Animals. Chromogranin A knockout (CgA-KO) mice on a mixed background (50% 129/SvJ; 50% C57BL/6) were backcrossed to C57BL/6J mice for 10 generations to get CgA-KO mice in C57BL/6 background. CgA-KO mice were later inbred for 7 generations to establish a homogeneous mouse line. Those CgA-KO mice were backcrossed to B6C3F1/J mice for 4 generations to generate CgA-KO mice in B6C3F1/J background. These mice were crossed with hTau heterozygote mice (in B6C3F1/J background) to generate CgA-KO/hTau mice. Animals were kept in a 12-hour light/12-hour dark cycle. Mice have access to food and water ad libitum. Mice were fed a regular chow diet (NCD: 14% calorie from fat; LabDiet 5P00). All studies performed on animals were approved by the UCSD and Veteran Affairs San Diego Institutional Animal Care and Use Committee (IACUC) and conform to relevant National Institutes of Health guidelines.
Genotyping: Mice were ear-tagged and tail-snips were collected. Genomic DNA from tail-snips were isolated using the Accustart Genotyping kit and amplified by PCR with Accustart Geltrack PCR supermix. Primers used for hTau genotyping are Forward (WT and mutant): 5’ TTG AAG TTG GGT TAT CAA TTT GG 3’, Reverse (WT): 5’ TTC TTG GAA CAC AAA CCA TTT C 3’, Reverse (Mutant): 5’ AAA TTC CTC AGC AAC TGT GGT 3’. Primers used for ChgA genotyping are Forward: 5’GTA GCA TGG CCA CTA CCC AG 3’ and Reverse: 5’ ATC CTT CAG AGC CCC TCC TT 3’.
Hippocampal Slice Culture
Organotypic hippocampal slice cultures (OTSC) were performed with hippocampal slices obtained from postnatal day 7–8 pups of WT or CgA-KO mice as described previously (Croft & Noble, 2018). Pups were culled by decapitation, and the hippocampus was quickly dissected in oxygenated artificial cerebrospinal fluid (ACSF). Approximately 18–24 400 µm thick slices were cut using a tissue chopper, and these were cultured in Millicell culture inserts (Millipore) in 6 well plates (6–8 slices per insert). Culture media was changed every 2–3 days and the slices were harvested after 21 or 28 days. The composition of ACSF was 125mM NaCl, 2.4mM KCl, 1.2mM NaH2PO4, 1mM CaCl2, 2mM MgCl2, 25mM NaHCO3, and 25mM Glucose. The composition of OTSC culture media was 25mM HEPES, 133mM NaCl, 31mM NaHCO3, 45mM D-Glucose, 5mM KCl, 3.3mM MgSO4, 4.5mM CaCl2, 1mM Na2HPO4, 0.5mM Ascorbic Acid, 1,25ml Pen-Strep, 2.5ml Glut-Max, 62.5ml Heat Inactivated Horse Serum and 82.5µl Insulin.
In vitro fibril-induced tau spreading assay: Hippocampal slices were transduced with AAV viral vector expressing P301S human tau (AAV2-smCBA-human_P301S_Tau-WPRE; 2x1010/mL) for 24h. AAV was removed from culture media and K18 (preformed tau fibrils; 1.5 µg/mL) were added before incubation for 72h. Subsequently, fresh media without or with Phenylephrine:10nM, Prazosin:0.5µM, or Epinephrine: 10nM, was applied as indicated. Slices were harvested on day 21 for Western blot analysis and immunohistochemistry.
In vivo fibril-induced tau spreading assay
Mice were anesthetized with inhalation of 2% isoflurane for the duration of surgery and secured on a stereotaxic frame (Kopf Instruments). 3-month-old hTau and CgA-KO/hTau mice were injected stereotaxically at a rate of 0.5µl/min, with 2µL of 5 mg/ml K18 PFF into the CA1 region of the left hippocampus. The coordinates for injection were anterior-posterior − 2.5, medial-lateral + 2.0, dorsal-ventral − 1.8. Mice were sacrificed 6 weeks after injection and transcardially perfused with PBS for immunohistochemistry analysis of tau aggregation (MC1+) in the ipsilateral and contralateral sides.
K18 purification and invitro Fibril formation: The repeat domains (K18) of P301L mutant Tau with a Myc Tag was expressed in E.coli BL21 (DE3) strain. NaCl (500mM) and betaine (10mM), a small molecule chaperone, were added before induction with IPTG (200 µM) at 30°C for 3.5h. Cells were resuspended in lysis buffer (20mM MES, pH 6.8, 1mM EGTA, 0.2mM MgCl2, 1mM PMSF, 5mM DTT), and passed through a microfluidizer for lysis. After lysis, 5M NaCl was added to a final concentration of 500mM followed by heating at 90°C for 20min. was clarified by centrifugation and was dialyzed overnight (Buffer A: 50mM NaCl, 1mM MgCl2, 0.1mM PMSF, 2mM DTT, 1mM EGTA, 20mM MES pH 6,8) to obtain the Tau-containing supernatant. Subsequently, cation exchange (HiTrap SP HP, 5ml column from Cytiva) was performed to purify K18. The degradation products and other impurities were removed by running 15% elution buffer (50mM NaCl, 1mM MgCl2, 0.1mM PMSF, 2mM DTT, 1mM EGTA, 20mM MES pH 6,8, 1M NaCl). Subsequently, 15–60% gradient (NaCl gradient from 50mM to 1M) of NaCl was used to obtain pure K18, which was concentrated and further dialyzed against assay buffer (PBS pH 7.4, 1mM DTT and 2mM MgCl2). A 10µM concentration of Tau was incubated in assay buffer for 36h at 37°C) upon adding 44µg/ml Heparin. The aggregates formed were snap frozen at -80°C till further use.
Transmission Electron Microscopy
Deeply anesthetized mice were flushed with a pre-warmed (37°C) Hank’s balanced salt solution (HBSS), with calcium and magnesium by perfusion with freshly prepared pre-warmed (37°C) fixative containing 2.5% glutaraldehyde and 2% paraformaldehyde in 0.15 M cacodylate buffer using a peristaltic pump. The hippocampus and cortex were dissected and postfixed in 1% OsO4 in 0.1 M cacodylate buffer. The tissues were stained en bloc with 2–3% uranyl acetate and dehydrated in graded ethanol series. Sections of 50–60 nm thickness were cut, stained with 2% uranyl acetate and Sato’s lead stain. Grids were imaged with a JEOL JEM1400-plus TEM (JEOL, Peabody, MA) attached to a Gatan OneView digital camera with 4k x 4k resolution (Gatan, Pleasanton, CA).
Measurement of catecholamines: Cortical and plasma catecholamines were measured upon separation by an Atlantis dC18 column (100A, 3 µm, 3 mm x 100 mm) on a ACQUITY UPLC H-Class System attached to an electrochemical detector (ECD model 2465; Waters Corp, Milford, MA) as described previously. The mobile phase (isocratic: 0.3 ml/min) contained 95:5 (vol/vol) of phosphate-citrate buffer and acetonitrile. An internal standard 3.4-dihydroxybenzylamine (DHBA 400 ng) was added to the cortical homogenate in 0.1N HCl. The ECD was set at 500 pA for determination of brain catecholamines. For determination of CSF catecholamines, DHBA (2 ng) was added to 150 µl CSF and adsorbed with ~ 15 mg of activated aluminum oxide for 10 min in a rotating shaker. After washing with 1 ml water, adsorbed catecholamines were eluted with 100 µl of 0.1N HCl. The ECD was set at 500 pA for determination of CSF catecholamines. The data were analyzed using Empower software (Waters Corp, Milford, MA). Catecholamine levels were assessed using the internal standard. Catecholamine levels were provided in nM (CSF) or ng/mg protein. For determination of plasma catecholamines, DHBA (2 ng) was added to 150 µl plasma and adsorbed with ~ 15 mg of activated aluminum oxide for 10 min in a rotating shaker. After washing with 1 ml water adsorbed catecholamines were eluted with 100 µl of 0.1N HCl. The ECD was set at 500 pA for determination of plasma catecholamines. The data were analyzed using Empower software (Waters Corp, Milford, MA). Catecholamine levels were normalized with the recovery of the internal standard. Plasma catecholamines were expressed as nM.
Measurement of cytokines
Cortices from hTau, CgA-KO/hTau, WT and CgA-KO were homogenized in PBS followed by centrifugation at 12500 RPM for 30 min at 4°C. The supernatant was collected and used in ELISA. Cytokines were measured using U-PLEX mouse cytokine assay kit (Meso Scale Diagnostics, Rockville, MD) following the manufacturer’s protocol in a MESO SECTOR S 600MM Ultra-Sensitive Plate Imager. The levels were presented in pg/mg protein. Plasma (25 µl) cytokines were measured using U-PLEX mouse mouse cytokine assay kit (Meso Scale Diagnostics, Rockville, MD).
Behavioral Studies
Behavioral studies including, Morris Water Maze, Novel Object Recognition and Rotarod test for all four cohorts of mice were performed in UCSD behavior core facility.
Morris Water Maze (MWM) test
MWM test is a long-term memory test where a chamber is filled with opaque water and there is a submerged platform under the surface. Training was carried out in the period of day1 to day7 for the hidden platform where mice were guided to reach the platform and trial was ended if they reached and are stationary on the platform for 5 seconds. Both distance and time were recorded for each mouse. On day8, the mice were dropped 180° opposite of the location of the platform but without the platform in the chamber. The number of times each mice entering the correct zone was recorded. Separately, the hidden platform was provided, and the time taken by each mouse to reach the platform was recorded and represented as latency.
Novel Object Recognition (NOR) test
In NOR, the mice was left to spend with time with a known object for 180 seconds on day1. The time for which the mouse explored the unknown object was recorded. On day2, a new object is introduced in addition to the old object. It is expected that the mouse will spend more time with the new introduced object for curiosity, if it can remember the old object. The total time spend by mice with the new object on day2 determines the degree of memory loss and represented as (Time with new object X 100)/Time with new + old object.
Rotarod test
Rotarod test was performed to evaluate the motor functions in mice. In this test there was a horizontal rod which rotates around its axis and the mice must co-ordinate with the movement so that they don’t fall off. The time for which they can stay on the rod determines their motor function. On day 1 each mice undergo five trials on the rotarod. On day 2, each mice undergo seven trials and time from each trial is plotted and compared.
Tau Seeding Assay
Human Tau RD P301S FRET biosensor expressing HEK 293 cells (ATCC CRL-3275) were plated on Millipore EZ chambered slide at a confluency of 1 X 103 Cells / well in DMEM Complete media (DMEM with 10%FBS + 100 µg penicillin and streptomycin). After 16h, the media is replaced with OptiMEM and cells were treated with 2 µg lysate from CgA-KO/hTau and hTau cortex prepared in PBS and 4µl Lipofectamine-3000. Post 24h of treatment the media is replaced with complete DMEM. After 24h the media was removed and cells were fixed with 4% Paraformaldehyde and stained with DAPI. Cells were mounted and images were taken using Keyence Fluorescence Microscope under 40X lens. Four biological replicates per group were taken and 4 images each group were analyzed by ImageJ for quantification.
Immunohistochemistry: Isofluorane was used to anesthetize the mice followed by trans-cardial perfusion with PBS. The brain was dissected out and kept in Zn-Formalin for 48hr. After that, Zn-Formalin is replaced with 30% Sucrose incubated for 72hr at 4°C. The brains underwent coronal sectioning of 30µm thick by sliding freezing microtome (Epredia). The sections were kept at -20°C in cryoprotectant. Approximately 7–8 sections were taken for each animal covering from anterior to posterior region of hippocampus. The sections were washed thoroughly (6X 10 min wash) with 1X PBS and then incubated with primary antibody in PBS containing 0.4% Triton-X for 24hr at 4°C. Following which the primary antibody is removed and washed with 1X PBS for 3X 15min. Subsequently, the secondary antibody and DAPI (1:2000) were added and incubated for 1hr at room temperature followed by 3X 15min PBS wash. Next, the sections were mounted on glass slides with Fluoromount G. The stained slides were imaged under Keyence Fluorescence Microscope. Primary antibodies used: AT8 (1:500), MC1 (1:500), CD68 (1:700), GFAP (1:500), ADRA1B (1:500), CgA (1:400). Secondary antibodies used: Anti-mouse Alexa Fluor 568 (1:300), Anti-rabbit Alexa Fluor 488 (1:300), Strep-Alexa Fluor 568 (1:500).
Paraffin-embedded brain slices pre-mounted on slides from ADRC were de-paraffinized in xylene for 10 mins, followed by rehydration with sequential incubation in 100%, 90%, 70% EtOH, 5 mins each. Sections were placed in Citrate buffer (pH6) solution in a pressure cooker at low pressure for 10 minutes for antigen retrieval. The slides were blocked (2.5% Normal Goat Serum for 1hr at room temperature) and incubated with primary antibody for overnight at 4°C, followed by 3X PBS wash for 15 min each. Next, a secondary antibody and DAPI (1:2000) were added and incubated for an hour at room temperature. After this, slides were dried and mounted with Fluoromount G. Images were taken with the Keyence Fluorescence microscope.
Nissl Staining, Volumetric analysis and DG and CA1 thickness measurement: Investigators were blinded to the genotypes or treatment of the mice. For quantification of hippocampal volume, mice hemibrains were cut at 30 µm coronally, and all hippocampi, including sections, were collected. Brain sections were mounted on microscope slides (Fisher Scientific) in an anterior-to-posterior order, starting from the section where the hippocampal structure first becomes visible (first section) to the section where hippocampal structure just disappears (last section). Mice with missing sections were excluded from the analyses, a pre-established criterion. Mounted brain sections were dried at room temperature for 24 h and stained with cresyl violet (Nissl staining). After rehydrating with a quick wash in distilled water, sections were stained in FD Cresyl Violet Solution for 3 min. Next, sections were dehydrated in increasing ethanol concentrations and differentiated in 95% ethanol with 0.1% glacial acetic acid. After the final dehydration in 100% ethanol, sections were cleared in xylene and mounted with DePeX mounting media (VWR). Images were acquired with a Keyence BZ-9000 microscope. Hippocampal volume was estimated using ImageJ (NIH) Volumest plugin (http://lepo.it.da.ut.ee/~markkom/volumest/). To measure the thickness of CA1 pyramidal cell layer and dentate gyrus granule cells layer, a straight line perpendicular to the length of cell layers at fixed locations was drawn and measured using ImageJ.10–12 hippocampal-containing sections were typically used for each analysis.
Western Blotting: 15mg Tissue was incubated in RIPA buffer (150mM NaCl, 1% Triton-X, 12mM Na-deoxycholate, 0.1% SDS, 50mM Tris pH 8.0, 25mM EDTA, 1mM PMSF, 5% Glycerol, 50mM NaF, 1mM Na3VO4, 1mM Na4P2O7, 25mM β-Glycerolphosphate, 50mM DTT and PIC) for 10 min. Homogenization was done by handheld motor homogenizer, followed by centrifugation at 12500 rpm for 30min at 4°C. The supernatant was collected and protein concentration was measured using Bradford Protein Assay Reagent. 15µg protein was loaded in each lane of 12% Tris-Glycine SDS Gel and post-running protein was transferred to PVDF membrane followed by blocking with 5% BSA for 2hrs. Primary antibody incubation was done at 4°C. Antibodies and dilution used as follows: 1°CgA (1:4000), 1°AT8 (1:3000), 1°PHF1 (1:4000), 1°CP13 (1:2000), 1°HT7 (1:8000), 1°Actin (1:8000), 1°ADRA1B (1:2000), 1°ADRA2B (1:2000), 1°ADRB2 (1:2000), 1°α-Tubulin (1:6000), 2°Anti-Mouse-HRP (1:10000), 2°Anti-Rabbit-HRP (1:10000), Strep-HRP (1:6000).
cAMP measurement
The cortex tissue samples from mice or human were lysed in PBS along with PDE inhibitor (IBMX) and PIC (SIGMA) with homogenizer followed by centrifugation at 12500 rpm for 20min at 4°C. The cAMP level in the supernatant was analyzed using Perkin Elmer cAMP measurement kit as described in the manual. Briefly, the tissue lysate was incubated with anti-cAMP acceptor beads in corning dark 384 well plate and incubated for 30min at room temperature in dark. Subsequently, biotinylated cAMP/streptavidin beads were added, and incubated at room temperature in dark for 1h. Excitation was performed at 680nm wave-length light and emission was measured at 550nM to determine the cAMP concentration based on the standard curve.
Metabolite Analysis
Frozen brain samples (20–40 mg) were transferred to 2-mL tubes containing 2.8 mm ceramic beads (Omni International) and 0.45 ml ice-cold 50% methanol/ 20 µM L-norvaline was added. Tubes were shaken (setting 5.5) for 30 s on a Bead Ruptor 12 (Omni International), quickly placed on ice, and frozen at -80°C overnight. Thawed samples were centrifuged at 15,000 x g for 10 minutes at 4°C. The supernatant was then transferred to a new tube, mixed with 0.225 ml chloroform, and centrifuged at 10,000 x g for 10 minutes at 4°C. This produced a two-phase separation. Portions (200 µl) of the top phase, along with 7 dilutions of a mixture of standards (see attached SRM sheet for list of standards), were dried (Speedvac) for analysis of polar metabolites. Dried samples and standards were derivatized with 30 µl isobutylhydroxylamine (TCI, 20 mg/ml in pyridine, 80°C for 20 min) followed by addition of 30 µl MTBSTFA (Soltec) and further incubation at 80°C for 60 min, before transfer to vials for GC-MS analysis. Samples and standards were analyzed by GC-MS using a TG-SQC column (15 m x 0.25 mm x 0.25 µm, Thermo) installed in a Thermo Scientific TSQ 9610 GC-MS/MS. The GC was programmed with an injection temperature of 250°C and a 0.8 µl injection with 1/5 split. The GC oven temperature was initially 130°C for 4 min, rising to 250°C at 6°C/min, and to 280°C at 60°C/min with a hold at the final temperature for 2 min. GC flow rate with helium carrier gas was 50 cm/s. The GC-MS interface temperature was 300°C and (electron impact) ion source temperature was 200°C, with 70 eV ionization voltage. Standards were run in parallel with samples. Metabolites in samples and standards were detected by MS/MS using precursor and product ion masses, and collision energies shown in the attached table (argon was used as the collision gas). Sample metabolites were quantified with calibration curves based on the standards (in Thermo Chromeleon software) and further data processing to adjust for the recovery of the internal standard (norvaline) and for the relative quantities of metabolites in the standards was done in MS Excel.
RNA extraction and qPCR
RNA was isolated using TRIzol reagent and extracted further with phenol-chloroform method. RNA concentration was measured using Thermo Nanodrop and cDNA was synthesized from 500ng of total RNA using Maxima RT cDNA synthesis kit. SYBR green containing NEB Luna qPCR mix was used to set up the qPCR in Bio-Rad qPCR machine.
Gene name | Forward | Reverse |
ADRA1B | 5’ GAAAGCAGCCAAAACCTTGGGC 3’ | 5’ CACTACCTTGAATACGGCGTCC 3’ |
ADRA1D | 5’ GTGTCTTCGTCCTGTGCTGGTT 3’ | 5’ GCCAGAAGATGACCTTGAAGACG 3’ |
ADRA2A | 5’ CAGGTGACACTGACGCTGGTTT 3’ | 5’ GACACCAGGAAGAGGTTTTGGG 3’ |
ADRA2B | 5’ GTGTGCCATCAGTCTGGACAGA 3’ | 5’ CAATGAGCCACACGGTGAGGAT 3’ |
β-ACTIN | 5’ CATTGCTGACAGGATGCAGAAGG 3’ | 5’ TGCTGGAAGGTGGACAGTGAGG 3’ |
RNA-seq library preparation and analysis
Total RNA was isolated from prefrontal cortex of 8-month-old mouse using RNeasy kit (Qiagen). RNA amount was quantified by ‘Nanodrop’ spectrophotometer and integrity was assessed by TapeStation (Agilent). Complementary DNA libraries were prepared from 500 ng of total RNA using the mRNA HyperPrep Kit (KAPA) according to manufacturer’s recommendations with Unique Dual-Indexed adapters (KAPA). Libraries were PCR-amplified for 10 cycles and quality was assessed by Tapestation. Libraries were then quantified by Qubit 2.0 fluorometer (Thermo), pooled, and analyzed by paired-end 100 sequencing on the NovaSeq 6000 platform (Illumina) at UCSD IGM Core.
RNA-Seq Analysis
RNA samples were first assessed for Sequencing quality by FASTQC and libraries with high quality reads were trimmed using Trimmomatic (v0.39). Reads were mapped to the mm10 mouse reference genome using STAR (v2.7.10b) and transcripts were quantified by StringTie (v1.3.6). Transcript counts were imported to R using prepDE.py3 for normalization and differential expression was analyzed by DESeq2 (v1.42.0). Gene clusters among differentially expressed genes were identified as common genes in comparisons of WT vs hTau and CgA-KO/hTau vs hTau with log2 fold-change > +/- 0.5 and p value < 0.01. For gene ontology analysis, the enrichGO function from clusterProfiler (v4.10.0) with the org.Mm.eg.db (v3.18.0) was used with BH parameter for p value adjustment.
Human Transcriptomics Data Analysis
For human transcript analysis, normalized data of gene expression in parahippocampal gyrus (Brodmann area 36) was obtained from Mount Sinai Brain Bank (MSBB) through the Synapse platform (syn16795937).
Statistics
In figure legends ‘n’ represents the biological replicates for the group. In all in vivo experiments the male and female ratio of 50% was maintained. Data were analyzed using unpaired two-tailed T-test, One-way or Two-way ANOVA as mentioned in the figure legends of each figure. Exact p-values are mentioned in the figures.