Endo-β-N-acetylglucosaminidase EndoE from infant gut Enterococcus faecalis neutralizes SARS-CoV-2 by interacting with the viral spike protein

doi:10.21203/rs.3.rs-4807732/v1

Download PDF

Article

Endo-β-N-acetylglucosaminidase EndoE from infant gut Enterococcus faecalis neutralizes SARS-CoV-2 by interacting with the viral spike protein

https://doi.org/10.21203/rs.3.rs-4807732/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is extensively N-glycosylated, and unlike the receptor-binding domain of the S1 subunit which undergoes frequent mutations, the glycosylation sites remain conserved across most variants of concern. In this study, we cloned and purified EndoE, an endo-β-N-acetylglucosaminidase enzyme from an Enterococcus faecalis strain isolated in our laboratory (E8 strain). The purified EndoE effectively removed glycans from the S1 protein of SARS-CoV-2 spike. We constructed a catalytically inactive mutant form of EndoE, termed EndoE (Mut). Both wild-type EndoE and the EndoE (Mut) demonstrated neutralizing activity against SARS-CoV-2 S pseudotyped virus infection, with IC₅₀ values of 81.26 ± 8.42 nM and 63.15 ± 5.06 nM, respectively. Enzyme-linked immunosorbent assay revealed that both forms of EndoE bound to the S1 protein. Moreover, commercial EndoH enzyme, which also cleaves N-glycosylation, did not exhibit neutralizing activity against SARS-CoV-2 S pseudotyped virus at any tested concentration. In contrast, the plant lectin Concanavalin A demonstrated the most potent neutralization ability, with an IC₅₀ of 40.89 ± 24.04 nM. Importantly, neither form of EndoE displayed toxicity even at the highest tested concentration (6,250 nM), whereas Concanavalin A exhibited toxicity to cells at a concentration as low as 157 nM. These findings shed light on the role of glycosidases in SARS-CoV-2 infection and offer a novel avenue for the development of antiviral strategies.

Biological sciences/Microbiology

Biological sciences/Microbiology/Applied microbiology

SARS-CoV-2

Enterococcus faecalis

neutralization

endo-β-N-acetylglucosaminidase

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the virus responsible for COVID-19, primarily infects the respiratory system, but it can also infect other organs in the body, including the gastrointestinal (GI) tract¹. Gastrointestinal symptoms and complications related to SARS-CoV-2 infection have been reported in a considerable percentage of COVID-19 patients, including diarrhea, vomiting, nausea and abdominal pain². Moreover, SARS-CoV-2 RNA has been found in the stool of patients with COVID-19³, suggesting that the virus can potentially be transmitted through the fecal-oral route⁴. SARS-CoV-2 infects host cells by attaching to the angiotensin-converting enzyme-2 (ACE2) receptor, which is notably abundant in the small intestine and colon⁵. This observation is supported by studies involving small intestinal organoids, further underscoring the possibility of viral infiltration into enterocytes⁶ and proposing a plausible mechanism behind gastrointestinal symptoms associated with SARS-CoV-2 infection. Host cell entry of SARS-CoV-2 is mediated by the spike (S) protein, a trimeric type I membrane protein heavily glycosylated with 22 N-linked glycans on each monomer⁷. Each S monomer is composed of two subunits, S1 and S2. The S1 subunit is responsible for recognition and binding to ACE2⁸, while the S2 subunit mediates viral cell membrane fusion⁹. The S1 glycoprotein shows a prevalence of high mannose and hybrid structures^10,11 and it has been shown that specific N-glycan sites play an essential structural role in modulating the conformational dynamics of the spike’s receptor binding domain (RBD), which is responsible for ACE2 recognition in host cells¹².

Due to the global COVID-19 pandemic caused by SARS-CoV-2, a great number of antiviral strategies have been developed to prevent viral infection. As binding of the S1 subunit to the ACE2 receptors is essential for viral infection, several approaches have involved targeting this subunit. One of the approaches comprises the use of neutralizing antibodies that bind to the S1 protein and block the recognition of the ACE2 receptors by the virus and, consequently, the adhesion to the host cells^13,14. However, mutations in S protein epitopes often lead to the emergence of variants that evade neutralizing antibodies. Unlike S protein epitopes, mutations in glycosylation sites across SARS-CoV-2 variants are not that frequent and N-glycosylation sites are conserved in almost all the SARS-CoV-2 variants of concern identified by the World Health Organization (WHO), particularly at the sites on the RBD¹¹. This makes the S1 glycan domain an ideal target for the development of strategies to prevent SARS-CoV-2 infection. Indeed, specifically designed lectins have been described to bind to N-glycans of the SARS-CoV-2 S protein, blocking viral entry and inhibiting viral replication in vitro¹⁵. Host cell infection by this virus has been shown to be inhibited by the mannose-specific lectins cyanovirin-N and griffithsin, the former inactivating SARS-CoV-2 pseudoviral particles in an irreversible manner¹⁶. The core fucosylation-specific Pholiota squarrosa lectin (PhoSL) and the human lectins CD209 antigen-like protein C (CD209c) and C-type lectin domain family 4 member G (Clec4g) strongly bind to the SARS-CoV-2 S protein and inhibit viral infection^17,18.

An observational study suggests that breastfeeding children show a reduced risk of COVID-19¹⁹. The mechanisms behind this effect are not yet known, but in general, the beneficial effects of human milk depend largely on biologically active components, including IgA, human milk oligosaccharides and microbiota^20,21. The intestinal microbiota of breastfed infants is a niche of glycoside hydrolases (GHs)^22,23 due to the presence of bacteria that exhibit a wide set of these enzymes to metabolize glycans and glycoconjugates present in human breast milk and intestinal epithelial cells. Owing to their ability to hydrolyze the glycan portion of glycoconjugates, these GHs might also modulate the glycosylation from the surface of microorganisms present in the intestinal epithelium, including bacterial and viral pathogens. Since the glycosylation of some pathogens plays a critical role in their interaction with intestinal epithelial cells^24,25, modification of the glycosylation state might have an effect on their adhesion. For example, it has been described that changes in glycosylation of glycoproteins present on the surface of the human immunodeficiency virus (HIV) might influence their binding to host cells²⁶. It has also been demonstrated that rotavirus with deglycosylated VP7 has reduced infectivity in MA104 cells compared to rotavirus with glycosylated VP7²⁷.

In this work, an endo-β-N-acetylglucosaminidase EndoE homolog was isolated from Enterococcus faecalis strain E8 associated with breastfed infant gut. The wild-type EndoE was able to deglycosylate the SARS-CoV-2 spike S1 protein. EndoE and its mutant showed neutralizing activity against SARS-CoV-2 S pseudotyped virus infection, and the antiviral capacity of EndoE and the mutant EndoE is possible due to its ability to bind the S1 glycoprotein probably via the attachment to the S1 glycans.

Detection and identification of glycosidase-producing bacteria from breast-fed infant feces.

A fecal sample mix of breast-fed infants was plated on non-selective agar media supplemented with the chromogenic substrates 5-bromo-4-chloro-3-indoxyl(X)-α-L-fucopyranoside (X-Fuc), X-β-D-galactopyranoside (X-Gal) or X-β-N-acetyl-D-glucosamine (X-GlcNAc) aimed to detect bacteria expressing glycosyl hydrolases. Fifty blue colonies from each chromogenic substrate were randomly selected. They were regarded as bacteria with α-L-fucosidase, β-galactosidase or β-N-acetylglucosaminidase, respectively, which would include bacteria with either extra- and/or intra-cellular glycosidases. The selected isolates were subjected to RAPD-PCR analysis and at least one representative of each band pattern was kept for subsequent species identification. Based on partial 16S rRNA gene sequencing, the isolates from the plates containing X-Fuc were identified as Bifidobacterium dentium (E13, E14 and E53), Bifidobacterium longum (E15, E16, E17, E18, E19, E20, E22 and E54), Klebsiella oxitoca (E28 and E29) and Klebsiella pneumoniae (E27 and E55). The bacterial isolates from the plates containing X-Gal were identified as Actinomyces urogenitalis (E24), B. dentium (E23), B. longum (E1 and E2), Enterococcus faecalis (E8), K. oxitoca (E6, E7, E11 and E12) and K. pneumoniae (E3 and E10). The isolates from the plates with X-GlcNAc were identified as B. longum (E4, E33, E35, E37, E38, E39, E40, E42, E43, E45, E46, E47, E48, E51, E52 and E56), E. faecalis (E41, E44 and E50) and K. pneumoniae (E30). Since Enterococcus genus contains species with probiotic properties^28–30, the isolates of this genus were further analyzed. RAPD-PCR analysis has been shown as an adequate molecular tool to differentiate lactic acid bacteria at the strain level^31,32. Based on the different RAPD-PCR band patterns, E. faecalis E8 and E41 strains (supplementary Figure S1) were selected for extracellular glycosidase assays as shown below.

Extracellular endoglycosidase activity on selected E. faecalis strains.

The bacterial strains studied here were analyzed for extracellular glycosidase activity towards the glycoproteins bovine ribonuclease B (RNase B) and bovine lactoferrin. These proteins contain one and five N-glycosylation sites, respectively^33,34, and the mobility in SDS-PAGE experiments is lower than their corresponding deglycosylated forms. Incubation of E. faecalis strains E8 and E41 with RNase B (Fig. 1a) led to the total deglycosylation of this glycoprotein after overnight incubation. Bovine lactoferrin was partially deglycosylated after overnight incubation with E8 and E41 strains (Fig. 1b). Previous results have shown that E. faecalis secretes the endo-β-N-acetylglucosaminidase EndoE with activity on high-mannose-type and complex-type N-glycans³⁵.

Endo-β- N -acetylglucosaminidase EndoE from E. faecalis strain E8 deglycosylates the SARS-CoV-2 Spike S1 subunit.

Based on gene ndoE sequence (GenBank accession number AY376354), which encodes for the endo-β-N-acetylglucosaminidase EndoE from E. faecalis strain HER1044³⁵, specific primers were used to search for a homolog of that gene in the E. faecalis E8 isolate. The results showed that this strain contains a gene homolog to ndoE and the predicted amino acid sequence of the mature protein is 99% identical to EndoE. The ndoE gene homolog from strain E8 was cloned in Escherichia coli and the corresponding product was purified as a 6x(His)-tagged fusion protein. This showed a molecular mass of 88 kDa (Fig. 2a), in agreement with the calculated mass of the 6x(His)-EndoE homolog (89,581 kDa). EndoE has previously demonstrated endo-β-N-acetylglucosaminidase activity on the glycoproteins IgG and RNase B³⁵. As expected, the EndoE homolog expressed here also showed activity on RNase B, as shown by a shift of the native glycoprotein relative to the control on the SDS-PAGE gel (Fig. 2b). It has been previously described that the catalytic residues D184 and E186 in the GH18 domain of EndoE are involved in the removal of N-linked glycans from glycoproteins³⁶. To determine whether the function of those residues is conserved in the EndoE homolog protein characterized here, site-directed mutagenesis was used to construct an EndoE double mutant enzyme, EndoE (Mut), for both catalytic residues (D184A and E186L). The EndoE (Mut) exhibited no hydrolytic activity against RNase B, as no shift was observed with respect to the control (Fig. 2b).

To investigate the glycan hydrolyzing activity of EndoE on the SARS-CoV-2 Spike S1 subunit, this protein was incubated with EndoE wild-type (WT). Western-blot analysis showed staining with concanavalin A only in the control S1, but not in the S1 protein incubated with EndoE (Fig. 3a). Furthermore, a shift in the mobility of S1 protein was observed when treated with EndoE (WT) (Fig. 3b). These results confirm that EndoE is able to deglycosylate SARS-CoV-2 S1 protein.

Endo-β- N -acetylglucosaminidase EndoE from E. faecalis strain E8 has potent antiviral activity against SARS-CoV-2 pseudovirus infection.

As glycosylation of the SARS-CoV-2 S protein has been shown to play an important role in viral infection¹², the EndoE glycosidase characterized here was evaluated for its ability to inhibit S-mediated infection using a surrogate SARS-CoV-2 S pseudotyped virus-based neutralization assay, which faithfully replicates entry processes of authentic SARS-CoV-2³⁷ (Fig. 4). EndoE (WT) and the EndoE (Mut) demonstrated neutralizing activity against S pseudotyped vesicular stomatitis virus (VSV-S) infection with IC₅₀ values of 81.26 ± 8.42 nM and 63.15 ± 5.06 nM, respectively (Fig. 4a and 4b). The glycosidase EndoH did not show any inhibitory effect in this assay (91.18 ± 0.56% infectivity when the cells were treated with 1,380 nM EndoH and 90.89 ± 0.24 infectivity when the cells were treated with 138 nM EndoH). Furthermore, the lectin Concanavalin A (ConA) also presented antiviral effect with a IC₅₀ of 40.89 ± 24.04 nM (Fig. 4c).

To ensure the observed effects were not due to toxicity, we also analyzed the effect of EndoE (WT) (Fig. 5a) and EndoE (Mut) (Fig. 5b), as well as ConA (Fig. 5c), on the viability of A549-ACE2-TMPRSS2 cells. Viability does not seem to be affected by WT or mutant EndoE even at doses of 6,250 nM, but treatment with ConA significantly reduces viability at doses of 157 nM or higher. Hence, the observed effect is unlikely to stem from toxicity.

Endo-β- N -acetylglucosaminidase EndoE from E. faecalis strain E8 binds to the SARS-CoV-2 Spike S1 subunit.

Previous studies have shown that catalytic residue mutants of EndoE bind to human lactoferrin³⁸. To investigate if EndoE interacts with SARS-CoV-2 Spike S1 protein, ELISA assays with EndoE (WT) and EndoE (Mut) were performed (Fig. 6). The results revealed that both, EndoE (WT) and EndoE (Mut), bind to the S1 glycoprotein. Interestingly, the binding of the EndoE (Mut) was significantly higher than that of EndoE (WT) (p < 0.01). Therefore, EndoE might possess a glycan-binding activity that is probably associated to its catalytic site, as a canonical carbohydrate-binding module (CBM) is not present in EndoE³⁶. S1 protein does not bind to EndoH as the binding levels are similar to the negative control with buffer only (Fig. 6).

Since EndoH has glycosidase activity but not the ability to bind on the SARS-CoV-2 S1 subunit and EndoE (WT) showed both activities on S1 protein, these results suggest that possibly the binding activity and not the glycosidase activity of EndoE is responsible for the inhibitory effect of the pseudotyped virus infection. Additionally, the lower IC₅₀ value observed for EndoE (Mut) compared to EndoE (WT) is consistent with the higher binding of EndoE (Mut) to S1 protein shown above. To further test this hypothesis, the pseudotyped virus-based neutralization assay was also carried out using the lectin Concanavalin A (ConA), which has a high affinity for binding mannose core in N-glycans³⁹. The results showed that ConA has a strong inhibition with an IC₅₀ of 40.89 ± 24.04 nM (Fig. 4c). Other mannose-specific lectins, such as cyanovirin-N and griffithsin, have previously been demonstrated to be effective against SARS-CoV-2 infection by leading to irreversible inactivation of pseudoviral particles¹⁶.

Glycosylation is an important process in the biology of many viruses and plays a critical role in the interaction of viruses with host cells^24,25,40. SARS-CoV-2 recognizes human angiotensin-converting enzyme 2 (ACE2) through the S1 subunit of the S protein, which is highly N-glycosylated¹¹. Many approaches to prevent SARS-CoV-2 infection are focused on targeting this subunit, including neutralizing antibodies that bind to the protein domain of the S1 subunit cells^13,14, and lectins that bind to the glycan portion of the S1 protein, both inhibiting the adhesion of SARS-CoV-2 to host cells^16–18. The capacity of viruses to infect host cells can also be affected by removing or modifying the glycosylation of their surface, as previously described for HIV and Influenza virus^26,41. In this work, endo-β-N-acetylglucosaminidase and S1 binding activities against the S1 subunit of the SARS-CoV-2 S protein have been demonstrated for the EndoE glycosidase isolated from E. faecalis E8. Interestingly, EndoE neutralized the SARS-CoV-2 S pseudotyped viruses, and it was the binding and not the glycosyl hydrolase activity of EndoE the responsible for this antiviral effect. In previous studies, different lectins exhibited a dose-dependent inhibition of SARS-CoV-2 infection, with IC₅₀ values ranging from picomolar to micromolar concentration^16–18. Concanavalin A (ConA), a model lectin with a high affinity for the mannose core in N-glycans³⁹, was tested here and it inhibited SARS-CoV-2 S pseudotyped virus with an IC₅₀ of 40.89 ± 24.04 nM. The IC₅₀ obtained is lower than the IC₅₀ value of 63.15 ± 5.06 nM obtained for EndoE (Mut), a mutant enzyme with binding capacity but lacking endo-β-N-acetylglucosaminidase activity against S1 glycoprotein. The virus-neutralizing capacity of ConA is higher than that determined for EndoE. However, cytotoxic effects on mammalian cells have been reported for several lectins, including ConA^42,43. Interestingly, there is no toxic effect of EndoE (Mut) at a dose greater than 100 times that of their IC₅₀.

EndoE is a multi-modular enzyme containing two GH domains: a GH18 domain with endo-β-1,4-N-acetylglucosaminidase activity and a GH20 domain with exo-β-1,2-N-acetylglucosaminidase activity³⁶. Both GH motifs cooperatively hydrolyze N-glycosylated glycoproteins. EndoE-GH20 cleaves the non-reducing terminal GlcNAc residues from complex-type N-glycans, generating smaller glycoforms, and EndoE-GH18 cleaves the core of the N-linked glycans, releasing whole N-glycans. Unlike these catalytic activities, which have been already studied in great detail³⁶, the EndoE capacity to recognize and bind to the substrate is not as well known. A binding activity for EndoE has been demonstrated here against the S1 subunit domain of SARS-CoV-2 S protein. In addition to catalytic domains, some GHs present carbohydrate-binding modules (CBM). The predicted function of these motifs is to promote the interaction of the enzyme with glycan structures on cell surfaces, extracellular matrices or other carbohydrate-containing molecules, and it is suggested that they improve the catalytic function of the GHs⁴⁴. Some GH18 and GH20 glycosidases have been described to contain different CBMs⁴⁴, although little is known about the structure of these domains. The chitinase B from Serratia marcescens belonging to the GH18 family contains a C-terminal chitin-binding domain (ChBD) in addition to the catalytic domain (SmGH18), classified as a family XII ChiBD⁴⁵. This ChBD is described to be interacting with the catalytic domain, contributing to substrate binding. No CBMs have been found for EndoE³⁶. Interestingly, EndoE (Mut) binds stronger to S1 subunit than EndoE (WT). This observation aligns with previous studies that have shown little or no interaction between active endoglycosidases and their substrate^38,46. Moreover, modification of the active site of glycosidases can lead to a loss of hydrolytic activity and an increase in the binding capacity. Thus, a single amino acid substitution in the catalytic center of a chitotriosidase belonging to the GH18 family resulted in a loss of enzymatic activity and conferred a strong chitin-binding ability⁴⁷.

The gastrointestinal tract of humans harbors a large and complex population of commensal microorganisms, including bacteria, viruses, fungi and protozoan. SARS-CoV-2, being mainly a respiratory but also an enteric pathogen, interacts with them producing beneficial or harmful results to the host⁴⁸. Recent studies demonstrated the beneficial effects of probiotics against this virus infection^49,50. The mechanisms of action of probiotics include the promotion of mucosal immunity, modulation of the gut microbiota composition and regulation of intestinal barrier function^51,52. In this work, bacteria with extracellular glycosidase activity were isolated from breastfed infant feces. Among the isolated species, some strains belonging to E. faecalis species, showed extracellular endo-β-N-acetylglucosaminidase activity, hydrolyzing N-glycans from glycoproteins. This activity has been previously characterized in different bacteria, including E. faecalis strains^{35,38,53–55}. Whether the Enterococcus strains isolated here expressing extracellular endo-β-N-acetylglucosaminidase enzymes would have a neutralizing effect against SARS-CoV-2 in the infant gastrointestinal tract needs further investigation. The work presented here gives insight into the role of GHs from the intestinal microbiota in viral infections and opens new avenues for antiviral strategy development.

Bacteria isolation from infant fecal samples with glycoside hydrolase activity on solid media

Stool samples from healthy 1 to 3-month-old breastfed infants were collected and stored at 4ºC under anaerobic conditions until arrival to the laboratory. Samples were then mixed with Brain Heart Infusion medium (BHI), 20% of skimmed milk and 0.1% of cysteine and stored at – 80ºC. Serial dilutions of stool samples were plated on Man, Rogosa and Sharp medium (MRS, Difco), Brain Heart Infusion (BHI, Condalab) and Wilkins-Chalgren (Oxoid) 1.5% agar plates with 5-bromo-4-chloro-3-indoxyl(X)-α-L-fucopyranoside (X-Fuc), X-β-D-galactopyranoside (X-Gal) or X-β-N-acetyl-D-glucosamine (X-GlcNAc) and grown at 37ºC under anaerobic conditions. Bacteria with glycosidic activity hydrolyze these compounds, producing a blue precipitate. Bacterial colonies that appeared with blue color were selected and subjected to randomly amplified polymorphic DNA (RAPD) analysis as previously described^31,32, using the primer MCV (AGTCAGCCAC). The reaction products were analyzed by agarose gel electrophoresis, selecting representative isolates based on their different pattern bands. 16S rRNA gene of the selected isolates was amplified by PCR using the primers 27F (AGAGTTTGATCCTGGCTCAG) and 924R (CTTGTGCGGGCCCCCGTCAATTC) or 1942R (GGTTACCTTGTTACGACTT) and cells from the colonies as a template. The PCR products were sequenced by Eurofins Genomics (http://www.eurofinsgenomics.com) and BLAST searches of the obtained sequences were performed to identify each isolate.

Glycosidase activity against the glycoproteins RNAse B and lactoferrin in bacterial whole cells

Enterococcus strains were grown in MRS plates and colonies were suspended in filter-sterilized 50 mM sodium phosphate buffer pH 7.5 to an OD₅₉₅ of 0.3, as described by Roberts G. et al., 2000⁵³. 200 µl of MRS basal medium supplemented with 5 mg mL^− 1 bovine RNAse B (Sigma) or bovine lactoferrin (Friesland Campina Domo) was inoculated with 5% (vol/vol) of bacterial suspension and incubated overnight at 37ºC in a 96-well plate. In both experiments, a non-inoculated MRS basal medium supplemented with RNAse B or lactoferrin was added as a negative control. At the end of the incubation period, the cultures were centrifuged and the supernatants were stored at -20°C. Supernatants containing 3 µg of RNAse B or 1 µg of lactoferrin were placed in Laemmli loading buffer, heated at 100°C for 10 min, and analyzed on 15 and 10% SDS-PAGE gels, respectively. Both RNAse B and lactoferrin gels were stained with Coomassie brilliant blue.

Expression and purification of His-tagged EndoE

Total DNA was isolated from E. faecalis E8 using the MasterPure DNA extraction Kit (Epicentre). The coding region of ndoE was amplified by PCR using genomic DNA from E. faecalis E8 as a template, Phusion High-Fidelity DNA polymerase and the designed primer pairs F1 (5’TTTTGGATCCGCCAATGAGCCGACCCAAG3’) and R1 (5’TTTTAAGCTTCTAGTGATTTTTAACCACCATATA3’) with restriction sites (underlined) for BamHI and HindIII (Thermo) added to the 5′ and 3’ ends. The PCR fragment was digested with the specific restriction enzymes and cloned into a pQE80L vector (Qiagen) cleaved with the same enzymes. The resulting plasmid (pQE-EndoE) was used to transform Escherichia coli DH10B by heat shocking at 42ºC for 45 seconds and transformants were selected with ampicillin (100 µg mL^− 1). The insert sequence was confirmed by DNA sequencing (Eurofins Genomics) and one clone with the correct sequence was cultured overnight in 250 mL of Luria-Bertani medium (Oxoid) at 37°C with agitation. When the culture reached an OD₅₉₅ of 0.7, isopropyl-β-D-1-thiogalactopyranoside (IPTG) 0.2 mM was added for protein induction and incubation was continued at 25ºC for 4 h. Cells were harvested by centrifugation and resuspended in lysis buffer (Tris-HCl 50 mM, pH 7.4; lysozyme, 1mg mL^− 1; dithiothreitol, 1mM; phenylmethylsulphonyl fluoride, 1 mM) for 30 min at room temperature. After incubation, cells were sonicated and centrifugated and the supernatants were collected. The recombinant proteins were purified as previously described⁵⁶. SDS-PAGE was used to determine the fractions containing the proteins of interest, which were kept frozen at − 80°C with 20% glycerol. Protein concentrations were determined with the Protein Assay Dye Reagent Concentrate (BioRad).

EndoE mutant construction by site-directed mutagenesis

A double-step PCR was performed using the plasmid pQE-EndoE, F1 and R1 flanking primers for ndoE gene and intermediate and complementary mutagenic primers F2 (5’GTTAGATATTGCCATGCTAACTCGTCC3’) and R2 (5’GGACGAGTTAGCATGGCAATATCTAAC3’) with the nucleotide changed underlined³⁰. Partial fragments of the ndoE gene with the mutated nucleotides were amplified using the Phusion High-Fidelity DNA polymerase (Thermo) with F1 or R1 and R2 or F2 mutagenic primer, respectively, and pQE-EndoE plasmid as a template. An overlap PCR was then performed using both PCR fragments as a template and the flanking primers F1 and R1. The PCR product was digested with BamHI and HindIII restriction enzymes and cloned into pQE80L vector cleaved with the same enzymes. The resulting plasmid (pQE-EndoE-Mut) was used to transform E.coli DH10B as described above. One clone with the mutated nucleotides confirmed by DNA sequencing was selected and the EndoE (Mut) was expressed and purified as described above for EndoE (WT).

EndoE enzyme activity

The activity of the purified His-tagged EndoE (WT) and EndoE (Mut) was assayed at 37°C with RNAse B 5mg mL^− 1. Reaction mixtures (15 µl) containing the substrate in 100 mM Tris-HCl buffer pH 7.0, were initiated by adding 1 µg and 10 µg of EndoE or EndoE mutant. Two hours and overnight reactions were mixed with 15 µl of 2X Laemmli loading buffer (v/v) and loaded into 15% SDS-PAGE gels, which were stained with Coomassie brilliant blue.

S1 protein expression and purification

The S1 protein from the hCoV-19/Wuhan/WIV04/2019 virus was cloned in the pFASTBAC1 vector for its expression in the Baculovirus Insect Cell expression system (Invitrogen). It was cloned from the amino acid 16 to the 672, with the last amino acid cloned located just before the furin cleavage site responsible of the S1/S2 breaking point. S1 domain was also N-terminal fused to a GP67 signal exportation to allow the recovery of the proteins from the grown media and 6xHis tagged at the C-terminal to facilitate its purification. The plasmid was transformed into DH10Bac cells to produce the recombinant baculoviruses following the manufacturer’s instructions.

The produced virus was used to infect Sf9 cells at a density of 1.5 x10⁶ cells mL^− 1 at a multiplicity of infection (MOI) of 2 for 72h at 27ºC with shaking at 120 rpm. After the infection, the cells were pelleted at 7,000 \(\:x\)g for 15 minutes at 4ºC and the supernatant was further centrifuged at 100.000 \(\:x\)g for 1 hour at 4ºC to remove the baculoviruses present in the medium. The pH of the medium was adjusted to 7.2 by adding PBS to a final concentration of 2X to facilitate protein purification. The S1 His-tagged protein was purified using a HisTrap Excel column (Cytiva) plugged into an ÄKTA Avant FPLC system (Cytiva). The medium flowed into the resin at 5 mL min^− 1, then the column was washed with 10 volumes of PBS containing 5 mM of imidazole and eluted in the same buffer containing 500 mM of imidazole. Finally, the imidazole was removed using the HiTrap Desalting column (Cytiva) in the same AKTA Avant using PBS as running buffer. The protein was finally concentrated to 5 mg mL^− 1 by ultrafiltration with an Amicon device (Millipore) with a 30 kDa cut-off point. The integrity and purity of the produced protein was analyzed by SDS-PAGE.

S1 Deglycosylation assay

S1 protein was incubated either with 5 µg of EndoE (WT) in PBS or only in PBS as a control, for 21 hours at 37 ºC. 1 µg of S1 proteins were separated by SDS-10% PAGE gel under reducing conditions and transferred onto PVDF membranes (Cytiva). The membrane was blocked with 3% BSA in PBS for 1 hour and was divided in two. One half was incubated with Concanavalin A (ConA) conjugated to HRP (Sigma-Aldrich) at 5 µg mL^− 1 in PBS containing 0.05% Tween 20 (PBS-T) overnight at 4ºC with gentle agitation. The other half of the membrane was incubated with 1:1,000 dilution in PBS-T of serum from hyperimmunized mice with S1 protein and incubated overnight at 4ºC with gentle agitation. After washing primary antibodies, the membrane was incubated with anti-Mouse-HRP (Millipore) diluted 1:10,000 in PBS-T for another hour at room temperature. Finally, the blots were developed with ECL (Cytiva) and captured in an Amersham Imager 680 (Cytiva).

Evaluation of antiviral activity using pseudotyped vesicular stomatitis virus

Neutralization assays were performed as previously described using a vesicular stomatitis virus (VSV) pseudotyped system encoding a green fluorescent protein (GFP) reporter^57–59. Briefly, VSV lacking its native glycoprotein and encoding GFP was pseudotyped with a codon-optimized Wuhan-Hu-1 S (VSV-S) in HEK293T cells (obtained from ATCC) and tittered by limiting dilution and quantification of green cells using A549-ACE2-TMPRSS2 cells (JCRB Cell Bank JCRB1819)⁶⁰. For antiviral assays, 1,000 focus-forming units (FFUs) of VSV-S2 were mixed with five-fold serial dilution of the glycosidases starting at a concentration of 250 ng ml^− 1 dilution and incubated at 37°C for 1 h. Subsequently, these FFUs were used to infect A549-ACE2-TMPRSS2 cells in a 96-well format. Finally, viral infection was quantified by measuring the number of GFP positive cells/GFP fluorescence after 18 h using a live cell microscope system (IncuCyteSX5; Sartorius). All assays were performed in triplicate. The concentration resulting in 50% virus neutralization (IC₅₀) values were calculated using drc package (version 3.0.1)⁶¹ in R (version 4.1.2) (R Foundation 2018). Plots were generated using ggplot2 (version 3.4.3)⁶².

A toxicity assay was performed to assess how the EndoE wild type, EndoE mutant and Concanavalin A (ConA) affect cell viability at different doses. For this, we quantified the effect of each protein on cell viability using crystal violet staining. Briefly, 24h after A549-ACE2-TMPRSS2 infection with the pseudotyped virus and treatment with EndoE (WT and Mut) or ConA, the cell media was removed, and cells were fixed with 100 µl of 10% paraformaldehyde for 15 minutes at room temperature. The fixation solution was removed and the monolayer was stained with a 2% crystal violet solution (Sigma) for 15 minutes. Excess stain was removed with water and the plates were left to dry for 24 h. Subsequently, cell confluence was calculated as the fraction of purple area (crystal violet stained) versus total well area using ImageJ2 (version 2.14.0/1.54f). Each sample was analyzed in triplicate and the mean and standard error values were calculated.

Binding Assay

Binding assays were performed in an ELISA format using the S1 protein. Briefly, for the binding assays 500 ng of glycosidases (EndoE (Wt), EndoE (Mut) and commercial EndoH) were coated in 100 µl carbonate/bicarbonate buffer pH 9.4 for 1 hour at 37ºC. The enzymes were coated in triplicate and wells without coating were used as negative controls. The plate was blocked with 200 µl per well of 3% BSA in PBS for 1 hour. 1 µg of S1 protein was diluted in 100 µl PBS-T and incubated for 1 hour at 37ºC and overnight at 4ºC. Unbound proteins were washed with PBS-T and 1:5,000 dilution of primary antibody (serum from hyperimmunized mice with S1 protein) was incubated for 1 hour at 37ºC. Later wells were washed with PBS-T and incubated with secondary antibody anti-Mouse-HRP (Millipore) diluted 1:5,000 in PBS-T for 1 hour at 37ºC. The reactions were developed with SigmaFast OPD (Merck) and measured at 492 nm in a Multiskan plate reader (Thermo Fischer). Each sample was analyzed in triplicate and the mean and standard error values were calculated.

Statistical analysis

Graphs and statistical analysis were obtained using GraphPad software (GraphPad Prism version 9.0 for MacOsx). The comparison between treated and untreated cells was done by applying an unpaired t-test with Welch’s correction, considering statistically significant p-values < 0.1.

Nucleotide sequence accession numbers

The partial nucleotide sequences of the 16S rRNA gene amplicons have been deposited at the GenBank database under the accession numbers OR608287 to OR608333, and the sequence of the gene encoding the endo-β-N-acetylglucosaminidase EndoE from E. faecalis strain E8 under the accession number OR596890.

Data availability statement: The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.

Competing Interests: The authors declare that they have no conflict of interest.

Author Contribution Statement: MJY, RG and JRD conceived and designed research. EVMG, SLN, RGR and AIAA, conducted experiments. MJY, EVMG, SLN, AIAA, RGR, RG and JRD analyzed data. EVMG, MJY and JRD wrote the manuscript. All authors read and approved the manuscript.

Ethical Statement: The use of human samples was approved by the Ethical Committee for Human Research of the University of Valencia. The study protocol has the registration number H1544010468380. Written informed consent was obtained from a parent of each of the subjects. All experiments were performed in accordance with relevant guidelines and regulations. The treatment of the human samples have been performed in accordance with the Declaration of Helsinki.

Founding statement: This work is part of the Grant PID2020-115403RB (C21 and C22) funded by the Spanish Ministry of Science and Innovation (MICIN)/Spanish State Research Agency (AEI)/10.13039/501100011033. The study was also supported by Valencian Government grant AICO/2021/033. RG acknowledged funding from grants SGL2021-03-009 and SGL2021-03-052 from European Union NextGenerationEU/PRTR through the CSIC Global Health Platform established by EU Council Regulation 2020/2094. EMM-G was supported by the Grant PRE2018-085768 funded by MICIN/AEI/10.13039/501100011033 and by “ESF Investing in your future”. SL-N was supported by the FPU22/00443 grant from the Spanish Ministry of Science and Innovation (MICIN). IATA-CSIC is a Centre of Excellence Severo Ochoa (CEX2021-001189-S MCIN/AEI/10.13039/501100011033).

Chen, T. H., Hsu, M. T., Lee, M. Y. & Chou, C. K. Gastrointestinal Involvement in SARS-CoV-2 Infection. Viruses 14, 1188 (2022).
Ouali, S. El & Achkar, J.-P. Gastrointestinal manifestations of COVID-19. COVID-19 Curbside consults (2021) doi:10.3949/ccjm.87a.ccc049.
Shing Cheung, K. et al. Gastrointestinal Manifestations of SARS-CoV-2 Infection and Virus Load in Fecal Samples From a Hong Kong Cohort: Systematic Review and Meta-analysis. Clinical-alimentary tract 159, 81–95 (2020).
Xiao, F. et al. Evidence for Gastrointestinal Infection of SARS-CoV-2. Gastroenterology 158, 1831 (2020).
Gaebler, C. et al. Evolution of Antibody Immunity to SARS-CoV-2. Nature 591, 639–644 (2021).
Lamers, M. M. et al. SARS-CoV-2 productively infects human gut enterocytes. Science (1979) 369, 50–54 (2020).
Shajahan, A., Pepi, L. E., Rouhani, D. S., Heiss, C. & Azadi, P. Glycosylation of SARS-CoV-2: structural and functional insights. Anal Bioanal Chem 413, 7179–7193 (2021).
Nagesha, S. N. et al. SARS-CoV 2 spike protein S1 subunit as an ideal target for stable vaccines: A bioinformatic study. Mater Today Proc 49, 904–912 (2022).
Xia, X. Domains and Functions of Spike Protein in SARS-Cov-2 in the Context of Vaccine Design. Viruses 13, (2021).
Brun, J. et al. Assessing Antigen Structural Integrity through Glycosylation Analysis of the SARS-CoV-2 Viral Spike. ACS Cent Sci 7, 586–593 (2021).
Shajahan, A., Pepi, L. E., Kumar, B., Murray, N. B. & Azadi, P. Site specific N-and O-glycosylation mapping of the spike proteins of SARS-CoV-2 variants of concern. Sci Rep 13, 10053 (2023).
Casalino, L. et al. Beyond shielding: The roles of glycans in the SARS-CoV-2 spike protein. ACS Cent Sci 6, 1722–1734 (2020).
Cao, Y. et al. Potent Neutralizing Antibodies against SARS-CoV-2 Identified by High-Throughput Single-Cell Sequencing of Convalescent Patients’ B Cells. doi:10.1016/j.cell.2020.05.025.
Enjuanes, L. et al. Nature of viruses and pandemics: Coronaviruses. Current Research in Immunology 3, 151 (2022).
Budhadev, D. et al. Polyvalent Nano-Lectin Potently Neutralizes SARS-CoV-2 by Targeting Glycans on the Viral Spike Protein. JACS Au 3, 1755–1766 (2023).
Nangarlia, A. et al. Irreversible Inactivation of SARS-CoV-2 by Lectin Engagement with Two Glycan Clusters on the Spike Protein. Biochemistry 62, 2115–2127 (2023).
Yamasaki, K. et al. Core fucose-specific Pholiota squarrosa lectin (PhoSL) as a potent broad-spectrum inhibitor of SARS-CoV-2 infection. FEBS J 290, 412–427 (2023).
Hoffmann, D. et al. Identification of lectin receptors for conserved SARS-CoV-2 glycosylation sites. EMBO J 40, e108375 (2021).
Verd, S. et al. Does breastfeeding protect children from COVID-19? An observational study from pediatric services in Majorca, Spain. Int Breastfeed J 16, 83 (2021).
Chutipongtanate, S., Morrow, A. L. & Newburg, D. S. Human Milk Oligosaccharides: Potential Applications in COVID-19. Biomedicines 10, 346 (2022).
Dimitroglou, M. et al. Anti-SARS-CoV-2 Immunoglobulins in Human Milk after Coronavirus Disease or Vaccination—Time Frame and Duration of Detection in Human Milk and Factors That Affect Their Titers: A Systematic Review. Nutrients 15, 1905 (2023).
Moya-Gonzálvez, E. M. et al. Infant Gut Microbial Metagenome Mining of α-l-Fucosidases with Activity on Fucosylated Human Milk Oligosaccharides and Glycoconjugates. Microbiol Spectr 10, e0177522 (2022).
Muñoz-Provencio, D. & Yebra, M. J. Gut Microbial Sialidases and Their Role in the Metabolism of Human Milk Sialylated Glycans. International Journal of Molecular Sciences vol. 24 9994 Preprint at https://doi.org/10.3390/ijms24129994 (2023).
Su, S., Gurney, K. b & Lee, B. Sugar and spice: viral envelope-DC-SIGN interactions in HIV pathogenesis. Curr HIV Res 1, 87–99 (2003).
Svensson, L. Identification of an outer capsid glycoprotein of human rotavirus by concanavalin A. J Gen Virol 65, 2183–2190 (1984).
Chand, S. et al. Glycosylation and oligomeric state of envelope protein might influence HIV-1 virion capture by α4β7 integrin. Virology 508, 199–212 (2017).
Mirazimi, A., Von Bonsdorff, C.-H. & Svensson, L. Effect of Brefeldin A on Rotavirus Assembly and Oligosaccharide Processing. Virology 217, 554–563 (1996).
Zommiti, M., Feuilloley, M. G. J. & Connil, N. Update of Probiotics in Human World: A Nonstop Source of Benefactions till the End of Time. Microorganisms 8, 1–33 (2020).
Chen, J., Chen, X. & Ho, C. L. Recent Development of Probiotic Bifidobacteria for Treating Human Diseases. Front Bioeng Biotechnol 9, 770248 (2021).
Krawczyk, B., Wityk, P., Gałęcka, M. & Michalik, M. The Many Faces of Enterococcus spp.—Commensal, Probiotic and Opportunistic Pathogen. Microorganisms 9, 1900 (2021).
Albesharat, R., Ehrmann, M. A., Korakli, M., Yazaji, S. & Vogel, R. F. Phenotypic and genotypic analyses of lactic acid bacteria in local fermented food, breast milk and faeces of mothers and their babies. Syst Appl Microbiol 34, 148–155 (2011).
Jarocki, P. et al. Comparison of various molecular methods for rapid differentiation of intestinal bifidobacteria at the species, subspecies and strain level. BMC Microbiol 16, 1–11 (2016).
An, H. J., Peavy, T. R., Hedrick, J. L. & Lebrilla, C. B. Determination of N-Glycosylation Sites and Site Heterogeneity in Glycoproteins. Anal Chem 75, 5628–5637 (2003).
Karav, S., German, J. B., Rouquié, C., Le Parc, A. & Barile, D. Studying Lactoferrin N-Glycosylation. Int J Mol Sci 18, 870 (2017).
Collin, M. & Fischetti, V. A. A Novel Secreted Endoglycosidase from Enterococcus faecalis with Activity on Human Immunoglobulin G and Ribonuclease B. Journal of Biological Chemistry 279, 22558–22570 (2004).
García-Alija, M. et al. Mechanism of cooperative N-glycan processing by the multi-modular endoglycosidase EndoE. Nat Commun 13, 1137 (2022).
Riepler, L. et al. Comparison of Four SARS-CoV-2 Neutralization Assays. Vaccines (Basel) 9, 13 (2020).
Garbe, J., Sjö Gren, J., Cosgrave, E. F. J., Struwe, W. B. & Bober, M. EndoE from Enterococcus faecalis Hydrolyzes the Glycans of the Biofilm Inhibiting Protein Lactoferrin and Mediates Growth. PLoS One 9, 91035 (2014).
Oinam, L. et al. Quantitative evaluation of glycan-binding specificity of recombinant concanavalin A produced in lettuce (Lactuca sativa). Biotechnol Bioeng 119, 1781–1791 (2022).
Peña‐Gil, N. et al. The Role of Host Glycobiology and Gut Microbiota in Rotavirus and Norovirus Infection, an Update. Int J Mol Sci 22, 13473 (2021).
Wang, C. C. et al. Glycans on influenza hemagglutinin affect receptor binding and immune response. Proc Natl Acad Sci U S A 106, 18137–18142 (2009).
Valadez-Vega, C. et al. Cytotoxic and Antiproliferative Effect of Tepary Bean Lectins on C33-A, MCF-7, SKNSH, and SW480 Cell Lines. Molecules 19, 9610–9627 (2014).
Ghoreschi, K., Muders, M. & Enders, G. A. Functional role of CD95 ligand in concanavalin A-induced intestinal intraepithelial lymphocyte cytotoxicity. Immunology 95, 566–571 (1998).
Sidar, A. et al. Carbohydrate Binding Modules: Diversity of Domain Architecture in Amylases and Cellulases From Filamentous Microorganisms. Front Bioeng Biotechnol 8, 871 (2020).
Van Aalten, D. M. F. et al. Structure of a two-domain chitotriosidase from Serratia marcescens at 1.9-Å resolution. PNAS 97, 5842–5847 (2000).
Allhorn, M., Olin, A. I., Nimmerjahn, F. & Collin, M. Human IgG/FcγR Interactions Are Modulated by Streptococcal IgG Glycan Hydrolysis. PLoS One 3, e1413 (2008).
Renkema, G. H. et al. Chitotriosidase, a chitinase, and the 39-kDa human cartilage glycoprotein, a chitin-binding lectin, are homologues of family 18 glycosyl hydrolases secreted by human macrophages. Eur J Biochem 251, 504–509 (1998).
Martín Giménez, V. M., Modrego, J., Gómez-Garre, D., Manucha, W. & De Las Heras, N. Gut Microbiota Dysbiosis in COVID-19: Modulation and Approaches for Prevention and Therapy. Int J Mol Sci 24, 12249 (2023).
Catinean, A., Sida, A., Silvestru, C. & Balan, G. G. Ongoing Treatment with a Spore-Based Probiotic Containing Five Strains of Bacillus Improves Outcomes of Mild COVID-19. Nutrients 15, 488 (2023).
Zhang, L. et al. Gut microbiota-derived synbiotic formula (SIM01) as a novel adjuvant therapy for COVID-19: An open-label pilot study. J Gastroenterol Hepatol 37, 823–831 (2022).
Liu, S., Zhao, Y., Feng, X. & Xu, H. SARS-CoV-2 infection threatening intestinal health: A review of potential mechanisms and treatment strategies. Crit Rev Food Sci Nutr 27, 1–19 (2022).
Tomkinson, S., Triscott, C., Schenk, E. & Foey, A. The Potential of Probiotics as Ingestible Adjuvants and Immune Modulators for Antiviral Immunity and Management of SARS-CoV-2 Infection and COVID-19. Pathogens vol. 12 928 Preprint at https://doi.org/10.3390/pathogens12070928 (2023).
Roberts, G., Tarelli, E., Homer, K. A., Philpott-Howard, J. & Beighton, D. Production of an endo-β-N-acetylglucosaminidase activity mediates growth of Enterococcus faecalis on a high-mannose-type glycoprotein. J Bacteriol 182, 882–890 (2000).
Roberts, G. et al. Distribution of endo-β-N-acetylglucosaminidase amongst enterococci. J Med Microbiol 50, 620–626 (2001).
Bøhle, L. A., Mathiesen, G., Vaaje-Kolstad, G. & Eijsink, V. G. H. An endo-β-N-acetylglucosaminidase from Enterococcus faecalis V583 responsible for the hydrolysis of high-mannose and hybrid-type N-linked glycans. FEMS Microbiol Lett 325, 123–129 (2011).
Bidart, G. N., Rodríguez-Díaz, J., Monedero, V. & Yebra, M. J. A unique gene cluster for the utilization of the mucosal and human milk-associated glycans galacto-N-biose and lacto-N-biose in Lactobacillus casei. Mol Microbiol 93, 521–538 (2014).
Rentsch, M. B. & Zimmer, G. A Vesicular Stomatitis Virus Replicon-Based Bioassay for the Rapid and Sensitive Determination of Multi-Species Type I Interferon. PLoS One 6, 25858 (2011).
Hanika, A. et al. Use of influenza C virus glycoprotein HEF for generation of vesicular stomatitis virus pseudotypes. Journal of General Virology 86, 1455–1465 (2005).
Hoffmann, M. et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 181, 271 (2020).
Martinez-Sobrido, L. et al. A Newly Engineered A549 Cell Line Expressing ACE2 and TMPRSS2 Is Highly Permissive to SARS-CoV-2, Including the Delta and Omicron Variants. Viruses 14, 1369 (2022).
Ritz, C., Baty, F., Streibig, J. C. & Gerhard, D. Dose-Response Analysis Using R. PLoS One 10, e0146021 (2015).
Wickham, H. Elegant Graphics for Data Analysis. (2016).

No competing interests reported.

Supplementarymaterials.pdf

Download PDF

Editorial decision: Revision requested
23 Aug, 2024
Reviews received at journal
08 Aug, 2024
Reviews received at journal
07 Aug, 2024
Reviewers agreed at journal
07 Aug, 2024
Reviewers agreed at journal
29 Jul, 2024
Reviewers invited by journal
29 Jul, 2024
Editor assigned by journal
29 Jul, 2024
Editor invited by journal
29 Jul, 2024
Submission checks completed at journal
27 Jul, 2024
First submitted to journal
26 Jul, 2024

You are reading this latest preprint version

Endo-β-N-acetylglucosaminidase EndoE from infant gut Enterococcus faecalis neutralizes SARS-CoV-2 by interacting with the viral spike protein

Status:

Version 1

Abstract

Figures

Introduction

Results

Discussion

Materials and Methods

Bacteria isolation from infant fecal samples with glycoside hydrolase activity on solid media

Glycosidase activity against the glycoproteins RNAse B and lactoferrin in bacterial whole cells

Expression and purification of His-tagged EndoE

EndoE mutant construction by site-directed mutagenesis

EndoE enzyme activity

S1 protein expression and purification

S1 Deglycosylation assay

Evaluation of antiviral activity using pseudotyped vesicular stomatitis virus

Binding Assay

Statistical analysis

Nucleotide sequence accession numbers

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1