a specific antibody (Sigma-Aldrich, G6532, antirabbit, 1:5000). β-actin levels were determined using a specific rabbit polyclonal antibody (Abcam, ab8227, 1:2000). Expression of Argininosuccinate synthase 1 from cancer cell lines was detected using a primary mouse monoclonal IgG2b ASS1 antibody (Santa Cruz Biotechnology, Dallas, TX, USA, E12, 1:5000). Membranes were incubated with primary antibodies diluted in 4% skim milk in TBST at 4 ºC overnight, followed by incubation in mouse antirabbit IgG-HRP (Santa Cruz Biotechnology, Dallas, TX, USA, sc-2357, 1:2000) for 1 hour at room temperature. Protein visualization was achieved using ECL (Thermo Scientific, REF. 32209).

Cell proliferation assay

Cell proliferation was evaluated through the MTT uptake assay. Cells were seeded at a density of 5 × 10³ cells per well in a 96-well plate with 200 µL of the appropriate growth medium and cultured overnight. Following this, cells were exposed to varying concentrations of overnight culture media derived from S. Gallinarum (SGKS1004) carrying pTAC_PelB::ADI or an empty vector (mock) for 24 hours. After the treatment period, MTT solution (5 mg/mL) was added, and cells were incubated for an additional 2 hours. The reaction was halted by adding 100 µL of dimethyl sulfoxide (DMSO) per well. Absorbance readings were taken at 570 nm using a Varioskan LUX multimode microplate reader (Thermo Fisher Scientific, Cat. No. VLBLATD2), with DMSO as the blank and cells cultured in an untreated medium serving as the control group. The cell viability index was calculated using the formula ODsample/ODcontrol × 100%. Replication of each experimental condition was performed four times to ensure statistical validity and reproducibility.

Tumorigenicity in a mouse xenograft model

Female BALB/c mice aged six to eight weeks were sourced from Orient Bio (South Korea) and housed under pathogen-free conditions in compliance with institutional guidelines. CT26 murine colon carcinoma cells, totaling approximately 1 × 10⁶, were suspended in 1 X PBS and subcutaneously implanted into the flank of each mouse to initiate xenograft tumors. Upon reaching tumor volumes of 90–120 mm³, mice were randomly assigned to groups containing 5 to 8 animals each. Administration of either PBS, S. Gallinarum (SGKS1004) carrying pTAC_PelB::ADI, or an empty vector (mock) was performed intravenously at a dose of 1×10⁸ CFU/mouse. Tumor dimensions were gauged every two days. In the investigation of the anti-tumor effects of both purified ADI and ADI expressed from ΔppGpp S. Gallinarum, mice were subcutaneously injected with 1 × 10⁶ CT26 cells. Ten days post-implantation, mice underwent diverse treatment modalities, encompassing PBS, 2 IU ADI administered intratumorally, S. Gallinarum (mock), S. Gallinarum (mock) coupled with 2 IU ADI administered intratumorally, and S. Gallinarum containing the PelB-ADI plasmid. The purified enzyme, prepared in PBS, was administered at two-day intervals. Tumor dimensions were monitored bi-daily, and on the tenth day, mice were euthanized, and tumors were excised and weighed. For the combination study with CQ, the CT26-bearing mice were treated with PBS, chloroquine, mock, mock plus chloroquine, PelB-ADI, PelB-ADI plus chloroquine. The CQ was injected into mice intraperitoneally at 50mg/kg daily. Tumors were measured every other day.

Statistical analysis

Graphical representation and statistical analyses were performed utilizing GraphPad Prism version 8 (La Jolla, CA, USA). The data are presented as the mean ± standard error of the mean (SEM). Statistical significance was assessed through t-test or one- and two-way ANOVA. Values of p < 0.05 were considered statistically significant. Figures annotated with asterisks denote statistically significant differences between groups.

Acknowledgments

This research was supported by the Bio & Medical Technology Development Program of the National Research Foundation(NRF) funded by the Korean government (MSIT) (No. NRF-2020M3A9G3080282). M.Y. was supported by the World Institute of Kimchi (grant numbers: KE2403-1), funded by the Ministry of Science and ICT, Republic of Korea.

Author contributions

Conceptualization, Hyon E. Choy. and Hae-Ho Jeong.; methodology, Kwangsoo Kim.; data curation, Taner Duysak.; writing—original draft preparation, Taner Duysak .; writing—review and editing, Hyon E. Choy and Misun Yun; funding acquisition, Jae-Ho Jeong. All authors have read and agreed to the published version of the manuscript. All authors read and approved the final manuscript

DATA AVAILABILITY

The data and code underlying the findings of this study are available from the corresponding author on reasonable request.

Institutional Review Board Statement: The animal study protocol was approved by the Ethics Committee of Chonnam National University–Institutional Animal Use and Care Committee (CNU IACUC-H-2020-7).

Conflicts of interest

The authors declare no conflicts of interest

Mengesha A, Dubois L, Chiu RK, Paesmans K, Wouters BG, Lambin P, Theys J. Potential and limitations of bacterial-mediated cancer therapy. Front Biosci. 2007;12:3880-91.
Kramer MG, Masner M, Ferreira FA, Hoffman RM. Bacterial therapy of cancer: promises, limitations, and insights for future directions. Front Microbiol. 2018;9:16.
Kamta J, Chaar M, Ande A, Altomare DA, Ait‐Oudhia S. Advancing cancer therapy with present and emerging immuno‐oncology approaches. Front Oncol. 2017;7:64.
Murphy C, Rettedal E, Lehouritis P, Devoy C, Tangney M. Intratumoural production of TNFα by bacteria mediates cancer therapy. PloS one. 2017;12:e0180034.
Forbes NS. Engineering the perfect (bacterial) cancer therapy. Nat Rev Cancer. 2010;10:785‐794.
Nallar SC, Xu D‐Q, Kalvakolanu DV. Bacteria and genetically modified bacteria as cancer therapeutics: Current advances and challenges. Cytokine. 2017;89:160‐172.
Heimann DM, Rosenberg SA. Continuous intravenous administration of live genetically modified salmonella typhimurium in patients with metastatic melanoma. J Immunother. 2003;26:179‐180.
Nemunaitis J, Cunningham C, Senzer N, Kuhn J, Cramm J, Litz C, Cavagnolo R, Cahill A, Clairmont C, Sznol M. Pilot trial of genetically modified, attenuated Salmonella expressing the E. coli cytosine deaminase gene in refractory cancer patients. Cancer Gene Ther. 2003;10(10):737-44.
Thamm DH, Kurzman ID, King I, Li Z, Sznol M, Dubielzig RR, Vail DM, MacEwen EG. Systemic administration of an attenuated, tumor-targeting Salmonella typhimurium to dogs with spontaneous neoplasia: phase I evaluation. Clin Cancer Res. 2005;1;11(13):4827-34.
Song S, Vuai MS, Zhong M. The role of bacteria in cancer therapy–enemies in the past, but allies at present. Infect Agent Cancer. 2018;13:9.
Wang C, Hu Q, Shen H‐M. Pharmacological inhibitors of autophagy as novel cancer therapeutic agents. Pharmacol Res. 2016;105:164‐175.
Jia LJ, Wei DP, Sun QM, Huang Y, Wu Q, Hua ZC. Oral delivery of tumor‐targeting Salmonella for cancer therapy in murine tumor models. Cancer Sci. 2007;98:1107‐1112.
Nguyen VH, Min J‐J. Salmonella‐mediated cancer therapy: roles and potential. Nucl Med Mol Imaging. 2017;51:118‐126.
Felgner S, Kocijancic D, Frahm M, Heise U, Rohde M, Zimmermann K, Falk C, Erhardt M, Weiss S. Engineered Salmonella enterica serovar Typhimurium overcomes limitations of anti-bacterial immunity in bacteria-mediated tumor therapy. Oncoimmunology. 2017;16;7(2):e1382791.
Min JJ, Nguyen VH, Kim HJ, Hong Y, Choy HE. Quantitative bioluminescence imaging of tumor-targeting bacteria in living animals. Nat Protoc. 2008;3(4):629-36.
Delage B, Fennell DA, Nicholson L, McNeish I, Lemoine NR, Crook T, Szlosarek PW. Arginine deprivation and argininosuccinate synthetase expression in the treatment of cancer. Int J Cancer. 2010;15;126(12):2762-72.
Kuo MT, Savaraj N, Feun LG. Targeted cellular metabolism for cancer chemotherapy with recombinant arginine-degrading enzymes Abstract : Glycolysis TCA cycle. Oncotarget. 2010;1:246–251.
Xiong L, Teng JL, Botelho MG, Lo RC, Lau SK, Woo PC. Arginine Metabolism in Bacterial Pathogenesis and Cancer Therapy. Int J Mol Sci. 2016;11;17(3):363.
Joseph SC, Blackman BA, Kelly ML, Phillips M, Beaury MW, Martinez I, Parronchi CJ, Bitsaktsis C, Blake AD, Sabatino D. Synthesis, characterization, and biological activity of poly(arginine)-derived cancer-targeting peptides in HepG2 liver cancer cells. J Pept Sci. 2014;20(9):736-45.
Al-Koussa H, El Mais N, Maalouf H, Abi-Habib R, El-Sibai M. Arginine deprivation: a potential therapeutic for cancer cell metastasis? A review. Cancer Cell Int. 2020;6;20:150.
Bakshi N, Morris CR. The role of the arginine metabolome in pain: implications for sickle cell disease. J Pain Res. 2016;30;9:167-75.
Takaku H, Takase M, Abe S, Hayashi H, Miyazaki K. In vivo anti-tumor activity of arginine deiminase purified from Mycoplasma arginini. Int J Cancer. 1992;8;51(2):244-9.
Gupta V, Bhavanasi S, Quadir M, Singh K, Ghosh G, Vasamreddy K, Ghosh A, Siahaan TJ, Banerjee S, Banerjee SK. Protein PEGylation for cancer therapy: bench to bedside. J Cell Commun Signal. 2019;13(3):319-330.
Holtsberg FW, Ensor CM, Steiner MR, Bomalaski JS, Clark MA. Poly(ethylene glycol) (PEG) conjugated arginine deiminase: effects of PEG formulations on its pharmacological properties. J Control Release. 2002;23;80(1-3):259-71.
Zeng T, Zhang Y, Yan Q, Huang Z, Zhang L, Yi X, Chen J, He G, Yin Y. Construction and in vitro evaluation of enzyme nanoreactors based on carboxymethyl chitosan for arginine deprivation in cancer therapy. Carbohydr Polym. 2017;15;162:35-41.
Mauthe M, Orhon I, Rocchi C, Zhou X, Luhr M, Hijlkema KJ, Coppes RP, Engedal N, Mari M, Reggiori F. Chloroquine inhibits autophagic flux by decreasing autophagosome-lysosome fusion. Autophagy. 2018;14(8):1435-1455.
Kim JE, Kim SY, Lee KW, Lee HJ. Arginine deiminase originating from Lactococcus lactis ssp. lactis American Type Culture Collection (ATCC) 7962 induces G1-phase cell-cycle arrest and apoptosis in SNU-1 stomach adenocarcinoma cells. Br J Nutr. 2009;102(10):1469-76.
Munro S, Pelham HR. Use of peptide tagging to detect proteins expressed from cloned genes: deletion mapping functional domains of Drosophila hsp 70. The EMBO journal, 1984;3(13), 3087–3093.
Keen NT, Tamaki S. Structure of two pectate lyase genes from Erwinia chrysanthemi EC16 and their high-level expression in Escherichia coli. Journal of bacteriology, 1986;168(2), 595–606.
Lim D, Kim K, Duysak T, So E, Jeong JH, Choy HE. Bacterial cancer therapy using the attenuated fowl-adapted Salmonella enterica serovar Gallinarum. Mol Ther Oncolytics. 2023;2;31:100745.
Cashel M, Gentry DR, Hernandez VJ, Vinella D. The stringent response. In “Escherichia coli and Salmonella. Cellular and Molecular Biology” 2nd ed., eds. Neidhardt, FC, Curtiss, 1996;1458-1496.
Kim K, Jeong JH, Lim D, Hong Y, Yun M, Min JJ, Kwak SJ, Choy HE. A novel balanced-lethal host-vector system based on glmS. PLoS One. 2013;8(3):e60511.
Boyde TRC & Rahmatullah M. Optimization of conditions for the colorimetric determination of citrulline, using diacetyl monoxime. Anal Biochem 1980;107, 424–431.
Kim RH, Coates JM, Bowles TL, McNerney GP, Sutcliffe J, Jung JU, Gandour-Edwards R, Chuang FY, Bold RJ, Kung HJ. Arginine deiminase as a novel therapy for prostate cancer induces autophagy and caspase-independent apoptosis. Cancer Res. 2009;15;69(2):700-8.
Savaraj N, You M, Wu C, Wangpaichitr M, Kuo MT, Feun LG. Arginine deprivation, autophagy, apoptosis (AAA) for the treatment of melanoma. Curr Mol Med. 2010;10(4):405-12.
Wang Z, Shi X, Li Y, Fan J, Zeng X, Xian Z, Wang Z, Sun Y, Wang S, Song P, Zhao S, Hu H, Ju D. Blocking autophagy enhanced cytotoxicity induced by recombinant human arginase in triple-negative breast cancer cells. Cell Death Dis. 2014;11;5(12):e1563.
Bedoya V. Effect of chloroquine on malignant lymphoreticular and pigmented cells in vitro. Cancer Res. 1970;30(5):1262-75.
Inoue S, Hasegawa K, Ito S, Wakamatsu K, Fujita K. Antimelanoma activity of chloroquine, an antimalarial agent with high affinity for melanin. Pigment Cell Res. 1993;6:354–8.
Chen TH, Chang PC, Chang MC, Lin YF, Lee HM. Chloroquine induces the expression of inducible nitric oxide synthase in C6 glioma cells. Pharmacol Res. 2005;51:329–36.
Fan C, Wang W, Zhao B, Zhang S, Miao J. Chloroquine inhibits cell growth and induces cell death in A549 lung cancer cells. Bioorg Med Chem. 2006;1;14(9):3218-22.
Jiang PD, Zhao YL, Shi W, Deng XQ, Xie G, Mao YQ, Li ZG, Zheng YZ, Yang SY, Wei YQ. Cell growth inhibition, G2/M cell cycle arrest, and apoptosis induced by chloroquine in human breast cancer cell line Bcap-37. Cell Physiol Biochem. 2008;22(5-6):431-40.
White E. Deconvoluting the context-dependent role for autophagy in cancer. Nat Rev Cancer. 2012;26;12(6):401-10.
White E, Mehnert JM, Chan CS. Autophagy, Metabolism, and Cancer. Clin Cancer Res. 2015;15;21(22):5037-46.
Maes H, Kuchnio A, Peric A, Moens S, Nys K, De Bock K, Quaegebeur A, Schoors S, Georgiadou M, Wouters J, Vinckier S, Vankelecom H, Garmyn M, Vion AC, Radtke F, Boulanger C, Gerhardt H, Dejana E, Dewerchin M, Ghesquière B, Annaert W, Agostinis P, Carmeliet P. Tumor vessel normalization by chloroquine independent of autophagy. Cancer Cell. 2014;11;26(2):190-206.
Hussain Z, Khan S, Imran M, Sohail M, Shah SWA, de Matas M. PEGylation: a promising strategy to overcome challenges to cancer-targeted nanomedicines: a review of challenges to clinical transition and promising resolution. Drug Deliv Transl Res. 2019;9(3):721-734.
Elumalai K, Srinivasan S, Shanmugam A. Review of the efficacy of nanoparticle-based drug delivery systems for cancer treatment. Biomedical Technology, 2024;109–122.
Green ER, Mecsas J. Bacterial Secretion Systems: An Overview. Microbiol Spectr. 2016;4(1):10.1128/microbiolspec.VMBF-0012-2015.
Korotkov KV, Sandkvist M, Hol WG. The type II secretion system: biogenesis, molecular architecture and mechanism. Nat Rev Microbiol. 2012;2;10(5):336-51.
Lei SP, Lin HC, Wang SS, Callaway J, Wilcox G. Characterization of the Erwinia carotovora pelB gene and its product pectate lyase. J Bacteriol. 1987;169(9):4379-83.
Wang H, Li QF, Chow HY, Choi SC, Leung YC. Arginine deprivation inhibits pancreatic cancer cell migration, invasion and EMT via the down regulation of Snail, Slug, Twist, and MMP1/9. J Physiol Biochem. 2020;76(1):73-83.
Hsu PP, Kang SA, Rameseder J, Zhang Y, Ottina KA, Lim D, Peterson TR, Choi Y, Gray NS, Yaffe MB, Marto JA, Sabatini DM. The mTOR-regulated phosphoproteome reveals a mechanism of mTORC1-mediated inhibition of growth factor signaling. Science. 2011;10;332(6035):1317-22.
Zhou J, Tan SH, Nicolas V, Bauvy C, Yang ND, Zhang J, Xue Y, Codogno P, Shen HM. Activation of lysosomal function in the course of autophagy via mTORC1 suppression and autophagosome-lysosome fusion. Cell Res. 2013;23(4):508-23.
Jeong JH, Song M, Park SI, Cho KO, Rhee JH, Choy HE. Salmonella enterica serovar gallinarum requires ppGpp for internalization and survival in animal cells. J Bacteriol. 2008 Oct;190(19):6340-50.
Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A. 2000 Jun 6;97(12):6640-5.

Graphical Abstract is not available with this version

Graphical abstract figure: Anti-cancer effect of Salmonella Gallinarum expressing an arginine deiminase (ADI) on arginine-dependent tumors in situ.

There is NO conflict of interest to disclose.

SupplementaryData.docx

Download PDF

Journal Publication

published 25 Sep, 2024

Read the published version in Oncogene →

Editorial decision: revise
08 Aug, 2024
Review #2 received at journal
07 Aug, 2024
Review #1 received at journal
06 Aug, 2024
Reviewer #2 agreed at journal
24 Jul, 2024
Reviewer #1 agreed at journal
24 Jul, 2024
Reviewers invited by journal
24 Jul, 2024
Submission checks completed at journal
24 Jul, 2024
First submitted to journal
23 Jul, 2024
Unknown event
16 Jul, 2024
Editor assigned by journal
16 Jul, 2024

You are reading this latest preprint version

Enhanced anti-cancer efficacy of arginine deaminase expressed by tumor-seeking Salmonella Gallinarum

Status:

Journal Publication

Version 1

Abstract

Figures

INTRODUCTION

RESULTS

Anti-cancer effect of ADI on cancer cell lines in vitro

Enhancement of therapeutic effect of ADI depletion in situ by co-treatment with chloroquine

DISCUSSION

CONCLUSIONS

MATERIALS AND METHODS

Materials

Strain construction

Construction of expression plasmids

Purification of ArcA

Measurement of arginine deiminase enzymic activity

Cell lines and cell culture

Western Blot Analysis

Cell proliferation assay

Tumorigenicity in a mouse xenograft model

Statistical analysis

Declarations

References

Graphical Abstract

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1