First report of natural infection with infectious spleen and kidney necrosis virus (ISKNV) associated with disease outbreaks in two gourami species (Trichopodus spp.)

doi:10.21203/rs.3.rs-4774773/v1

Download PDF

Research Article

First report of natural infection with infectious spleen and kidney necrosis virus (ISKNV) associated with disease outbreaks in two gourami species (Trichopodus spp.)

https://doi.org/10.21203/rs.3.rs-4774773/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Infectious spleen and kidney necrosis virus (ISKNV) has broad host range and pose significant threat to aquaculture species. Herein, we report two disease outbreaks in snakeskin gourami (Trichopodus pectoralis) in Thailand, marked by skin hemorrhage, scale loss, internal organ necrosis, and a mortality rate exceeding 60%. Additionally, three spot gourami (Trichopodus trichopterus) cultured in the same ponds along with snakeskin gourami were found to be affected and tested positive for the virus. Histopathological examination revealed extensive necrosis of hematopoietic tissues in the kidneys and spleen, accompanied by the presence of numerous megalocytic cells in both fish species. Real-time PCR assays, using protocolstargeting major capsid protein (MCP) gene in a broad range of Megalocytivirus genotypes, confirmed the presence of ISKNV in the infected fish. Furthermore, molecular and phylogenetic analyses based on the MCP gene (1,362 bp) and the adenosine triphosphatase (ATPase) gene (720 bp) revealed that the ISKNV strains in gourami and other fish hosts were closely related, suggesting possible cross-species transmission. This report extends the host range of ISKNV and highlights the need to prevent the spread of this virus across species boundaries. Further research is needed to understand the pathogenicity and transmission routes of the virus, gain insights into its epidemiology, and develop strategies to mitigate disease outbreaks.

ISKNV

Megalocytivirus

Trichopodus spp.

Histophathology

Genotypic analysis

This report documents the first occurrence of fatal ISKNV infections in two gourami species (Trichopodus spp.).
The virus was identified based on pathological, molecular and phylogenetic evidence.
This study expands the host range of ISKNV and emphasizes the importance of preventing its spread across species boundaries.

Megalocytiviruses, belonging to the family Iridoviridae, cause high mortality in various teleost hosts and have a global distribution in freshwater, brackish, and marine environments (Chinchar et al., 2017). These viruses pose a significant threat to global aquaculture, impacting both wild and farmed fish species (Kurita & Nakajima, 2012; Subramaniam et al., 2012). Within the genus Megalocytivirus, two primary species have been identified: infectious spleen and kidney necrosis virus (ISKNV) and scale drop disease virus (SDDV) according to the latest virus taxonomy of the International Committee on Taxonomy of Viruses (https://ictv.global/taxonomy). Genetic characterization, especially using the gene encoding the major capsid protein (MCP), is essential for understanding the diversity and relatedness of Megalocytiviruses (Huang et al., 2011; Song et al., 2008). The MCP gene is highly conserved and serves as a reliable marker for classifying Megalocytivirus isolates (Fu et al., 2011; Tsai et al., 2020). Additionally, genes encoding adenosine triphosphatase (ATPase), DNA polymerase, and methyltransferase provide complementary genetic information (Kerddee et al., 2021; Kurita & Nakajima, 2012; Whittington et al., 2010). Genetic analyses based on the MCP and ATPase genes of ISKNV have identified three main genotypes: ISKNV, red seabream iridovirus (RSIV), and turbot reddish body iridovirus (TRBIV) (Ayiku et al., 2024; Fusianto et al., 2023; Kerddee et al., 2021). Typically, SDDV can be distinguished from other Megalocytivirus infections by its unique external clinical signs (de Groof et al., 2015; Girisha et al., 2021; Senapin et al., 2018).

The infectious spleen and kidney necrosis virus (ISKNV) is a significant pathogen that causes lethal systemic infections, leading to mass mortality in various fish species and substantial economic losses, particularly in Asian aquaculture (Kurita & Nakajima, 2012; Machimbirike et al., 2019; Qin et al., 2023; Subramaniam et al., 2012). Previous studies have shown that more than 50 cultured and wild marine fish species are susceptible to ISKNV infections (Wang et al., 2007). This susceptibility is widespread and also affects freshwater and brackish water food fish species such as barramundi (Lates calcarifer), grouper (Epinephelus spp.) and tilapia (Oreochromis spp.) (Ayiku et al., 2024; Dong et al., 2017; Figueiredo et al., 2022; Fusianto et al., 2021; Kerddee et al., 2021; Ramírez-Paredes et al., 2021; Zhu et al., 2021). Additionally, ISKNV has been detected in a variety of ornamental fish, including zebrafish (Danio rerio), guppies (Poecilia reticulata), Siamese fighting fish (Betta splendens), goldfish (Carassius auratus) and koi carp (Cyprinus carpio koi) (Baoprasertkul & Kaenchan, 2019; Bermúdez et al., 2018; Girisha et al., 2021). While ISKNV is well-documented in various fish species, including certain gourami such as the giant gourami (Osphronemus goramy) and dwarf gourami (Colisa lalia) (Sudthongkong et al., 2002; Sukenda et al., 2020), infections in gourami species (Trichopodus spp.) have not yet been reported. Gourami species, including the snakeskin gourami (Trichopodus pectoralis) and the three spot gourami (Trichopodus trichopterus), are popular both in aquaculture and as ornamental fish. These species are native to the Mekong Basin and have been introduced to several countries, including Malaysia, India, and Indonesia (Rainboth, 1996). The snakeskin gourami is widely distributed throughout Southeast Asia and is considered as an important candidate for aquaculture in the region (Dinh-Hung et al., 2023a; Dinh-Hung et al., 2023b). In Thailand, it is among the top five freshwater fish farmed in aquaculture (FAO, 2024). At the same time, the three spot gourami, known in the aquarium trade for its many varieties, is not only a popular ornamental species but also serves as an edible fish in its native region, underlining its dual roles in aquaculture and the aquarium trade (Maddern, 2022). Despite its relatively minor commercial importance as a food fish in its native range, the species is also farmed, reflecting its versatile contribution to finfish industries (IUCN, 2023).

This study presents the first documented cases of natural ISKNV infections in two gourami species (Trichopodus spp.) associated with fatal outbreaks. Identification of the virus was based on pathological, molecular, and phylogenetic evidence. These findings underscore the significant threat posed by the spread of ISKNV across species boundaries and emphasize the urgent need for effective control strategies to combat this emerging disease in the aquaculture sector. The spread of ISKNV to gourami species complicates the epidemiological landscape and necessitates comprehensive surveillance and management practices to protect susceptible fish populations.

2.1. Fish and case history

In February and March 2022, two separate outbreaks of above-average mortality in snakeskin gourami (T. pectoralis) occurred at local commercial fish farms in Thailand. The first outbreak affected 3-month-old fish (mean weight = 98.56 ± 10.00 g, mean total length = 17.25 ± 0.78 cm) reared in earthen ponds. Concurrently, samples from three spot gourami (T. trichopterus), also housed in the same ponds originally intended for culturing snakeskin gouramis, exhibited similar symptoms, indicating an overlap of infections. It is noteworthy that commercial farms exclusively breeding three spot gourami are uncommon in Thailand. The incidental presence of this species alongside snakeskin gourami in these ponds likely resulted from shared natural breeding practices. Typically, broodstock are introduced into the ponds for natural spawning, and after 45 to 60 days, the fry, which may include both species, are harvested. Additionally, operational practices at the hatchery include a grading process before selling snakeskin gourami, during which three gourami are often inadvertently released back into the ponds, fostering a mixed-species environment. This practice has inadvertently led to the cohabitation of snakeskin gourami with other fish species, including three spot gourami, within these commercial aquaculture systems.

The second outbreak, which occurred in March 2022, affected fingerling snakeskin gourami (weight 0.3–0.5 g). Significant mortality was observed in these fish following transfer from the hatchery to the nursery ponds. Historically, these fingerlings were sourced from a hatchery where male and female broodstock, cultured in earthen ponds, were allowed to mate and breed naturally. The eggs were spawned in natural bubble nests created by the males in the same pond. The offspring were harvested at 45 days old, at a size of approximately 4.5 cm, and then transferred to nursery ponds. Initially, the fingerlings were housed in nets (hapas, 5×5×1.5 m in size) in earthen ponds upon arrival. Abnormal mortality occurred within 48 hours of transfer from the hatchery, so the fish were relocated to concrete tanks (2×4×1 m) with aeration for supportive treatment and monitoring.

2.2. Sample collection, DNA extraction and histopathology examination

Representative infected fish were obtained for this study in compliance with the standards established by the Animal Welfare Committee of Kasetsart University (approval no. ACKU65-FIS-001). Moribund snakeskin gourami and three spot gourami were subjected to routine necropsy, and tissue samples (liver, kidney, and spleen) were collected for histopathology and molecular analysis. Two sets of samples were collected from each moribund fish: one set was preserved in 90% ethanol for molecular diagnosis and the other in 10% neutral buffered formalin for histopathology. Pooled tissues (liver, kidney, and spleen, ≤ 10 mg each) per fish from the ethanol-preserved samples were subjected to DNA extraction using a conventional sodium dodecyl sulfate/proteinase K-containing lysis solution, followed by phenol/chloroform extraction and ethanol precipitation (Meemetta et al., 2020). The purity and concentration of DNA were measured using the NanoDrop (Thermo Fisher Scientific, USA) and adjusted to 100 ng/µL with nuclease-free water.

Following dissection, tissue samples (snakeskin gourami, n = 5; and three spot gourami, n = 3 per farm) were preserved in 10% neutral buffered formalin. Samples were transferred to 70% ethanol after 24 hours and then processed for routine histopathology analysis. Tissue samples were embedded in paraffin, sectioned into 5 µm slices, and stained with hematoxylin and eosin (H&E). The slides were examined and photographed using an Olympus BX51 digital light microscope.

2.3. Real-time PCR assays for universal screening of Megalocytivirus

Using extracted DNA as a template from adult snakeskin gourami (n = 5; farm 1), three spot gourami (n = 3, farm 1) and fingerling snakeskin gourami (n = 3; farm 2), a real-time PCR assay was performed for the universal detection of Megalocytivirus across multiple genotypes. Real-time PCR assay, Kawato-1 was used for the detection of a broad range of Megalocytivirus genotypes, as previously described by Kawato et al. (2021) with minor modifications. Briefly, the reaction mixture contained 1X iTaq Universal Probes Super-mix (Bio-Rad, USA), 2 µL DNA template, 900 nM forward and reverse primers (Meg-MCP160F and Meg-MCP349R) and 250 nM of the RSIV-MCP239P probe in a total volume of 20 µL. Additionally, a SYBR Green-based real-time PCR assay (Sriisan et al., 2018) highly specific for detecting SDDV was performed using the same set of DNA. The primers, qSDDV-MF and qSDDV-MR were used to amplify the MCP gene of the SDDV genome. Each 20 µL reaction contained 200 ng of extracted DNA, 1× PCRBIO buffer (that contained 3 mM MgCl₂, 1 mM dNTPs, and the manufacturer's amplifiers and stabilizers), 0.25 U PCRBIO Taq polymerase (PCR Biosystems), and 200 µM of each primer. The negative control reaction contained no DNA template and the positive control contained genomic DNA extracted from barramundi naturally infected with the respective viral pathogens, ISKNV and SDDV. The PCR amplifications were performed using a Bio-Rad CFX Connect real-time PCR System. A detailed information on the primers, probes, thermocycling conditions and product sizes can be found in Table 1.

Table 1

The primers, probes and cycling conditions were used for the detection and confirmation of ISKNV in this study.
No	Primer/probe	Sequence (5’-3’)	Amplicon size (bp)		Cycling condition (Temp, time)			Cycles		Reference
					Initial Denaturation	Denaturation	Annealing/ Extension
1	Meg-MCP160F	TCAAAACAGACTGGCCATGC		190	95°C, 10 min	95°C, 15 sec	64°C, 60 sec	40	(Kawato et al., 2021)
	Meg-MCP349R	TAAATGACACCGACACCTCCTC
	RSIV-MCP239P	FAM-TGTGGCTGCGTGTTAAGATCCCCTCCA-BHQ1
2	qSDDV-MF	GGACAAGAATTTAGCGTGGTTGTG		121	95°C, 3 min	95°C, 3 sec	63°C, 30 sec	35	(Sriisan et al., 2018)
	qSDDV-MR	TGTCGGTCCATCTTATGCTTGAAT
3	MMCP-F	ATGTCTGCRATCTCAGGTG		1362	95°C, 5 min	95°C, 3 sec	58°C, 50 sec	35	(Huang et al., 2011)
	MMCP-R	TYACAGGATAGGGAAGCCTG
4	MATPase-F	ATGGAAATCMAAGAGTTGTCCYTG		720	95°C, 5 min	95°C, 3 sec	58°C, 50 sec	35	(Huang et al., 2011)
	MATPase-R	TTACRCCACGCCAGCCTTGTA

2.4. Sequence analysis of viral MCP and ATPase genes.

The positive samples for Megalocytivirus from the real-time PCR assay was selected for sequence analysis, targeting the MCP and ATPase genes. The nucleotide sequence of the primers are described in Table 1, and the PCR conditions were same as described previously (Huang et al., 2011). After agarose gel electrophoresis, the amplicons were purified using the NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Japan), following the manufacturer’s instructions. The purified DNA amplicons were then subjected to DNA sequencing using a barcode-tagged sequencing technique (Celemics, Inc., South Korea). The MCP and ATPase genes from these samples were compared with those of other members of the genus Megalocytivirus, including ISKNV, RSIV, and TRBIV. Multiple sequence alignment and phylogenetic analysis were performed using MEGA11 software, version 11.0.11 (Tamura et al., 2021). The nucleotide sequences were aligned using ClustalW, and a phylogenetic tree was constructed using the Neighbor-Joining method with the best-fit model of K2 + G and 1000 bootstrap replicates.

3.1. Infection data and pathology findings

The gross lesions observed in snakeskin gourami and three spot gourami fish from two separate outbreaks were very similar although the severity varied among individual fish. The infected fish showed symptoms such as lethargy, loss of appetite, abnormal swimming, and breathing difficulties, often gasping for air at the surface. The moribund fish displayed external lesions, including skin hemorrhages, scale loss, and scale protrusion (Fig. 1A, 1B). Internally, the most prevalent lesions were swelling of the spleen and severe necrosis of the visceral organs, accompanied by ascitic fluid (Fig. 1C). In the first outbreak (Farm 1), to mitigate mortalities supportive treatments were applied including decontamination and a 7-day course of antibiotics with oxytetracycline (OTC) at 200 mg/g active ingredient, administered via feed at a dosage of 5 g OTC per 1 kg of feed. Despite these disease control measures, there was no noticeable reduction in mortality. The mortality rate rapidly increased and eventually reached 60% in this group of fish within two weeks of the disease onset. Concurrently, samples from three spot gourami found on the same farm also exhibited similar symptoms.

It is worth noting that to avoid any chance of false identification of the two fish species that have lot of similarities in appearance, 18S rRNA gene was amplified and sequenced (data not shown). Representative 18S rRNA sequences of the three spot gourami fish have been deposited in the GenBank database (https://www.ncbi.nlm.nih.gov/genbank/) under the accession number PP837837. The sequence data ensured that we observed similar clinical signs in two different species of gourami. Additionally, despite attempted treatments with either 20 ppm formalin or 10 ppt saline, and daily replacement of 50% of the water, Farm 2 experienced a mortality rate of 75% within two weeks of the first death in the second outbreak (Fig. 1D).

Histopathological manifestations included severe hemorrhage, inflammatory cell infiltration, melanocyte accumulation, and extensive necrosis of the kidneys and spleen (Fig. 2). Notably, characteristic microscopic lesions indicative of viral infections, particularly the presence of basophilic megalocytic cells (also known as hypertrophied cells), were identified in these tissues (arrows in Fig. 2C). Such histological changes are recognized as hallmark of infection by Megalocytiviruses.

3.2. Viral identification

The real-time PCR successfully amplified the target when primers targeting the Megalocytivirus MCP gene were used with DNA isolated from two gourami species from two farms (Fig. 3A, Table 2). However, efforts to amplify SDDV from the same DNA samples were not successful (Fig. S1). In order to confirm the initial findings, the MCP and ATPase genes were amplified from samples that tested positive for Megalocytivirus by conventional PCR (see Fig. 3B). One selected representative amplicon from each fish species, snakeskin gourami (T. pectoralis) and three spot gourami (T. trichopterus) was sequenced. The nucleotide sequences of the nearly complete MCP genes (1311 bp for the snakeskin gourami and 1335 bp for the three spot gourami) were submitted to the GenBank database under accession numbers OR999348 and OR999349, respectively. Similarly, the consensus sequences of the nearly complete ATPase genes (700 bp for the snakeskin gourami and 688 bp for the three spot gourami) were also submitted under accession numbers OR999350 and OR999351, respectively. BLAST analysis of the MCP and ATPase gene sequences indicated that ISKNV sequence derived from snakeskin gourami and three spot gourami these are identical (100% nucleotide identity, e = 0, and 100% query cover) to several ISKNV sequences available in the NCBI database.

Table 2

Details of the fish samples examined in this study.
Farm	Fish	Length	Collection date	Tissue	ISKNV real-time PCR (positive/tested samples)	SDDV real-time PCR
1	Snakeskin gourami	~ 17 cm	Feb 2022	Liver/Kidney	4/5 (Ct = 27.99–32.87)	0/3
1	Three spot gourami*	~ 13 cm	Feb 2022	Liver/Kidney	3/3 (Ct = 24.65–29.26)	0/3
2	Snakeskin gourami*	~ 4 cm	Mar 2022	Liver/Speen/Kidney	3/3 (Ct = 25.84–30.16)	0/3
*, Samples subjected to MCP and ATPase sequencing

3.3. Phylogenetic analysis

Phylogenetic trees based on the MCP and ATPase genes of selected ISKNV, RSIV, and TRBIV (members of the genus Megalocytivirus) are shown in Fig. 4. In both the MCP-based and ATPase-based trees, ISKNV isolates from the current study clustered in clade genotype I with ISKNV isolates originating from Thailand, China, Indonesia, and Taiwan.

This study documents the first natural infections of ISKNV in gourami species, expanding the list of susceptible species and highlighting the extensive host range of the virus. These findings, combined with previous reports, confirm that ISKNV infects a wide array of freshwater and marine fish, including economically significant species such as barramundi, grouper, and tilapia (Dong et al., 2017; Figueiredo et al., 2022; Fusianto et al., 2021; Kerddee et al., 2021; Ramírez-Paredes et al., 2021; Zhu et al., 2021) as well as ornamental fish like zebrafish, guppies, goldfish, and koi carp (Baoprasertkul & Kaenchan, 2019; Bermúdez et al., 2018; Girisha et al., 2021). The detection and characterization of ISKNV in various species across different regions emphasize the pervasive threat posed by this virus. The geographical distribution of ISKNV has expanded significantly in recent years, with cases reported in different parts of Asia including Thailand (Kerddee et al., 2021; Thanasaksiri et al., 2018), Vietnam (Dong et al., 2017), Indonesia (Fusianto et al., 2021), India (Girisha et al., 2021; Swaminathan et al., 2021) and China (Wang et al., 2007; Zhu et al., 2021), Latin America such as Brazil (Figueiredo et al., 2022) and Africa (Ayiku et al., 2024; Ramírez-Paredes et al., 2021). All these findings highlight the widespread outbreaks of ISKNV and their far-reaching impact on the aquaculture industry.

The virulence of ISKNV across different fish species is well documented, with some species such as tilapia and barramundi showing high mortality rates (Dong et al., 2017; Figueiredo et al., 2022; Kerddee et al., 2021; Ramírez-Paredes et al., 2021; Zhu et al., 2021), while some ornamental fish species display only subclinical infections with no major mortality (Girisha et al., 2021; Johnson et al., 2019). Gross lesions observed in the current study, including skin hemorrhages, scale loss, and necrosis of visceral organs, indicated a severe systemic infection. Although scale drop and skin hemorrhages were observed on the body surface of both snakeskin gourami and three spot gourami, our PCR diagnostics revealed that the fish were not infected with SDDV instead infected with ISKNV. The high mortality rates (> 60%) in both fingerlings and adult stages of snakeskin gourami underscore a high virulence of the circulating genotype of ISKNV in these fish. No natural mortality rate information was reported, but artificial infection through intraperitoneal injection with supernatant homogenate from the spleen and kidney of naturally infected giant gouramis (Osphronemus goramy) showed a cumulative mortality of 93% in 12 days (Sukenda et al., 2020). Similarly, ISKNV infection in mandarin fish (Siniperca chuatsi) resulted in 100% mortality within 7–10 days (He et al., 2000). Additionally, supernatant homogenate from infected dwarf gourami (Colisa lalia) resulted in 90% mortality in Murray cod fingerlings (Maccullochella peelii peelii) (Sudthongkong et al., 2002). This observation also aligns with observations in other food fish species. For instance, in farmed barramundi, mortality rates from natural and artificial infections in Thailand were reported as high as 40–50% and 50–90%, respectively, and in China, 85.89% and 83.30%, respectively (Kerddee et al., 2021; Zhu et al., 2021). Similarly, a mortality rate ranging from 60–90% due to natural ISKNV infection was reported in tilapia from Ghana (Ramírez-Paredes et al., 2021).

Spleen and kidney have been identified as the primary target organs with a severe pathology observed in several species previously infected with ISKNV (Bermúdez et al., 2018; Dong et al., 2017; Figueiredo et al., 2022; Girisha et al., 2021; Ramírez-Paredes et al., 2021; Thanasaksiri et al., 2018; Zhu et al., 2021). As the name suggests, the Megalocytivirus inevitably causes abnormal cell enlargement in the target organs, especially the spleen and kidney. It is, therefore, not surprising that a large number of abnormally enlarged cells were observed in spleen and kidney of both snakeskin gourami and three spot gourami in the present study. These histological findings are hallmark of Megalocytivirus infection and highlight the significant pathological changes concurrent with a high mortality. Severe pathological changes in the kidney and spleen, characterized by hypertrophy, basophilic inclusions, architectural defects, and necrosis, could lead to increased pathogenicity and potentially fatal infections.

Genetic analyzes based on the MCP and ATPase genes revealed that the ISKNV strain infecting snakeskin gourami and three-spotted gourami belongs to ISKNV genotype I. This strain is closely related to other known ISKNV strains, including those from mandarin fish in China (He et al., 2001), barramundi in Thailand (Kerddee et al., 2021), giant gourami in Indonesia (Sukenda et al., 2020) and red seabream in Taiwan (Shiu et al., 2018). This genetic similarity indicates a common lineage, suggesting the potential for widespread transmission and the emergence of new infections across different fish populations in these regions. However, the implications of this genetic relatedness for the epidemiology of ISKNV infections remain unclear and require further research to understand the dynamics and spread of the virus. Although ISKNV-like viruses have been increasingly isolated and characterized from various fish species worldwide in recent decades, there is still no standardized nomenclature for these similar virus isolates. Many new isolates have been named after their host species or geographical regions, such as giant gourami iridovirus (GGIV), red seabream iridovirus (RSIV), and turbot reddish body iridovirus (TRBIV), dwarf gourami iridovirus (DGIV), banggai cardinalfish iridovirus (BCIV), marble sleepy goby iridovirus (MSGIV), pompano iridovirus (PIV), etc. This naming convention has led to a confusion in taxonomic classification (Chinchar et al., 2009). The MCP gene is highly conserved among members of the Iridoviridae family and has been widely used in analyzing genetic relationships among iridoviruses (Tidona et al., 1998). The molecular identification of ISKNV by sequencing of the MCP and ATPase genes in the current study provides direct evidence for the presence of the virus infecting snakeskin gourami and three spot gourami and its phylogenetic placement in the Megalocytivirus genus. The high degree of sequence identity with known strains of ISKNV suggests a common evolutionary origin and the possibility of a wide distribution of similar genotype of the virus across different fish species and geographical regions (Fusianto et al., 2023). These genetic findings are crucial for the development of targeted diagnostic tools and understanding the epidemiology of ISKNV infections across many different fish species.

Even though the current study provides compelling evidence of ISKNV infection in gourami species, it does have certain limitations. These include the small number of cases and inadequate sample preservation for virus isolation, which prevented the performance of an experimental trial to prove Koch's postulates. A high mortality rate was recorded in these cases; however, an outbreak of disease is rarely due to the presence of a pathogen alone (Dinh-Hung et al., 2022). Many factors contribute, including water quality, husbandry procedures, stress after animal transportation, and the possible role of co-infections. Therefore, comprehensive prevalence surveys and epidemiologic studies are needed to assess the characteristics and prevalence of ISKNV in different fish species and aquaculture systems in Thailand. Understanding the pathogenicity and factors driving the spread of the virus will be crucial for the development of effective control measures. Moreover, considering mixed-species gourami farming is a common farming practice in Thailand, this could facilitate cross-species transmission of the virus, complicating disease control efforts. The detection of ISKNV in three spot gourami, an ornamental fish species frequently traded worldwide, raises serious concerns about the potential international spread of this pathogen. This concern is underpinned by previous experiences when German retail establishments reported significant epizootics in angelfish (Pterophyllum spp.) originating from Colombia. The etiologic agent associated with mortalities were later identified as ISKNV (Jung-Schroers et al., 2016). Similarly, high viral loads of ISKNV were found in dwarf gourami (Trichogaster lalius) and kissing gourami (Helostoma temminckii) imported to Australia from Singapore and Thailand (Johnson et al., 2019). In conclusion, this is the first report of occurrence of lethal ISKNV infections in two gourami species T. pectoralis and T. trichopterus further expanding the host range of the virus. There is an urgent need for effective intervention strategies including epidemiological surveillance, biosecurity measures in place, good environmental management, and potential vaccination programs to combat further spread of ISKNV in aquaculture.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This research was supported by the National Science, Research and Innovation Fund, Thailand Science Research and Innovation (TSRI).

Data availability statement

The data that support the findings of this study are available on request.

Ayiku ANA, Adelani AA, Appenteng P, Nkansa M, Ngoi JM, Morang'a CM, Dzabeng F, Paley R, Cudjoe KS, Verner-Jeffreys D, Quashie PK, Duodu S (2024) Molecular epidemiology and current management of Infectious Spleen and Kidney Necrosis Virus (ISKNV) infection in Ghanaian cultured tilapia. Aquaculture 581:740330. https://doi.org/https://doi.org/10.1016/j.aquaculture.2023.740330
Baoprasertkul P, Kaenchan N (2019) Distribution and detection of Megalocytivirus in ornamental fish in Thailand
Bermúdez R, Losada AP, de Azevedo AM, Guerra-Varela J, Pérez‐Fernández D, Sánchez L, Padrós F, Nowak B, Quiroga MI (2018) First description of a natural infection with spleen and kidney necrosis virus in zebrafish. J Fish Dis 41(8):1283–1294
Chinchar VG, Hick P, Ince IA, Jancovich JK, Marschang R, Qin Q, Subramaniam K, Waltzek TB, Whittington R, Williams T (2017) ICTV virus taxonomy profile: Iridoviridae. J Gen Virol 98(5):890–891
Chinchar VG, Hyatt A, Miyazaki T, Williams T (2009) Family Iridoviridae: Poor Viral Relations No Longer. In J. L. Van Etten (Ed.), Lesser Known Large dsDNA Viruses (pp. 123–170). Springer Berlin Heidelberg. https://doi.org/10.1007/978-3-540-68618-7_4
de Groof A, Guelen L, Deijs M, van der Wal Y, Miyata M, Ng KS, van Grinsven L, Simmelink B, Biermann Y, Grisez L (2015) A novel virus causes scale drop disease in Lates calcarifer. PLoS Pathog 11(8):e1005074
Dinh-Hung N, Dong HT, Shinn AP, Rodkhum C, Phiwsaiya K, Wichianrat C, Soontara C, Senapin S, Chatchaiphan S (2023) Lumpy skin disease of snakeskin gourami: A new record of metacercariae of Posthodiplostomum sp.(Digenea, Diplostomidae) in clinically sick snakeskin gourami, Trichopodus pectoralis Regan, 1910 (Pisces, Osphronemidae). Aquaculture 573:739583
Dinh-Hung N, Dong HT, Soontara C, Rodkhum C, Nimitkul S, Srisapoome P, Kayansamruaj P, Chatchaiphan S (2022) Co-infection of Candidatus Piscichlamydia Trichopodus (Order Chlamydiales) and Henneguya sp. (Myxosporea, Myxobolidae) in Snakeskin Gourami Trichopodus pectoralis (Regan 1910). Front Vet Sci 9:847977. https://doi.org/10.3389/fvets.2022.847977
Dinh-Hung N, Dong HT, Taengphu S, Soontara C, Rodkhum C, Senapin S, Chatchaiphan S (2023) Streptococcus suis is a lethal pathogen in snakeskin gourami, Trichopodus pectoralis. Aquaculture, 739173. https://doi.org/https://doi.org/10.1016/j.aquaculture.2022.739173
Dong HT, Jitrakorn S, Kayansamruaj P, Pirarat N, Rodkhum C, Rattanarojpong T, Senapin S, Saksmerprome V (2017) Infectious spleen and kidney necrosis disease (ISKND) outbreaks in farmed barramundi (Lates calcarifer) in Vietnam. Fish Shellfish Immunol 68:65–73. https://doi.org/10.1016/j.fsi.2017.06.054
FAO (2024) Thailand. Text by Pongsri, C. and Sukumasavin, N. Fisheries and Aquaculture Division [online]. Rome. [Cited Tuesday, May 21st 2024]. https://www.fao.org/fishery/en/countrysector/th/en
Figueiredo HCP, Tavares GC, Dorella FA, Rosa JCC, Marcelino SAC, Pierezan F, Pereira FL (2022) First report of infectious spleen and kidney necrosis virus in Nile tilapia in Brazil. Transbound Emerg Dis 69(5):3008–3015. https://doi.org/https://doi.org/10.1111/tbed.14217
Fu X, Li N, Liu L, Lin Q, Wang F, Lai Y, Jiang H, Pan H, Shi C, Wu S (2011) Genotype and host range analysis of infectious spleen and kidney necrosis virus (ISKNV). Virus Genes 42(1):97–109. https://doi.org/10.1007/s11262-010-0552-x
Fusianto C, Hick PM, Murwantoko, Herlambang A, Whittington RJ, Becker JA (2021) Outbreak investigation attributes Infectious spleen and kidney necrosis virus as a necessary cause of a mortality epidemic in farmed grouper (Epinephelus spp.) in Bali, Indonesia. Aquaculture Rep 20:100723. https://doi.org/https://doi.org/10.1016/j.aqrep.2021.100723
Fusianto CK, Becker JA, Subramaniam K, Whittington RJ, Koda SA, Waltzek TB, Murwantoko, Hick PM (2023) Genotypic Characterization of < i > Infectious Spleen and Kidney Necrosis Virus (ISKNV) in Southeast Asian Aquaculture. Transboundary and Emerging Diseases, 2023, 6643006. https://doi.org/10.1155/2023/6643006
Girisha SK, Kushala KB, Nithin MS, Puneeth TG, Kumar N, Vinay BT, Suresh TN, Ajay T, Venugopal SK, M. N., Ramesh KS (2021) First report of the infectious spleen and kidney necrosis virus (ISKNV) infection in ornamental fishes in India. Transbound Emerg Dis 68(2):964–972. https://doi.org/https://doi.org/10.1111/tbed.13793
He JG, Deng M, Weng SP, Li Z, Zhou SY, Long QX, Wang XZ, Chan SM (2001) Complete genome analysis of the mandarin fish infectious spleen and kidney necrosis iridovirus. Virology 291(1):126–139. https://doi.org/10.1006/viro.2001.1208
He JG, Wang SP, Zeng K, Huang ZJ, Chan S-M (2000) Systemic disease caused by an iridovirus-like agent in cultured mandarinfish, Siniperca chuatsi (Basilewsky), in China. J Fish Dis 23(3):219–222. https://doi.org/https://doi.org/10.1046/j.1365-2761.2000.00213.x
Huang SM, Tu C, Tseng CH, Huang CC, Chou CC, Kuo HC, Chang SK (2011) Genetic analysis of fish iridoviruses isolated in Taiwan during 2001–2009. Arch Virol 156(9):1505–1515. https://doi.org/10.1007/s00705-011-1017-9
IUCN (2023) The IUCN red list of threatened species. Version 2023-1
Johnson SJ, Hick PM, Robinson AP, Rimmer AE, Tweedie A, Becker JA (2019) The impact of pooling samples on surveillance sensitivity for the megalocytivirus Infectious spleen and kidney necrosis virus. Transbound Emerg Dis 66(6):2318–2328. https://doi.org/https://doi.org/10.1111/tbed.13288
Jung-Schroers V, Adamek M, Wohlsein P, Wolter J, Wedekind H, Steinhagen D (2016) First outbreak of an infection with infectious spleen and kidney necrosis virus in ornamental fish in Germany. Dis Aquat Organ 119. https://doi.org/10.3354/dao02995
Kawato Y, Cummins DM, Valdeter S, Mohr PG, Ito T, Mizuno K, Kawakami H, Williams LM, Crane MSJ, Moody NJG (2021) Development of New Real-time PCR Assays for Detecting < i > Megalocytivirus Across Multiple Genotypes. 魚病研究 56(4):177–186. https://doi.org/10.3147/jsfp.56.177
Kerddee P, Dinh-Hung N, Dong HT, Hirono I, Soontara C, Areechon N, Srisapoome P, Kayansamruaj P (2021) Molecular evidence for homologous strains of infectious spleen and kidney necrosis virus (ISKNV) genotype I infecting inland freshwater cultured Asian sea bass (Lates calcarifer) in Thailand. Arch Virol 166(11):3061–3074. https://doi.org/10.1007/s00705-021-05207-7
Kurita J, Nakajima K (2012) Megalocytiviruses Viruses 4(4):521–538. https://www.mdpi.com/1999-4915/4/4/521
Machimbirike VI, Jansen MD, Senapin S, Khunrae P, Rattanarojpong T, Dong HT (2019) Viral infections in tilapines: More than just tilapia lake virus. Aquaculture 503:508–518. https://doi.org/https://doi.org/10.1016/j.aquaculture.2019.01.036
Maddern M (2022) Trichopodus trichopterus (three spot gourami). CABI Compendium CABI Compendium. https://doi.org/10.1079/cabicompendium.121020
Meemetta W, Domingos JA, Dong HT, Senapin S (2020) Development of a SYBR Green quantitative PCR assay for detection of Lates calcarifer herpesvirus (LCHV) in farmed barramundi. Journal of Virological Methods, 285. https://doi.org/ARTN 11392010.1016/j.jviromet.2020.113920
Qin P, Munang'andu HM, Xu C, Xie J (2023) Megalocytivirus and Other Members of the Family Iridoviridae in Finfish: A Review of the Etiology, Epidemiology, Diagnosis. Prev Control Viruses 15(6). https://doi.org/10.3390/v15061359
Rainboth WJ (1996) Fishes of the cambodian mekong. Food & Agriculture Org
Ramírez-Paredes JG, Paley RK, Hunt W, Feist SW, Stone DM, Field TR, Haydon DJ, Ziddah PA, Nkansa M, Guilder J, Gray J, Duodu S, Pecku EK, Awuni JA, Wallis TS, Verner-Jeffreys DW (2021) First detection of infectious spleen and kidney necrosis virus (ISKNV) associated with massive mortalities in farmed tilapia in Africa. Transbound Emerg Dis 68(3):1550–1563. https://doi.org/10.1111/tbed.13825
Senapin S, Dong H, Meemetta W, Gangnonngiw W, Sangsuriya P, Vanichviriyakit R, Sonthi M, Nuangsaeng B (2018) Mortality from scale drop disease in farmed Lates calcarifer in Southeast Asia. J Fish Dis 42. https://doi.org/10.1111/jfd.12915
Shiu J-Y, Hong J-R, Ku C-C, Wen C-M (2018) Complete genome sequence and phylogenetic analysis of megalocytivirus RSIV-Ku: A natural recombination infectious spleen and kidney necrosis virus. Arch Virol 163(4):1037–1042. https://doi.org/10.1007/s00705-017-3689-2
Song J-Y, Kitamura S-I, Jung S-J, Miyadai T, Tanaka S, Fukuda Y, Kim S-R, Oh M-J (2008) Genetic variation and geographic distribution of megalocytiviruses. J Microbiol 46:29–33. https://doi.org/10.1007/s12275-007-0184-6
Sriisan S, Boonchird C, Thitamadee S, Dong H, Senapin S (2018) Development of real-time PCR assay for detection of scale drop disease virus (SDDV) in Asian sea bass
Subramaniam K, Shariff M, Omar AR, Hair-Bejo M (2012) Megalocytivirus infection in fish. Reviews Aquaculture 4(4):221–233
Sudthongkong C, Miyata M, Miyazaki T (2002) Iridovirus disease in two ornamental tropical fresh-water fishes: African lampeye and dwarf gourami. Dis Aquat Organ 48(3):163–173
Sukenda S, Gardenia L, Zairin M, Lusiastuti A, Alimudin A (2020) Identification of giant gourami iridovirus (GGIV): a new infectious spleen and kidney necrosis virus (ISKNV) from natural outbreak in cultured Osphronemus goramy. Aquacult Int 28(3):1069–1082. https://doi.org/10.1007/s10499-020-00513-4
Swaminathan TR, Raj NS, Preena PG, Pradhan PK, Sood N, Kumar RG, Sudhagar A, Sood NK (2021) Infectious spleen and kidney necrosis virus-associated large-scale mortality in farmed giant gourami, Osphronemus goramy, in India. J Fish Dis 44(12):2043–2053. https://doi.org/https://doi.org/10.1111/jfd.13519
Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38(7):3022–3027. https://doi.org/10.1093/molbev/msab120
Thanasaksiri K, Takano R, Fukuda K, Chaweepack T, Wongtavatchai J (2018) Identification of infectious spleen and kidney necrosis virus from farmed barramundi Lates calcarifer in Thailand and study of its pathogenicity. Aquaculture 500. https://doi.org/10.1016/j.aquaculture.2018.09.035
Tidona CA, Schnitzler P, Kehm R, Darai G (1998) Is the major capsid protein of iridoviruses a suitable target for the study of viral evolution? Virus Genes 16(1):59–66. https://doi.org/10.1023/a:1007949710031
Tsai JM, Huang SL, Yang CD (2020) PCR Detection and Phylogenetic Analysis of Megalocytivirus Isolates in Farmed Giant Sea Perch Lates calcarifer in Southern Taiwan. Viruses 12(6). https://doi.org/10.3390/v12060681
Wang YQ, Lü L, Weng SP, Huang JN, Chan SM, He JG (2007) Molecular epidemiology and phylogenetic analysis of a marine fish infectious spleen and kidney necrosis virus-like (ISKNV-like) virus. Arch Virol 152(4):763–773. https://doi.org/10.1007/s00705-006-0870-4
Whittington RJ, Becker JA, Dennis MM (2010) Iridovirus infections in finfish - critical review with emphasis on ranaviruses. J Fish Dis 33(2):95–122. https://doi.org/10.1111/j.1365-2761.2009.01110.x
Zhu Z, Duan C, Li Y, Huang C, Weng S, He J, Dong C (2021) Pathogenicity and histopathology of infectious spleen and kidney necrosis virus genotype II (ISKNV-II) recovering from mass mortality of farmed Asian seabass, Lates calcarifer, in Southern China. Aquaculture 534:736326. https://doi.org/https://doi.org/10.1016/j.aquaculture.2020.736326

The authors declare no competing interests.

SUPPLEMENTARYDATA.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

First report of natural infection with infectious spleen and kidney necrosis virus (ISKNV) associated with disease outbreaks in two gourami species (Trichopodus spp.)

Status:

Version 1

Abstract

Figures

Highlights

1. INTRODUCTION

2. MATERIALS AND METHODS

2.1. Fish and case history

2.2. Sample collection, DNA extraction and histopathology examination

2.3. Real-time PCR assays for universal screening of Megalocytivirus

2.4. Sequence analysis of viral MCP and ATPase genes.

3. RESULTS

3.1. Infection data and pathology findings

3.2. Viral identification

3.3. Phylogenetic analysis

4. DISCUSSION

Declarations

Declaration of competing interest

Acknowledgements

Data availability statement

References

Additional Declarations

Supplementary Files

Status:

Version 1