2.1. Compliance with ethical standards.
Animal experiment protocols were approved by the Experimental Animal Ethics Committee of Affiliated Hangzhou First People’s Hospital, Zhejiang University School of Medicine. All animal experiments were performed in accordance with the Guide for the Care and Use of Laboratory animals published by the US National Institutes of Health. Extensive efforts were made to ensure minimal suffering of animals during the study.
2.2. Analysis of BPD gene expression dataset and bioinformatics prediction.
The gene expression dataset GSE25293 of mouse BPD models was retrieved from the annotation platform GPL1261 in the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/gds) and then analyzed using R language. The databases DIANA TOOLS (http://diana.imis.athena-innovation.gr/DianaTools/), miRWalk (energy < -30) (http://mirwalk.umm.uni-heidelberg.de), mirDIP (Integrated Score > 0.6) (http://ophid.utoronto.ca/mirDIP/), miRDB (http://www.mirdb.org) and miRSearch (https://www.exiqon.com/miRSearch) were used to analyze the intersected upstream miRNAs in human body. A box plot was drawn using R language to extract key miRNA expression data from the miRNA dataset GSE25293 from the annotation platform GPL11199 in the GEO database. Protein-protein interaction (PPI) analysis was performed on String website (https://string-db.org) to obtain proteins that could potentially bind to BPD. Cytoscape (https://cytoscape.org) was used to process the visual graphs of PPI analysis, and its downstream regulatory pathways were predicted based on existing literatures.
2.3. Establishment of hyperoxia–induced BPD rat models.
Twelve specific-pathogen-free (SPF) Sprague-Dawley (SD) rats (a gestational age of 15 days; Shanghai SLAC Laboratory Animal Co., Ltd., Shanghai, China) were raised at 22 ± 3 °C and with humidity of 60 ± 5% and circadian rhythm of 12 h. Each neonatal rat was housed individually and was self-delivered after 1 week of acclimation. Then 60 neonatal rats within 12 h of birth difference after delivery were randomly grouped into the hyperoxia treatment group and the control group. And the hyperoxia-treated rats with BPD were then treated with miR-214 negative control (NC), miR-214 agomir, miR-214 NC + PlGF vector, and miR-214 agomir + PlGF (n = 12 in each treatment). After the recombinant adenoviruses were packaged, cloned, amplified, purified and titrated, the hyperoxia-induced BPD model rats were developed as previously reported [14, 15]. The remaining experimental control conditions and operations were the same as those in the hyperoxia treatment group. The box was routinely opened for 30 min every day, and water and food were added and the litter was replaced. The mother rats were exchanged with the control group (to avoid the decreased feeding ability of mother rats because of oxygen toxicity). The rats in control group were placed in the same room, with the similar experimental control factors to those in the hyperoxia treatment group. Three newborn rats were randomly selected from the two groups by random number method at the 3rd, 7th and 14th days after the experiment began, and then received intraperitoneal injection of 90 mg/kg pentobarbital sodium for anesthesia. Next, the abdominal cavity was opened immediately, and the right lungs were taken out and placed in an RNase-free cryo vial (Eppendorf, Hamburg, Germany). After rapidly frozen with liquid nitrogen, the lungs were stored in a -80 °C refrigerator for subsequent reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. Then 40 g/L paraformaldehyde was slowly injected to the rats through the left bronchus until the apex of lung was inflated, placed in an embedding box, and added with 40 g/L paraformaldehyde solution for overnight fixation for subsequent detection.
2.4. Enzyme-linked immunosorbent (ELISA) assay.
The strips used in the experiment were equilibrated at room temperature for 20 min. Standard and sample wells were set separately, and 50 µL of standards (IL-1β, TNF-ɑ and IL-6) at different concentration was added into the standard wells respectively. Then 10 µL samples and were supplemented into the sample wells and 40 µL sample dilution was then added to the samples. The blank wells were not subject to treatment. Next, 100 µL of horse radish peroxidase (HRP)-labeled antibody to be detected was added to the standard wells and the sample wells respectively, and the blank wells were not subject to treatment. The wells were sealed with microplate sealers, followed by 60-min incubation at 37 °C. After the liquid was discarded, the experimental strips were washed in full-automatic washing machine. Then 50 µL of substrate A and B were added to each well, followed by 15-min incubation at 37 °C in subdued light. Subsequently, 50 µL of the stop buffer was added to each well and allowed to stand for 15 min, after which the OD value of each well was measured at a wavelength of 450 nm.
2.5. Hematoxylin-eosin (HE) staining.
The lung tissues of rats in each group were fixed with 4% paraformaldehyde for 24 h, dehydrated with 80%, 90% and 100% ethanol and n-butanol respectively, and immersed in a wax box at 60 °C. Following xylene dewaxing and hydration, the sections were first stained with hematoxylin (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) for 2 min, stained with eosin for 1 min, followed by gradient ethanol dehydration, xylene clearing, and neutral rubber fixing. Finally, the morphological changes of lung tissues were observed and analyzed under an optical microscope (XP-330, Bingyu Optical Instrument Co., Ltd., Shanghai, China).
2.6. Alveolar epithelial cell isolation using Immunomagnetic bead.
The fetal rats were taken out by cesarean section from the SD rats with a gestational age of 15 days under sterile condition and were transected at the chest, after which the lungs were taken out and put in pre-cooled phosphate buffer solution (PBS) to remove residual non-lung tissues. Digestion, filtration, centrifugation, and sorting were carried out according to the experimental operations. CD14 magnetic beads were added to the cells (20 µL/107 cells), mixed well, followed by 15-min culture at 4–8 °C. The cells were washed with buffer solution (1 mL/107 cells) and centrifuged at 1500 r/min for 10 min, with the supernatant completely removed. The cells were resuspended in 500 µL of buffer solution, and the cell suspension was added to a MS separation column. The unlabeled cells that had flowed out first were collected, which were negative cells. The MS separation column was washed with 1500 µL of buffer solution. The separation column was removed from the magnetic field and the cells retained on the column were quickly eluted with 1 mL of buffer solution. These cells were magnetically labeled positive cells. Under a modified Barthel microscope, more dark particles in the cytoplasm were visible with characteristic eosinophils observed, which presented with obvious microvilli in lamellar bodies and cell membranes. This indicated that type II alveolar epithelial cells in the fetal rats were successfully isolated.
2.7. Development of hyperoxia-provoked cell injury models.
Pulmonary epithelial cells after 2 days of growth were exposed to air (control) or hyperoxia. The cells exposed to air and hyperoxia were placed in a closed oxygen chamber with 21% oxygen volume fraction. The hyperoxic cells were further transfected with plasmids of miR-214 NC, miR-214 mimic, miR-214 NC + PlGF vector, miR-214 NC + PlGF, and miR-214 mimic + PlGF. Then the recombinant adenoviruses were packaged, cloned, amplified, purified and titrated. The pulmonary epithelial cells were infected with these adonoviruses and placed in a closed oxygen chamber with 85% oxygen volume fraction.
2.8. Transmission electron microscope.
After the pulmonary epithelial cells were centrifuged at 10,000 rpm for 10 min, the supernatant was discarded and the cells were fixed in 4% glutaraldehyde at 4 °C for more than 2 h. The cells were fixed with 1% osmium tetroxide for 2 h, and dehydrated with gradient ethanol and acetone. The cells were then immersed with epoxy resin, embedded and polymerized, and then made into semi-thin sections with a thickness of 0.5 µm. The sections were positioned under a microscope, stained with uranyl acetate and lead citrate, and observed and photographed under a transmission electron microscope (H-7500).
2.9. RNA binding protein immunoprecipitation (RIP).
The pulmonary epithelial cells were added with 10 mL of PBS, scraped off with a cell scraper and transferred into a centrifuge tube. The cells were centrifuged at 1500 rpm for 5 min at 4 °C, then added with RIP Lysis Buffer, mechanically dissociated into and mixed thoroughly, and lysed on ice for 5 min to prepare cell lysate. Next, 50 µL of magnetic beads were added into each tube and mixed well, after which 0.5 mL RIP Wash Buffer was added to rinse the magnetic beads, and 100 µL RIP Wash Buffer was added to resuspend beads. Then 5 µg of Ago2 antibody was added to the tubes and incubated in rotation for 30 min at room temperature. The supernatant was discarded and the beads were washed twice with 0.5 mL RIP Wash Buffer for subsequent experiments. 900 µL of RIP Immunoprecipitation Buffer was added to the magnetic bead-antibody mixture, after which the centrifugation was carried out at 14000 rpm for 10 min at 4 °C. The supernatant was collected and transferred into a new eppendorf (EP) tube, and then 100 µL of the supernatant was taken into the tube containing the magnetic bead-antibody. 1.0 mL served as the final volume of the immunoprecipitation reaction, and incubation was conducted overnight at 4 °C. Then the magnetic beads were washed 6 times with 0.5 mL RIP Wash Buffer, 150 µL of proteinase K buffer was added, and the RNA was purified by 30 min of incubation at 55 °C. The RNA was extracted by a conventional TRIzol method followed by RT-qPCR detection.
2.10. Giemsa staining.
The rats were anesthetized by intraperitoneal injection of 1% sodium pentobarbital solution, and fixed on a simple operation table. The thoracic cavities of rats were exposed after being euthanized by exsanguination, after which the pleural tissues around the trachea were bluntly separated, the trachea was fully exposed and a needle was used to stab at the 1/3 of the trachea. The tip of the 18G indwelling needle was previously trimmed into a hernia type, and the tracheal intubation was performed along the trial point and ligated with a surgical line. 1 mL of pre-cooled sterile normal saline was used to perfuse the lung tissues of the rats for three times. The bronchoalveolar lavage fluid (BALF) was collected and stored in a pre-cooled EP tube and subsequently centrifuged at 1200 r/min for 20 min at 4 °C. The supernatant was stored in a -80 °C freezer for subsequent use. The cell precipitate was resuspended in 100 µL of PBS, smeared with 50 µL of the suspension, and stained with Swiss Giemsa. The number of neutrophils was counted under an oil microscope and the total number of cells in 10 µL of the suspension was counted by a hemocytometer.
2.11. Immunohistochemistry.
The specimen was fixed in 10% formaldehyde, followed by preparation of 4 µm paraffin-embedded sections. Then the tissue sections were placed in a 60 °C oven for 1 h, dewaxed by xylene in conventional manner, and then dehydrated with gradient alcohol, followed by 30-min culture in 3% H2O2 (Sigma-Aldrich, Shanghai, China) at 37 °C. Then the tissue sections were boiled in 0.1 M citrate buffer solution for 20 min at 95 °C, and cooled to room temperature. The sections were blocked with 10% normal goat serum for 10 min at 37 °C followed by rabbit anti-eNOS (AF0096, Affinity) incubation at 4 °C for 12 h. The sections were treated with biotin-labeled goat anti-rabbit secondary antibody at room temperature for 10 min. After thoroughly washed, S-A/HRP was added to react at room temperature for 10 min. The tissue sections were developed using diaminobenzidine (DAB) away from light at room temperature for 8 min. Then the tissues were counter-stained with hematoxylin, dehydrated, cleared, blocked, and observed under a light microscope. The number of positive cells was counted using image analysis software (Nikon Corporation, Tokyo, Japan). Five fields of equal area were selected from each section, and the proportion of positive cells was calculated with the average value calculated. The cells with apparent brown or brownish yellow particles in the cytoplasm were positive cells.
2.12. Dual luciferase reporter gene assay.
The artificially synthesized PlGF 3' untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT) of PlGF and constructed into the pMIR-reporter reporter plasmid. The correctly sequenced luciferase reporter plasmids WT and MUT were respectively co-transfected with miR-214 mimic and miR-214 NC into HEK293T cells. After 48 h of transfection, cells were collected and lysed, and the luciferase activity was measured using Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA).
2.13. RT-qPCR assay.
Total RNA was extracted from cells using the Trizol kit (Invitrogen Inc., Carlsbad, CA, USA) and reverse transcribed into cDNA according to the instructions of TaqMan MicroRNA Assays Reverse Transcription Primer (4427975, Applied Bio-systems, Foster City, CA,USA). The reverse transcribed cDNA was diluted to 50 ng/µL. The expression of relevant genes was analyzed normalized to U6 (for miRNA) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (for other genes). The fold changes were calculated using relative quantification (the 2−△△Ct method). The primers used are shown in Table 1.
TABLE 1
Primer sequences of RT-qPCR
Gene
|
Primer sequences
|
GAPDH
|
F: TCTGATTTGGTCGTATTGGG
|
GAPDH
|
R: GGAAGATGGTGATGGGATT
|
U6 F
|
F: CTCGCTTCGGCAGCACA
|
U6 R
|
R: AACGCTTCACGAATTTGCGT
|
hsa-miR-214
|
F: CACCTTTCTCCCTTTCCCCTTACTCTCC
|
hsa-miR-214
|
R: TTTCATAGGCACCACTCACTTTAC
|
mmu-miR-214
|
F: ACACTCCAGCTGGGACAGCAGGCACAGACA
|
mmu-miR-214
|
R: TGGTGTCGTGGAGTCG
|
PlGF
|
F: CGGAATTCCACCATGCCGGTCATGAGGCTGTTCCCT
|
PlGF
|
R: CCAGATCTTACCTCCGGGGAACAGCATCGCC
|
eNOS
|
F: AGACGGACCCAAGTTTCCTC
|
Enos
|
R: TCCCGAGCATCAAATACCTG
|
Bcl-2
|
F: TTTCTCCTGGCTGTCTCTGAA
|
Bcl-2
|
R: TGTGTGTGTGTGTGTTCTGCT
|
c-myc
|
F: ACAGCGTCTGCTCCACCT
|
c-myc
|
R: CTGCGTAGTTGTGCTGATGT
|
Note: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PlGF, placental growth factor (PlGF); eNOS, endothelial nitric-oxide synthase; F, forward; R, reverse.
|
2.14. Western blot assay.
The lung tissues or cells were added with lysis buffer, shaken on a vortex agitator, and centrifuged at 12000 r/min for 30 min at 4 °C to remove tissues or cell debris. The supernatant was taken and the total protein concentration was measured using a bicinchoninic acid (BCA) kit. 50 µg of protein was subjected to 10% sodium dodecyl sulfate polyacrylamide gel electropheresis and electroblotted to polyvinylidene fluoride membranes by wet transfer method. After being blocked with 5% skim milk powder at room temperature for 1 h, the membrane was then probed with diluted primary antibodies from CST (Danvers, MA, USA) against Survivin (# 2808S), GAPDH (#5174), B-cell lymphoma-2 (Bcl-2, #3498) and c-myc (#13987), and primary antibodies from Abcam (Cambridge, UK) against PlGF (ab74778), E-cadherin (ab11512) and α-smooth muscle actin (α-SMA, ab32575), and then diluted based on the manuals. The membrane was re-probed with HRP-labeled secondary antibody for 1 h. The membrane was placed on a clean glass plate. The immunocomplexes on the membrane were visualized using enhanced chemiluminescence (ECL) fluorescence detection kit (BB-3501, Amersham, Little Chalfont, UK), and band intensities were quantified using a Bio-Rad image analysis system and Quantity One v4.6.2 software. The ratio of the gray value of the target band to GAPDH was representative of the relative protein expression.
2.15. Statistical analysis.
Data analyses were conducted using SPSS 21.0 (IBM Corp, Armonk, NY, USA). Measurement data were described using mean ± standard deviation. An unpaired t-test was conducted to compare the data obeying normal distribution and homogeneity of variance between two groups. Data comparisons between multiple groups were performed using one-way analysis of variance (ANOVA), followed by a Tukey’s multiple comparisons posttest. Data comparisons at different time points were performed by repeated measures ANOVA, followed by a Bonferroni post hoc test for multiple comparisons. Pearson correlation was used to analyze the relationship between two indicators. A value of p < 0.05 was considered to be statistically significant.