Development of a Method to Evaluate Influenza Virus RNA-dependent RNA Polymerase Activity Through Real-time Reverse Transcription Polymerase Chain Reaction

doi:10.21203/rs.3.rs-482828/v1

Download PDF

Methodology

Development of a Method to Evaluate Influenza Virus RNA-dependent RNA Polymerase Activity Through Real-time Reverse Transcription Polymerase Chain Reaction

https://doi.org/10.21203/rs.3.rs-482828/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background: The development of an influenza RNA-dependent RNA polymerase (RdRp) inhibitor is required; therefore, a method for evaluating the activity of influenza RdRp needs to be developed. The current method uses an ultracentrifuge to separate viral particles and quantifies RdRp activity with radioisotope-labeled nucleosides, such as ³²P-GTP. This method requires special equipment and radioisotope management, so it cannot be implemented in all institutions. We have developed a method to evaluate the activity of RdRp without using ultracentrifugation and radioisotopes.

Results: RdRp was extracted from viral particles that were purified from the culture supernatant using magnetic beads. A strand-specific real-time reverse transcription polymerase chain reaction (RT-PCR) method was developed based on the reverse transcription, using tagged primers. Real-time PCR using the tag sequence as the forward primer and a segment-specific reverse primer ensured the specificity for quantifying the mRNA of segments 1, 4, and 5. The temperature, reaction time, and Mg²⁺ concentration were determined to select the optimum conditions for in vitro RNA synthesis by RdRp, and the amount of synthesized mRNAs of segments 1, 4, and 5 was determined with a detection sensitivity of 10 copies/reaction. In addition, mRNA synthesis was inhibited by ribavirin triphosphate, an RdRp inhibitor, thus indicating the usefulness of this evaluation method for screening RdRp inhibitors.

Conclusion: This method makes it possible to analyze the RdRp activity even in a laboratory where ultracentrifugation and radioisotopes cannot be used. This novel method for measuring influenza virus polymerase activity will further promote research to identify compounds that inhibit viral RNA synthesis.

Virology

Influenza virus

RNA-dependent RNA polymerase activity

real-time reverse transcription polymerase chain reaction

ribavirin

The influenza virus is an enveloped negative-strand RNA virus, and the viral particles contain eight genomic RNA segments encoding viral proteins [1, 2]. Each RNA segment contains a ribonucleoprotein (RNP) with a heterotrimeric RNA polymerase complex containing the viral acidic polymerase protein (PA), polymerase basic protein 1 (PB1), polymerase basic protein 2 (PB2), and nucleoprotein (NP) [2]. Viral RNPs (vRNPs) are involved in the transcription of viral genes and replication of the viral RNA genome in infected cells.

Although neuraminidase inhibitors, such as oseltamivir and zanamivir, are one of the mainstream treatments for influenza, an epidemic of neuraminidase inhibitor-resistant viruses has been reported [3]. Baloxavir marboxil, which has been in clinical use since 2018 in Japan, the United States, and other countries, potently and selectively inhibits the cap-dependent endonuclease within the polymerase PA subunit of influenza A and B viruses [4]. However, after treatment with baloxavir marboxil, amino acid substitutions at position 38 in the influenza virus PA (PA/I38T) subunit have occasionally been observed in pediatric and adult patients (23% and 10%, respectively). It has been reported that the susceptibility of the PA/I38T mutant virus to baloxavir marboxil has reduced by approximately 50-fold [5].

T-705 (favipiravir) and ribavirin have been reported as effective influenza virus RNA-dependent RNA polymerase (RdRp) inhibitors in in vitro and in vivo experiments [6, 7]. These compounds are analogs of nucleosides and interrupt RNA synthesis through viral RdRp. Humans do not have RdRp but they do have DNA-dependent RNA polymerase and DNA-dependent DNA polymerase. Animal experiments to assess the teratogenicity of favipiravir using four separate species, mice, rat, rabbits and monkeys, demonstrate delayed development or embryonic death in the first trimester of pregnancy [8]. For this reason, the clinical use of favipiravir in women of reproductive age comes with a strong warning. Therefore, it is necessary to develop an inhibitor that can specifically inhibit influenza RdRp without affecting RNA and DNA synthesis in infected hosts.

A method for evaluating RdRp activity is important to screen for viral RdRp inhibitors. In a previously reported method, the virus is purified through density gradient ultracentrifugation [9–11]. However, this step is time consuming and the purification process is complicated. In addition, a polymerase reaction is performed in vitro using a radioisotope-labeled nucleoside, such as ³²P-GTP, and the synthesized RNA is determined with a scintillation counter. Even though this method is capable of determining even a very small amount of RNA, the use of a radioisotope is a safety concern.

In this study, we developed a novel method for the evaluation of RdRp activity for screening of RdRp inhibitors that do not use density gradient ultracentrifugation or radioisotopes.

Cell culture

Madin-Darby canine kidney (MDCK) cells were grown in Eagle’s minimum essential medium (MEM; FUJIFILM Wako Pure Chemical Industries, Ltd., Osaka, Japan) containing 7 % fetal bovine serum (FBS; Biowest SAS, Nuaillé, France) and 1 % antibiotics (penicillin and streptomycin; FUJIFILM Wako).

Viruses

Influenza virus A/Puerto Rico/8/34 (PR8, H₁N₁) was used in this study. For cell infection, the virus was diluted in serum-free MEM supplemented with 0.4 g/L bovine serum albumin (FUJIFILM Wako) and adsorbed to cells at a multiplicity of infection (MOI) of 0.001 for 1 h at 37°C. The inoculum was then removed and replaced with FBS-free Dulbecco’s modified Eagle medium (DMEM; FUJIFILM Wako) supplemented with 4 g/L bovine serum albumin and acetyltrypsin (2 µg/mL; Sigma-Aldrich, St. Louis, MO, USA) for 24 h.

Purification of the influenza virus RdRp

Influenza virus RNA polymerase was purified from viral culture supernatants using Viro-Adembeads (Ademtech, Pessac, France) according to the manufacturer’s instructions [12]. Briefly, 500 µL of a virus solution (4.8 × 10⁶ FFU/mL) was adsorbed onto magnet beads by mixing at 900 rpm for 20 min at 20°C. The tube was placed on the magnet for 1 min, the supernatant was removed, and the beads were washed with phosphate-buffered saline (PBS). After that, 70 µL of the polymerase elution buffer (50 mM Tris-HCl pH 8.0, 0.1 M KCl, 5 mM MgCl₂, 2 mM DTT, 1000 U/mL RNase inhibitor, and 0.25 % Triton N-101) was added, and the mixture was incubated at 30°C for 30 min to extract the RdRp.

In vitro transcription with purified RdRp

The in vitro transcription was conducted using a standard RNA synthesis reaction buffer [7, 10, 11, 13], which contained 50 mM Tris-HCl (pH 8.0), 0.1 M KCl, 5 mM MgCl₂, 2 mM DTT, 1000 U/mL RNase inhibitor, 0.25% Triton N-101, 500 µM ATP, 500 µM CTP, 500 µM UTP, 500 µM GTP, 200 µM ApG dinucleotide, and 20 µL purified RdRp. The reaction was performed at 37°C for 30 min in a final volume of 50 µL.

Evaluation of RdRp activity through real-time reverse transcription polymerase chain reaction (RT-PCR)

RdRp activity was evaluated using RT-PCR. mRNA specific RT primers (Table 1) for segments 1 (PB2), 4 (HA), and 5 (NP) of the PR8 strain were designed by modifying a previously reported protocol [14]. To prepare cDNA from the viral RNA produced through the aforementioned RdRp reaction, each tagged-specific RT primer and the ReverTra Ace qPCR RT Kit (TOYOBO, Osaka, Japan) were mixed as follows: 5 µL of a mixture containing 4 µL of the RdRp reaction product and 1 µL of the 5 pmol tagged-specific RT primer. The mixture was heated at 65°C for 10 min, immediately cooled on ice for 5 min, and then heated again at 60°C for 5 min. 5X RT buffer (containing reaction buffer, MgCl₂, and dNTPs), RT enzyme mix (containing RT enzyme and RNase inhibitor), and nuclease-free water were added to the RdRp product and primer mixture to a total reaction volume of 10 µL. Real-time quantitative PCR (qPCR) was performed on an ABI PRISM 7500 Fast Real-time PCR system using the Thunderbird SYBR qPCR mix (TOYOBO) and the primer sets for each segment mRNA (Table 1). Each 20 µL of the PCR mixture contained 2 µL of a ten-fold dilution of the cDNA and 0.3 µM of forward and reverse primers. The amplification conditions were 95°C for 1 min, 40 cycles at 95°C for 15 s, 60°C for 30 s, and 72°C for 35 s. Copy numbers were estimated from a calibration curve obtained using serial 10-fold dilutions (10⁹, 10⁸, 10⁷, 10⁶, 10⁵, 10⁴, 10³, and 10²) and 10 copies of the quantified standard sample as the template. Standard samples were created by inserting the respective amplification range sequences into the pEGFP-N1 plasmid.

Table 1

Primer sequences for quantitative real-time PCR
Target	Purpose	Prime name	sequences (5’ to 3’)
Segment 1 mRNA	Reverse transcription	PR8 seg1 mRNA tag	CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTAAACTATTCGA
	Realtime PCR	mRNAtag	CCAGATCGTTCGAGTCGT
	Realtime PCR	PR8 seg1 mRNA Re	GGAGATATGGGCCAGCATTA
Segment 4 mRNA	Reverse transcription	PR8 seg4 mRNA tag	CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTCCTCATATTTCT
	Realtime PCR	mRNAtag	CCAGATCGTTCGAGTCGT
	Realtime PCR	PR8 seg4 mRNA Re	GGGCAATCAGTTTCTGGATGTGTTCT
Segment 5 mRNA	Reverse transcription	PR8 seg5 mRNA tag	CCAGATCGTTCGAGTCGTTTTTTTTTTTTTTTTTCTTTAATTGTC
	Realtime PCR	mRNAtag	CCAGATCGTTCGAGTCGT
	Realtime PCR	PR8 seg5 mRNA Re	CGATCGTGCCTTCCTTTG

Primer design and standard curve for mRNA segments 1, 4, and 5

To quantify the copy numbers of mRNA of segments 1, 4, and 5 in the PR8 strain, we designed primers specific for each segment (Table 1) by modifying the primer sequences previously reported by Kawakami et al., and calibration curves for each segment mRNA were constructed (Fig. 1a, b, and c). Each calibration curve was linear in the range of 10¹–10⁹ copies in the reaction solution. The linear correlations of the calibration curves in this range were r = 0.999 in segment 1, r = 0.998 in segment 4, and r = 0.999 in segment 5 (Fig. 1a, b, and c, Table 2).

Table 2

Validation parameters for mRNA quantification of segments 1, 4, and 5 by strand-specific real-time RT-PCR using tagged primers.
Target		sensitivity (copies)	Linear regression
Target		sensitivity (copies)	Slope	Intercept	Amplification efficiency (E%)	R²
segment 1	mRNA	10¹	-3.2232	38.833	100	0.9979
segment 4	mRNA	10¹	-3.1873	38.24	100	0.9967
segment 5	mRNA	10¹	-3.2491	39.379	100	0.9972

Effect of the polymerase reaction time on influenza virus mRNA synthesis

The optimum conditions for the RdRp reaction were examined. After the RdRp reaction for 0, 15, 30, 60, and 120 min, mRNA production was maximal at 120 min in segment 1 (7.8 ± 0.39 × 10³ copies in reaction), maximal at 60 min in segment 4 (3.6 ± 0.23 × 10³ copies in reaction), and maximum at 60 min in segment 5 (1.1 ± 0.01 × 10⁴ copies in reaction) (Fig. 2a, b, and c). Therefore, the RdRp reaction time was 30 min that corresponds to half of the maximum reaction rate for each segment.

Influenza virus mRNA synthesis at various temperatures

The optimum temperature for the RdRp reaction was examined in the range of 4–42°C. The highest activity was observed in segment 1 at 30–37°C (Fig. 3a), and in segments 4 and 5, mRNA production increased in a temperature-dependent manner between 15°C and 37°C (Fig. 3b and c). In all segments, RdRp activity decreased under high temperature conditions of 42°C (Fig. 3a, b, and c). Therefore, the reaction temperature of RdRp was set at 37°C.

Effect of Mg²⁺ concentration in RNA polymerase reaction

Generally, the polymerase reaction changes depending on the Mg²⁺ concentration in the reaction solution. In segment 1, almost no mRNA was produced up to 4 mM MgCl₂, but mRNA production increased rapidly at 5 mM MgCl₂ (Fig. 4a). Segments 4 and 5 showed concentration-dependent production of mRNA at 3 mM to 5 mM of MgCl₂ (Fig. 4b and c). CaCl₂ did not affect RdRp activity (data not shown). The reaction solution containing 5 mM MgCl₂ synthesized 17.8- (Fig. 4a), 23.5- (Fig. 4b), and 55.8-fold (Fig. 4c) more mRNA in segments 1, 4, and 5, respectively, than in the reaction solution without MgCl₂. From these results, the MgCl₂ concentration in the RdRp reaction solution was fixed at 5 mM.

Effect of ApG

The addition of dinucleotide ApG has been reported to significantly accelerate influenza virus mRNA synthesis in the RdRp reaction [10, 15]. Due to the lack of ApG, an initiator of mRNA synthesis, in the RdRp reaction solution, the amount of mRNA synthesis in segments 1, 4, and 5 was markedly reduced to 7.9%, 9.2%, and 3.8%, respectively (Fig. 5a, b, and c).

The inhibitory effect of the RNA polymerase inhibitor ribavirin triphosphate (RTP)

To investigate whether the method developed in this study to determine RdRp activity might be useful to evaluate RdRp inhibitory compounds, the inhibitory effect of ribavirin triphosphate (RTP), which has been reported to inhibit influenza virus RdRp, was analyzed. In segment 1, 200 µM and 300 µM of RTP inhibited mRNA synthesis by 46.4% and 47.9%, respectively, compared to that of the control (Fig. 6a). In segments 4 and 5, mRNA production was inhibited in a concentration-dependent manner by RTP addition. At 500 µM of RTP in the reaction solution, mRNA production was inhibited in segments 4 and 5 by 86.7% and 91.5%, respectively. This inhibitory effect of RTP in influenza virus RdRp activity did not differ from those previously reported [16, 17] (Fig. 6b and c).

We have established a novel method for measuring the RdRp activity of influenza viruses using RT-PCR. In current methods [15, 18], the amount of mRNA synthesized is quantified using ³²P-labeled nucleoside triphosphates (GTP or UTP). Therefore, only the total number of eight-segment mRNAs is calculated. However, in the method we developed, the mRNA of each segment can be analyzed individually, and the copy number of the mRNA produced can be quantified through RT-PCR.

In this study, mRNAs of segments 1, 4, and 5 were examined, but by designing the primer using the primer design reported by Kawakami et al. [14] as reference, the amount of cRNAs and vRNAs of each of the eight segments present in influenza virus might be also quantified.

Viral particles were purified from the culture supernatants of infected cells. Although ultracentrifugation is commonly used to prepare influenza virus polymerase solutions, the method is time consuming and unsuitable for screening. In this experiment, we collected influenza viral particles using magnetic beads. Sakudo et al. have shown through immunochromatography that these beads can efficiently capture influenza viruses in cell culture media [12]. Using this method, it is possible to collect viral particles more easily and quickly than that using ultracentrifugation; therefore, viral particles with high RdRp enzyme activity can be collected. However, as these beads may adsorb various viruses through electrostatic interactions, they are not specific for influenza virus, leading to contamination with other components from the cell culture medium. In our case, the virus polymerase activity was not affected by contamination with the culture medium.

The reaction time for polymerase activity was the same as previously reported [19]. The optimum temperature for this method was 37°C (Fig. 3), but some previous studies have reported the use of 30°C [7, 13, 20, 21] Even though studies have reported the use of 37°C [22, 23], it is unclear why 37°C was optimum for our method.

Regarding the concentration of Mg in the RNA synthesis reaction buffer, the polymerase activity increased (Fig. 4) at Mg concentrations similar to those previously reported [7, 11, 15]. However, the amplification of each segment increased sharply at 3 or 4 mM MgCl₂ and showed little increase at concentrations below 3 mM (Fig. 4). Zhang et al. showed a similar rapid increase, although the border concentrations were slightly different [24].

The presence of ApG, a specific dinucleotide primer, increased mRNA production by approximately 10-fold in each segment, but mRNA was synthesized to a certain extent even in its absence (Fig. 5).

RTP inhibits RdRp because it is mistakenly taken up during mRNA synthesis as it is similar in structure to GTP and stops mRNA synthesis [16, 17]. Initially, when the GTP concentration was the same as that of ATP, CTP, and UTP, 100 µM RTP had no inhibitory effect, and 500 µM RTP only inhibited segment 1 by 57.1% and segment 4 by 47.1% (data not shown). Therefore, in this experiment we lowered GTP concentration to show the inhibitory effect of RTP. The inhibitory effect of 100 µM RTP was observed resulting in 20.8% inhibition for segment 1, 39.2%, for segment 4, and 44.5% for segment 5 (Fig. 6). In segments 4 and 5, there was no effect of the GTP concentration on mRNA production, and mRNA production decreased depending on the RTP concentration (Fig. 6b and c). However, in segment 1, mRNA production was significantly reduced by the dilution of GTP, even without RTP. Therefore, the concentration-dependent inhibition of RTP could not be confirmed in segment 1 (Fig. 6a). The concentration of GTP is considered important for the synthesis of segment 1 mRNA.

Since the amount of mRNA synthesis was reduced in the absence of ApG or magnesium, and the inhibition of synthesis by RTP was confirmed, this experimental method proved useful at evaluating the activity of RdRp of influenza viruses.

This novel method for measuring influenza virus polymerase activity will further promote research to identify compounds that inhibit viral RNA synthesis.

HA: hemagglutinin; MOI: multiplicity of infection; NP: nucleoprotein; PA: acidic polymerase protein; PB1: polymerase basic protein 1; PB2: polymerase basic protein 2; qPCR: quantitative PCR; RdRp: RNA-dependent RNA polymerase; RTP: ribavirin triphosphate; RNP: ribonucleoprotein; RT-PCR: reverse transcription polymerase chain reaction; vRNPs: viral ribonucleoprotein particles.

Ethics approval and consent to participate

Not applicable.

Consent to publication

Not applicable.

Availability of data and material

All data generated or analyzed during this study are included in this published article.

Competing interests

The authors declare no competing financial interests.

Funding

This work was supported by JSPS KAKENHI (grant numbers 18K11117 and 19K11659) and was partly supported by the grants from AIST (Japan) and the Department of Biotechnology (Govt. of India) under DAILAB and DAICENTER projects.

Author’s contributions

YH performed the experiments and analyzed the data. YH and MS designed the experiments and wrote the manuscript. YI conceived and supervised the study. All authors read and approved the final manuscript.

Acknowledgments

This work was supported by a Grant-in-Aid for Scientific Research (C) (grant numbers 18K11117 and 19K11659) from the Japan Society for the Promotion of Science. This study was partly supported by the grants from AIST (Japan) and the Department of Biotechnology (Govt. of India) under DAILAB and DAICENTER projects. We would like to thank Editage (www.editage.com) for English language editing.

Portela A, Digard P: The influenza virus nucleoprotein: a multifunctional RNA-binding protein pivotal to virus replication. J Gen Virol 2002, 83:723-734.
Palese P, Shaw ML: Orthomyxoviridae : the viruses and their replication. In Fields Virology. 5 edition. Edited by Knipe DM, Howley PM. Philadelphia: Lippincott Williams & Wilkins; 2007: 1647-1689.
Sheu TG, Deyde VM, Okomo-Adhiambo M, Garten RJ, Xu X, Bright RA, Butler EN, Wallis TR, Klimov AI, Gubareva LV: Surveillance for neuraminidase inhibitor resistance among human influenza A and B viruses circulating worldwide from 2004 to 2008. Antimicrob Agents Chemother 2008, 52:3284-3292.
Omoto S, Speranzini V, Hashimoto T, Noshi T, Yamaguchi H, Kawai M, Kawaguchi K, Uehara T, Shishido T, Naito A, Cusack S: Characterization of influenza virus variants induced by treatment with the endonuclease inhibitor baloxavir marboxil. Sci Rep 2018, 8:9633.
Hayden FG, Sugaya N, Hirotsu N, Lee N, de Jong MD, Hurt AC, Ishida T, Sekino H, Yamada K, Portsmouth S, et al: Baloxavir Marboxil for Uncomplicated Influenza in Adults and Adolescents. N Engl J Med 2018, 379:913-923.
Furuta Y, Gowen BB, Takahashi K, Shiraki K, Smee DF, Barnard DL: Favipiravir (T-705), a novel viral RNA polymerase inhibitor. Antiviral Res 2013, 100:446-454.
Furuta Y, Takahashi K, Kuno-Maekawa M, Sangawa H, Uehara S, Kozaki K, Nomura N, Egawa H, Shiraki K: Mechanism of action of T-705 against influenza virus. Antimicrob Agents Chemother 2005, 49:981-986.
Pilkington V, Pepperrell T, Hill A: A review of the safety of favipiravir - a potential treatment in the COVID-19 pandemic? J Virus Erad 2020, 6:45-51.
Seong BL, Kobayashi M, Nagata K, Brownlee GG, Ishihama A: Comparison of two reconstituted systems for in vitro transcription and replication of influenza virus. J Biochem 1992, 111:496-499.
Barauskas O, Xing W, Aguayo E, Willkom M, Sapre A, Clarke M, Birkus G, Schultz BE, Sakowicz R, Kwon H, Feng JY: Biochemical characterization of recombinant influenza A polymerase heterotrimer complex: Polymerase activity and mechanisms of action of nucleotide analogs. PLoS One 2017, 12:e0185998.
Honda A, Uéda K, Nagata K, Ishihama A: RNA polymerase of influenza virus: role of NP in RNA chain elongation. J Biochem 1988, 104:1021-1026.
Sakudo A, Ikuta K: Efficient capture of infectious H5 avian influenza virus utilizing magnetic beads coated with anionic polymer. Biochem Biophys Res Commun 2008, 377:85-88.
Kawaguchi A, Nagata K: De novo replication of the influenza virus RNA genome is regulated by DNA replicative helicase, MCM. EMBO J 2007, 26:4566-4575.
Kawakami E, Watanabe T, Fujii K, Goto H, Watanabe S, Noda T, Kawaoka Y: Strand-specific real-time RT-PCR for distinguishing influenza vRNA, cRNA, and mRNA. J Virol Methods 2011, 173:1-6.
Shimizu K, Handa H, Nakada S, Nagata K: Regulation of influenza virus RNA polymerase activity by cellular and viral factors. Nucleic Acids Res 1994, 22:5047-5053.
Eriksson B, Helgstrand E, Johansson NG, Larsson A, Misiorny A, Norén JO, Philipson L, Stenberg K, Stening G, Stridh S, Oberg B: Inhibition of influenza virus ribonucleic acid polymerase by ribavirin triphosphate. Antimicrob Agents Chemother 1977, 11:946-951.
Wray SK, Gilbert BE, Knight V: Effect of ribavirin triphosphate on primer generation and elongation during influenza virus transcription in vitro. Antiviral Res 1985, 5:39-48.
Liu Y, Qin K, Meng G, Zhang J, Zhou J, Zhao G, Luo M, Zheng X: Structural and functional characterization of K339T substitution identified in the PB2 subunit cap-binding pocket of influenza A virus. J Biol Chem 2013, 288:11013-11023.
Scholtissek C, Rott R: Effect of temperature on the multiplication of an Influenza virus. J Gen Virol 1969, 5:283-290.
Nilsson BE, Te Velthuis AJW, Fodor E: Role of the PB2 627 Domain in Influenza A Virus Polymerase Function. J Virol 2017, 91:e02467-02416.
Nilsson-Payant BE, Sharps J, Hengrung N, Fodor E: The Surface-Exposed PA(51-72)-Loop of the Influenza A Virus Polymerase Is Required for Viral Genome Replication. J Virol 2018, 92:e00687-00618.
Galarza JM, Peng Q, Shi L, Summers DF: Influenza A virus RNA-dependent RNA polymerase: analysis of RNA synthesis in vitro. J Virol 1996, 70:2360-2368.
Takeuchi K, Nagata K, Ishihama A: In vitro synthesis of influenza viral RNA: characterization of an isolated nuclear system that supports transcription of influenza viral RNA. J Biochem 1987, 101:837-845.
Zhang S, Weng L, Geng L, Wang J, Zhou J, Deubel V, Buchy P, Toyoda T: Biochemical and kinetic analysis of the influenza virus RNA polymerase purified from insect cells. Biochem Biophys Res Commun 2010, 391:570-574.

Download PDF

Editorial decision: Major revision
18 Jun, 2021
Review #1 received at journal
03 Jun, 2021
Review #2 received at journal
03 Jun, 2021
Reviews received at journal
18 May, 2021
Reviewers invited by journal
18 May, 2021
Reviewer #2 agreed at journal
17 May, 2021
Reviewer #1 agreed at journal
17 May, 2021
Editor assigned by journal
10 May, 2021
Submission checks completed at journal
09 May, 2021
Editor invited by journal
09 May, 2021
First submitted to journal
29 Apr, 2021

You are reading this latest preprint version

Development of a Method to Evaluate Influenza Virus RNA-dependent RNA Polymerase Activity Through Real-time Reverse Transcription Polymerase Chain Reaction

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Cell culture

Viruses

Purification of the influenza virus RdRp

In vitro transcription with purified RdRp

Evaluation of RdRp activity through real-time reverse transcription polymerase chain reaction (RT-PCR)

Results

Primer design and standard curve for mRNA segments 1, 4, and 5

Effect of the polymerase reaction time on influenza virus mRNA synthesis

Influenza virus mRNA synthesis at various temperatures

Effect of Mg²⁺ concentration in RNA polymerase reaction

Effect of ApG

The inhibitory effect of the RNA polymerase inhibitor ribavirin triphosphate (RTP)

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1

Development of a Method to Evaluate Influenza Virus RNA-dependent RNA Polymerase Activity Through Real-time Reverse Transcription Polymerase Chain Reaction

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Cell culture

Viruses

Purification of the influenza virus RdRp

In vitro transcription with purified RdRp

Evaluation of RdRp activity through real-time reverse transcription polymerase chain reaction (RT-PCR)

Results

Primer design and standard curve for mRNA segments 1, 4, and 5

Effect of the polymerase reaction time on influenza virus mRNA synthesis

Influenza virus mRNA synthesis at various temperatures

Effect of Mg2+ concentration in RNA polymerase reaction

Effect of ApG

The inhibitory effect of the RNA polymerase inhibitor ribavirin triphosphate (RTP)

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1

Effect of Mg²⁺ concentration in RNA polymerase reaction