Inhibition of DNA ligase IV affects the DNA damage repair pathway and decreases the sensitivity of olaparib to platinum-sensitive BRCA wild-type ovarian cancer

doi:10.21203/rs.3.rs-4842625/v1

Download PDF

Research Article

Inhibition of DNA ligase IV affects the DNA damage repair pathway and decreases the sensitivity of olaparib to platinum-sensitive BRCA wild-type ovarian cancer

https://doi.org/10.21203/rs.3.rs-4842625/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Ovarian cancer is one of the most common gynecologic malignancies, and the mortality rate has always been the highest among gynecologic malignancies. Currently, the initial treatment mode after the first diagnosis of ovarian cancer is tumor cytoreductive surgery, platinum-based chemotherapy, and targeted drug maintenance therapy. Although PARP inhibitors are an important approach to maintenance therapy, relapse occurs in patients after a period of treatment. PARP inhibitors mainly exert anti-tumor effects by inhibiting the repair of tumor cell DNA damage to achieve synthetic lethality. After DNA damage, repair primarily occurs through two pathways: homologous recombination (HR) and non-homologous end joining (NHEJ). DNA ligase IV, as a crucial enzyme in NHEJ, plays a role in connecting DNA fragments during the DNA repair process. Through bioinformatics analysis, we found that the use of olaparib in platinum-sensitive BRCA wild-type ovarian cancer cells leads to a decrease in the expression levels of DNA ligase IV in patients. Furthermore, cell experiments revealed that the expression levels of DNA ligase IV affect the sensitivity of ovarian cancer cells to olaparib. Specifically, when the expression levels of DNA ligase IV are reduced, the sensitivity of ovarian cancer to olaparib decreases. This suggests that BRCA wild-type ovarian cancer patients with low expression of DNA ligase IV may not respond well to PARP inhibitors. Through comet assays and other methods, it was discovered that a decrease in DNA ligase IV levels makes DNA less susceptible to damage in platinum-sensitive BRCA wild-type cells. Additionally, alterations in DNA ligase IV affect the related pathway genes of DNA damage repair in platinum-sensitive BRCA ovarian cancer, resulting in changes in DNA damage repair mechanisms. Therefore, the changes in NHEJ caused by DNA ligase IV may be one of the reasons for the sensitivity of BRCA wild-type ovarian cancer cells to PARP inhibitors. In the future, it may be possible to improve the efficacy of PARP inhibitors in BRCA wild-type ovarian cancer patients by influencing changes in the expression levels of DNA ligase IV.

Ovarian cancer is one of the most common gynecologic malignancies, with approximately 57,200 patients diagnosed with ovarian cancer each year in China, and the mortality rate consistently ranks first among malignancies of the female reproductive system [1]. Currently, ovarian cancer is primarily treated with surgery, platinum-based adjuvant chemotherapy, and maintenance therapy with PARPi to maximize patient outcomes [2]. Although the majority of patients achieve clinical remission after initial treatment, 70 percent of patients relapse within three years, and the five-year overall survival rate is less than 50 percent [3]. Patients with platinum-sensitive recurrent ovarian cancer who have relapsed more than 6 months after initial platinum-based therapy are considered to benefit more from maintenance therapy with PARP inhibitors than patients with platinum-resistant relapse.

Poly (ADP-ribose) polymerase (PARP family) is involved in DNA damage repair, in which PARP1 binds to DNA damage sites and catalyzes the synthesis of poly ADP ribose chains on protein substrates, and ultimately recruits other DNA repair proteins to the damage sites to repair DNA damage [4]. The molecularly targeted drug PARP inhibitor blocks the DNA repair process of tumor cells by binding to the PARP catalytic site, resulting in the irreparable transformation of DNA single-strand break to double-strand break. In BRCA-mutated tumor cells, HR function hinders the accurate repair of DNA double-strand breaks, leading to cell death, i.e., synthetic lethality [5]. PARP inhibitors are also effective in killing cancer cells without BRCA mutations, although cancer cells without BRCA mutations are less sensitive to PARP inhibitors than cancer cells harboring BRCA mutations [6]. Olaparib is one of the first PARP inhibitors for clinical treatment in China. It has achieved good results in maintenance therapy after chemotherapy for advanced ovarian cancer and in the neoadjuvant and post-line treatment of advanced patients [7]. Recent L-MOCA studies have shown that olaparib maintenance therapy is effective and well tolerated in Asian patients with platinum-sensitive (PSR) ovarian cancer, regardless of BRCA status [8]. Despite this, subgroup analyses showed that patients with BRCA wild-type had worse outcomes and lower survival than patients with BRCA-mutant ovarian cancer.

There are several mechanisms of PARP inhibitor resistance [10]: 1. Secondary mutations: Some tumor cells may undergo secondary mutations that restore the function of BRCA1/2 and thus regain the ability to repair DNA, thus rendering PARP inhibitors ineffective. 2. PARP gene overexpression: Some tumor cells may increase the expression level of PARP, thereby improving the cell's tolerance to PARP inhibitors. 3. Activation of DNA repair pathways. In addition to BRCA1/2, tumor cells may rely on other DNA repair pathways to maintain genomic stability [11]. 4. PARP structural alterations: Some tumor cells may produce PARP protein mutations, so PARP inhibitors cannot bind to them, thus losing the drug's effect. In conclusion, developing resistance to PARP inhibitors is inextricably linked to the DNA damage repair pathway.

The NHEJ repair pathway is one of the important pathways for DNA damage repair and can repair most DSBs. In mammalian and plant cells, the NHEJ pathway competes with the HR pathway for DSB repair, and disruption of the NHEJ pathway has been shown to increase the frequency and efficiency of HR repair [12]. DNA LIG IV is a key enzyme that catalyzes the final step of non-homologous end ligation to repair DNA double-strand breaks, so the decreased expression of DNA LIG IV leads to NHEJ pathway blockage [13]. One of the mechanisms of PARP inhibitor resistance is the restoration of homologous recombination function [14], which, in addition to inducing reexpression of BRCA1 or BRCA2 wild-type proteins or morphological variation through reversal mutations or epigenetic alterations, may also lead to reactivation of homologous recombination function through deletion of the non-homologous end linker 53BP1, which can interact with DNA LIG IV and regulate its activity in DNA repair, thereby affecting the efficiency and accuracy of the NHEJ repair pathway [15]. Therefore, it is worth exploring whether the low efficacy of platinum-sensitive ovarian cancer on PARP inhibitors is that PARP inhibition will affect the expression of LIG IV and further affect the effectiveness of PARP inhibitors. Therefore, this study mainly investigated the effect of LIG IV, a key enzyme in the NHEJ pathway, on the sensitivity of the PARP inhibitor olaparib in platinum-sensitive BRCA wild-type ovarian cancer cells and its molecular mechanism.

2.1 TCGA database analysis

RNAseq sequencing data and corresponding clinical information for ovarian cancer were obtained from the Cancer Genome Atlas (TCGA, https://portal.gdc.com) and genotype tissue expression (GTEx, https://gtexportal.org/home/datasets) databases. From the V8 version (https://gtexportal.org/home/datasets). Statistical analysis was performed using R software v4.0.3. A P value of < 0.05 was considered statistically significant. In this study, the difference in DNA LIG IV expression between patients with and without molecularly targeted therapy in ovarian cancer patients was detected, and gene correlation analysis and prognostic analysis were performed on the patient population.

2.2 Cell culture and reagents

Human ovarian cancer cell lines A2780 and OVCAR3 were donated by Prof. Hailing Cheng (Cancer Research Institute, Dalian Medical University, China). Cell lines are cultured in RPMI-1640 medium (Hyclone) containing 10% fetal bovine serum (Hyclone), 1% streptomycin (100 µg/mL), and penicillin (100 U/mL) in a humidified incubator with 5% CO2 at 37°C. All cells were used within ten passages. Olaparib was purchased from Medchem Express (USA) and SCR7 was purchased from Selleck (USA).

2.3 Cell viability analysis

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay is performed to assess the cytotoxic effects of olaparib. Cells are seeded in 96-well plates (3x103 cells/well) and treated with olaparib (A2780: 0,2,4,8,16,32 µM, OVCAR3: 0,8,16,32,64,128 µM) after 24 h of culture. After 72 hours, the cells were incubated with 1 mg/ml MTT solution. After four hours, absorbance is measured at 490 nm and the data are evaluated using a microplate reader (Thermo).

2.4 Establish stable knockdown LIG IV cell lines

Sequence-validated shRNA yields the lentiviral plasmid pLKO.1-puro for generating lentiviral particles targeting DNA LIG IV mRNA. The DNA LIG IV shRNA interference sequences are shLIG4-1 (NM_002312), shLIG4-2 (NM_002312), and negative control. The detailed sequence is shown in Table 1. Transfection of Lipo2000 with one of the three transfer vectors, shLIG4-1, shLIG4-2, and an empty vector, yielded non-replication-capable modified lentiviral particles in 293T cells. A2780 or OVCAR3 cells were seeded at 100,000 cells/cm2 and infected overnight with shLIG4-1, shLIG4-2, or empty vector lentiviral particles 24 h later with an MOI of 10. Selection is initiated 24 hours post-infection and is allowed continuously by adding 1 µg/mL puromycin (OVCAR3: 3µg/mL puromycin). Finally, we get A2780^(plko.1), A2780^(LIG4−), OVCAR3^(plko.1), OVCAR3^(LIG4−).

Table 1

Oligonucleotide sequence
Target	Oligo Name	Sequence(5’-3’)
ShLIGIV	Forward Oligo	CCGGTATGTCAGTGGACTAATGGATCTCGAGATCCATTAGTCCACTGACATATTTTTG
	Reverse Oligo	AATTCAAAAATATGTCAGTGGACTAATGGATCTCGAGATCCATTAGTCCACTGACATA
PCR-LIGIV	Forward Oligo	ATCGGAATTCATGGCTGCCTCACAAACTT
	Reverse Oligo	ATCGGCGGCCGCAATCAAATACTGGTTTTCTTCTTG

2.5 Establishment of stable overexpression cell lines

The overexpression plasmid pcDNA3.1 was purchased from Addgen (USA). Lipofectamine 2000 (Thermo, USA) transfects the overexpression plasmid according to the manufacturer's protocol. Insert the LIG4 fragment into plasmid pcDNA3.1 to generate the DNA LIG IV expression plasmid pcDNA3,1-LIG4. A2780 or OVCAR3 cells were seeded in a 60 mm diameter dish, 1,000,000 cells were added, and the lipid plasmids pcDNA3, 1-LIG4, and pcDNA3.1 were diluted in Opti-MEM 24 hours later. Change the medium after six hours. Selection is initiated 24 hours post-infection and is allowed continuously by adding 1 µg/mL puromycin (OVCAR3: 3µg/mL puromycin). Finally, we get A2780^(pcDAN3.1), A2780^(LIG4+), OVCAR3^(pcDNA3.1), and OVCAR3^(LIG4+).

2.6 Quantitative RT-qPCR

Ovarian cancer cells are collected. Add 1ml of Trizol reagent, mix well, and let stand for 5min. Add 200 µL of chloroform to the centrifuge tube, mix well with a pipette, and let stand for 15 min at room temperature. In a 4°C centrifuge, centrifuge at 12,000 g for 15 min. Take the upper aqueous phase, add 500 µL of isopropanol, mix well with a pipette, and let stand at room temperature for 10min. Then centrifuge at 12,000 g for 10 min and discard the supernatant. Add 1 ml of 75% ethanol (prepared with DEPC water) to suspend the pellet without blowing off the pellet and centrifuge at 12,000 g for 5 min in a 4°C centrifuge. Discard the supernatant and allow it to dry at room temperature. 35 µL of TE buffer to dissolve the RNA sample. Measure the concentration of the sample. Follow the steps for reverse transcription with the All-Gold Reverse Transcription Kit (TransGen Biotech, China). RT-PCR was performed stepwise using the Bao Bio Kit (Takara, Japan) in a reaction of 10 µL. The sequence is shown in Table 2.

Table 2

Primer sequences
Target	Primer name	Sequence(5’-3’)
β-actin	Forward primer	GATTCCTATGTGGGCGACG
	Reverse primer	TGTGGTGCCAGATTTTCTCC
LIG ⅠV	Forward primer	TGCTGCTGAGTTGCATAATGT
	Reverse primer	AGCAGCTAGCATTGGTTTTGA
PARP1	Forward primer	GCAACCACACACAATGCGTA
	Reverse primer	GTTGGCACTCTTGGAGACCA

2.7Western blot assay

Total protein was extracted from cells by lysis buffer (0.05 M Tris-HCL, 1% NP-40, 0.15 M NaCl, 1 mM EDTA) and quantified by the Qubit Protein Assay Kit (Q33211, Thermo, USA). The same amount of protein (20 µg) is separated with SDS-PAGE and transferred to a polyvinylidene (PVDF) membrane. Seal with 10% skim milk for 1 h under TBST and then incubate with primary antibody overnight at 4°C. After 3 washes, the membrane is incubated with horseradish peroxidase-conjugated secondary antibody for 2 h at room temperature. Finally, the results were visualized by enhanced chemiluminescence (ECL Chemiluminescence Detection Kit, PK10003, Proteintech, USA). The intensity of each band was analyzed by ImageJ software and normalized to β-actin. Primary antibodies include LIG4 (Proteintech, 12695-1-AP), PARP1 (Proteintech, 13371-1-AP), β-actin (Proteintech, HRP-66009), γH2AX (Proteintech, 10442-1-AP), and anti-mouse HRP antibody (Proteintech, RGAM001) and anti-rabbit HRP antibody (Proteintech, RGAR001).

2.8 Colony formation assay

A2780^(plko.1), A2780^(LIG4−), OVCAR3^(plko.1), OVCAR3^(LIG4−) cells, A2780^(pcDAN3.1), A2780^(LIG4+), OVCAR3^(pcDNA3.1), and OVCAR^3(LIG4+) are seeded in 12-well plates at a density of 1000 cells per well. Cells were treated with olaparib for 48 h and incubated for approximately 14 days, fixed with 4% formaldehyde, and stained with crystal violet staining solution. Colonies are imaged by camera and quantified by Image J software.

2.9 Commet assay

First, prepare a single-cell suspension mixed with low-melting agarose (LM agarose) at 37°C and coat the agarose and cell mixture on the pretreated slides; Treat with lysate for 30–60 min or overnight at 4°C (6 g NaOH and 0.186 g EDTA-2Na dissolved in 500 ml ddH2O). After lysis, electrophoresis at 25 V for 30 min. After electrophoresis, remove the slides, blot the electrophoresis buffer on filter paper, and neutralize with neutral lysate for 15 min at 4°C. Then add 50 µl of 30 µg/mL ethidium bromide (EB) solution dropwise to each slide and stain in the dark for 20 min. The tailings are observed with an inverted fluorescence microscope and statistically analyzed.

2.10 DNA damage repair detection system containing the GFP reporter gene was constructed

We established A2780 cells containing DR-GFP (for HR) and EJ-2 (for MMEJ) repair substrates. To measure repair efficiency, 1×106 cells were seeded in a 60 mm diameter dish. The indicated compounds or DMSO are added to the medium for 24 h and cells are infected with adenovirus expressing the I-SceI enzyme. Two days after infection, the cells are trypsinized and GFP-positive cells are quantified by flow cytometry (Beckman).

2.11 Statistical Analysis

All assays were performed in at least three independent experiments. All data were statistically analyzed using GraphPad Prism 9. One-way analysis of variance (ANOVA) was used to analyze the statistical comparison of multiple groups. When p < 0.05, the difference is considered statistically significant.

3.1 The use of olaparib in platinum-sensitive BRCA wild-type ovarian cancer cells will affect the expression of DNA LIG IV

We performed a bioinformatics analysis of the data of ovarian cancer patients through the TCGA database and found that the RNA levels of DNA LIG IV in ovarian cancer patients after targeted therapy were lower than those in patients without targeted therapy (Fig. 1A), and the expression of DNA LIG IV and PARP1 was positively correlated in ovarian cancer patients (Fig. 1B).The prognostic analysis of monogenic DNA LIG IV in ovarian cancer showed that patients with high expression of DNA LIG IV had a better prognosis than those with low expression [16] (Fig. 1C), PFS lasts longer. Therefore, we exposed two human platinum-sensitive BRCA wild-type ovarian cancer cell lines [17,18]A2780 [19] and OVCAR3 [20] to different concentrations (0, 1, 2, 4, 8, 16 μM and 0,8,16,32,64,128 μM) for 72 h after drug treatment. The viability of cells in each group was detected by the MTT method (Figs. 1D and G). According to the results of monotherapy intervention, 8 μM, and 16 μM olaparib were added to A2780, respectively. The addition of 32 μM and 64 μM olaparib to OVCAR3, respectively, showed that the protein expression of DNA LIG IV was reduced after the addition of olaparib to two platinum-sensitive BRCA wild-type ovarian cancer cells (Fig. 1E, F, H, I).

In conclusion, bioinformatics analysis and cell experiments have shown that using PARP inhibitor intervention in BRCA wild-type ovarian cancer reduces the expression of DNA LIG IV in ovarian cancer cells.

3.2 Construct platinum-sensitive ovarian cancer cells with DNA LIG IV knockdown and DNA LIG IV overexpression

To understand whether alterations in DNA LIG IV have an effect on olaparib sensitivity in ovarian cancer, we constructed the plko.1-LIG IV plasmid with LIG IV knockdown[21](Fig. 2A), and the PCDNA3,1-LIG IV plasmid expression LIG IV and verified its accuracy by degestion(Fig. 2B-C). Then, the two plasmids and their control empty plasmids were transfected in platinum-sensitive BRCA wild-type ovarian cancer A2780 and OVCAR3 cell lines, respectively, and then the transfected cells were screened with 1 μg/ml and 3 μg/ml puromycin, and the expression of LIG IV in each cell was detected by Western blot and fluorescence quantitative RT-PCR assay (Fig. 2 D-O). A2780^(plko.1), A2780^(LIG4-), A2780^(PCDNA3.1), A2780^(LIGIV+), OVCAR3^(plko.1), OVCAR3^(LIG4-), OVCAR3^(PCDNA3.1), OVCAR3^(LIGIV+) are stable cell lines.

3.3 High or low levels of DNA LIG IV expression can affect the sensitivity of platinum-sensitive BRCA wild-type ovarian cancer cells to olaparib

When the repair method of NHEJ is defective, ovarian cancer is resistant to olaparib[22]. In ovarian cancer cells with normal HR repair function, PARP inhibitor therapy can lead to mitotic disaster and cell death by promoting NHEJ repair and chromosomal abnormalities [23]. Therefore, after obtaining these stable cell lines, we treated the constructed cell lines with the same concentration gradient of olaparib for 72 hours. We then detected the cell viability of each group using an MTT assay (Figure 3A-D). In DNALIG IV knockdown cells, the inhibitory effect of olaparib on cell proliferation was insignificant. In cells overexpressing DNA LIG IV, the inhibitory effect of Olaparib on cell proliferation was significantly enhanced. We further examined the effects of Olaparib on these cells through cloning experiments, and the results showed that when DNA LIG IV expression decreased, cells were insensitive to Olaparib, while when DNA LIG IV expression increased, cells became more sensitive to Olaparib. These results indicate that changes in DNA LIG IV expression levels can affect the sensitivity of platinum-sensitive BRCA wild-type ovarian cancer cells to olaparib.

3.4 Alterations in DNA LIG IV expression can affect the DNA damage repair pathway in platinum-sensitive BRCA wild-type ovarian cancer

The above experimental results indicate that when DNA LIG IV changes, the sensitivity of Olaparib to platinum-sensitive BRCA wild-type ovarian cancer changes. To further investigate how DNA LIG IV affects the sensitivity of Olaparib, we first added an appropriate concentration of Olaparib to DNA LIG IV knockdown cells and detected the degree of DNA damage using a comet assay (Figure 4A-B). It was found that the comet tail of DNA LIG IV knockdown cells was shorter than that of empty vector cells, indicating that DNA damage in DNA LIG IV knockdown cells was not as severe as in blank vector cells. Then, we measured the RNA expression level of PARP1 in DNA LIG IV knockdown cells and found that the decrease in DNA LIG IV led to a decrease in PARP1 expression level (Figure 4C-D), which is consistent with our previous bioinformatics analysis results. It has been found that CHD7 is localized to DNA LIG IV, and PARP1 depletion reduces the recruitment of CHD7, thereby impairing NHEJ-mediated DNA damage repair [24]. However, the decrease in PARP1 expression leads to a decrease in the site of action of Olaparib on one hand, and on the other hand affects the DNA single-strand break pathway, causing DNA single-strand break to become DNA double-strand break [25]. Then, we measured the protein expression of γ H2AX in DNA LIG IV knockdown cells and blank vector group cells using Olaparib and found that the protein expression of γ H2AX in DNA LIG IV knockdown cells was lower than that in the blank vector group (Figure 4E-F), indicating more severe double-strand breaks in the blank vector group [26].

Given that SCR7 is the only DNA LIG IV inhibitor on the market [27], we cultured 120 μ M of SCR7 in A2780 cells at different concentrations (0,15,30,60120240 μ M) for 72 hours and validated its effect in the cells. Then, we detected the DNA LIG of A2780 cells after the addition of SCR7 drug at the IV protein expression level (Figure 4H) and found that SCR7 can effectively inhibit the protein level of DNA LIG IV. Next, we constructed report plasmids for detecting homologous recombination repair pDRGFP [28] and for detecting microhomologous end effector EJ2GFP [29], respectively, and transferred these two plasmids to A2780 cells to construct a DNA damage repair efficiency detection system carrying HR-GFP and MMEJ-GFP report genes. Then, we transiently transfected the expression plasmid pCBASceI encoding I-SceI endonuclease [30] and added 120 μ M to the system. After 72 hours of treatment with the SCR7 drug, the expression of GFP in cells was detected by flow cytometry, and the HR repair efficiency and MMEJ after DNA double-strand break were evaluated. The repair efficiency showed that when the expression of DNA LIG IV was inhibited, the repair efficiency of HR and MMEJ increased (Figure 4I-J), but mainly HR.

DNA damage repair is a complex process in cells aimed at repairing damage and errors in DNA molecules to maintain the integrity and stability of the cellular genome. There are several common repair methods: direct repair, mismatch repair, nucleotide excision repair, base excision repair, homologous recombination repair, nonhomologous end connections, and micro homologous end connections. These DNA damage repair mechanisms work together in cells.

Nowadays there is research evidence that the DNA repair pathway plays an important role in the development of ovarian cancer [31], especially for ovarian cancer related to BRCA (breast cancer susceptibility gene), because BRCA gene mutation leads to the loss of the function of homologous recombination repair (HR) mechanism, making this type of ovarian cancer cells more sensitive to some treatment methods. When HR function is inhibited, cells' dependence on other repair mechanisms increases. The loss of HR function provides an important research direction for the treatment of ovarian cancer [32]. The PARP family members associated with it also play an important role in the DNA repair process. When DNA is damaged, the PARP enzyme can be activated and bind to DNA damage sites. PARP inhibitors hinder the repair of single-strand breaks (SSBs) by inhibiting the activity of PARP enzymes, leading to the formation of DSBs. Due to the loss of HR function, ovarian cancer cells are unable to repair DSB, leading to cell death effectively. Therefore, PARP inhibitors are an effective treatment option for BRCA mutation-positive ovarian cancer patients [33]. PARP inhibitors can be used as monotherapy or maintenance therapy for BRCA-mutated ovarian cancer patients to prolong progression-free survival (PFS) and overall survival (OS). However, for BRCA wild-type (non-mutated) ovarian cancer patients, treatment options and prognosis often differ from those of BRCA mutation-positive patients. Although monotherapy with PARP inhibitors may also lead to remission in platinum-sensitive BRCA wild-type patients, the therapeutic effect is much lower than in BRCA mutant ovarian cancer patients [34], partly due to differences in sensitivity to PARP inhibitors [35]. Therefore, it is crucial to identify research directions that can improve the efficacy and predictive factors of PARP inhibitors in BRCA wild-type ovarian cancer. It is urgent to find biomarkers that can predict PARP inhibitor response and prognosis.

PARP inhibitor resistance is closely related to the repair of DNA damage in tumor cells. DNA LIG IV plays a crucial role in the nonhomologous end junction (NHEJ) repair pathway and can serve as a potential target for the treatment of ovarian cancer [36]. Some studies have found that in animal and plant cells, the two main DNA double-strand break repair mechanisms, HR and NHEJ, play complementary roles. When HR function is impaired, NHEJ is enhanced, and when NHEJ function is inhibited, HR function is feedback enhanced [37]. In BRCA mutant ovarian cancer cells, DNA repair ability is weak and the cell's dependence on the NHEJ pathway increases. Therefore, the combination therapy of DNA LIG IV inhibitors and PARP inhibitors can inhibit NHEJ and PARP-dependent repair, further weakening DNA repair ability [38]. However, there are few reports on the NHEJ pathway in BRCA wild-type ovarian cancer cells. Although BRCA wild-type ovarian cancer typically has lower HR functional defects, studies have found that inhibiting EZH2 upregulates MAD2L2 and reduces DNA end excision, thereby increasing the NHEJ repair pathway and chromosomal abnormalities. Ultimately, the use of PARP inhibitors in HR-functioning ovarian cancer cells can cause mitotic disasters and lead to ovarian cancer cell death [39], providing new research directions for the application of PARP inhibitors in HR-functioning ovarian cancer cells.

In summary, this study found through bioinformatics data analysis and basic experiments that the use of PARP inhibitors in platinum-sensitive BRCA wild-type ovarian cancer cells reduced the expression level of DNA LIG IV. Moreover, the expression of DNA LIG IV. altered the sensitivity of BRCA wild-type ovarian cancer cells to PARP inhibitors. BRCA wild-type ovarian cancer cells are not sensitive to PARP inhibitors when DNA LIG IV expression decreases but are more sensitive to PARP inhibitors when DNA LIG IV expression increases. The decrease of DNA LIG IV can lead to a decrease in the expression of PARP1, which also inhibits the SSB repair function of BRCA wild-type ovarian cancer. Through simple prognostic analysis, we found that ovarian cancer patients with high DNA LIG IV expression had longer survival times than those with low expression. Therefore, DNA-LIG IV may be a biomarker for predicting the response of BRCA wild-type ovarian cancer to PARP inhibitors.

Conflict of interest The authors declare that no confict of interest exists.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Availability of data and material

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Author information

Authors and Affiliations

Department of Medical Oncology, The Second Afliated Hospital of Dalian Medical University, Dalian, Liaoning, China, Yupeng G, Yichen Pan, Yue Wan, Kui Jiang

Yupeng Gu and Yichen Pan contributed equally to this work.

Contributions

YG and YP; writing-original draft preparation: YG and YP; writing-review and editing: YG, YP and YW; supervision: KJ; funding acquisition: KJ. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Kui Jiang([email protected]).

Stewart C, Ralyea C, Lockwood S. Ovarian Cancer: An Integrated Review [J]. Semin Oncol Nurs, 2019, 35(2): 151-6.
Mittica G, Ghisoni E, Giannone G, et al. PARP Inhibitors in Ovarian Cancer [J]. Recent Pat Anticancer Drug Discov, 2018, 13(4): 392-410.
Zavesky L, Jancarkova N, Kohoutova M. Ovarian cancer: origin and factors involved in carcinogenesis with potential use in diagnosis, treatment and prognosis of the disease [J]. Neoplasma, 2011, 58(6): 457-68.
Huang R, Zhou PK. DNA damage repair: historical perspectives, mechanistic pathways and clinical translation for targeted cancer therapy [J]. Signal Transduct Target Ther, 2021, 6(1): 254.
Huang RX, Zhou PK. DNA damage response signaling pathways and targets for radiotherapy sensitization in cancer [J]. Signal Transduct Target Ther, 2020, 5(1): 60.
Chatterjee N, Walker GC. Mechanisms of DNA damage, repair, and mutagenesis [J]. Environ Mol Mutagen, 2017, 58(5): 235-63.
Jia Q, Den Dulk-Ras A, Shen H, et al. Poly(ADP-ribose)polymerases are involved in microhomology mediated back-up non-homologous end joining in Arabidopsis thaliana [J]. Plant Mol Biol, 2013, 82(4-5): 339-51.
Tattersall A, Ryan N, Wiggans AJ, et al. Poly(ADP-ribose) polymerase (PARP) inhibitors for the treatment of ovarian cancer [J]. Cochrane Database Syst Rev, 2022,2(2): CD007929.
Lisio MA, Fu L, Goyeneche A, et al. High-Grade Serous Ovarian Cancer: Basic Sciences, Clinical and Therapeutic Standpoints [J]. Int J Mol Sci, 2019, 20(4).
Vanderstichele A, Loverix L, BusschaertT P, et al. Randomized CLIO/BGOG-ov10 trial of olaparib monotherapy versus physician's choice chemotherapy in relapsed ovarian cancer [J]. Gynecol Oncol, 2022, 165(1): 14-22.
Gao Q, Zhu J, Zhao W, et al. Olaparib Maintenance Monotherapy in Asian Patients with Platinum-Sensitive Relapsed Ovarian Cancer: Phase III Trial (L-MOCA) [J]. Clin Cancer Res, 2022, 28(11): 2278-85.
Zhang N, Zheng H, Gao Y, et al. A real-world study of treatment patterns following disease progression in epithelial ovarian cancer patients undergoing poly-ADP-ribose polymerase inhibitor maintenance therapy [J]. J Ovarian Res, 2024, 17(1): 55.
Kubalanza K, Konecny G E. Mechanisms of PARP inhibitor resistance in ovarian cancer [J]. Curr Opin Obstet Gynecol, 2020, 32(1): 36-41.
Jun S, Jung YS, Suh HN, et al. LIG4 mediates Wnt signalling-induced radioresistance [J]. Nat Commun, 2016, 7: 10994.
Chang H H Y, Pannunzio N R, Adachi N, et al. Non-homologous DNA end joining and alternative pathways to double-strand break repair [J]. Nat Rev Mol Cell Biol, 2017,18(8): 495-506.
Bunting S F, Callen E, WongN, et al. 53BP1 inhibits homologous recombination in Brca1-deficient cells by blocking resection of DNA breaks [J]. Cell, 2010, 141(2):243-54.
Gyrffy B. Transcriptome-level discovery of survival-associated biomarkers and therapy targets in non-small-cell lung cancer [J]. Br J Pharmacol, 2024, 181(3): 362-74.
Sallmyr A, Rashid I, Bhandari SK, et al. Human DNA ligases in replication and repair [J]. DNA Repair (Amst), 2020, 93: 102908.
Angstenberger M, Krischer J, Aktas O, et al. Knock-Down of a ligIV Homologue Enables DNA Integration via Homologous Recombination in the Marine Diatom Phaeodactylum tricornutum [J]. ACS Synth Biol, 2019, 8(1): 57-69.
Goff NJ, Breniere M, Buehl CJ, et al. Catalytically inactive DNA ligase IV promotes DNA repair in living cells [J]. Nucleic Acids Res, 2022, 50(19): 11058-71.
Li H, Liu ZY, Wu N, et al. PARP inhibitor resistance: the underlying mechanisms and clinical implications [J]. Mol Cancer, 2020, 19(1): 107.
Bunting S F, Callen E, WongN, et al. 53BP1 inhibits homologous recombination in Brca1-deficient cells by blocking resection of DNA breaks[J]. Cell,2010, 141(2):243-54.
Gyrffy B. Transcriptome-level discovery of survival-associated biomarkers and therapy targets in non-small-cell lung cancer [J]. Br J Pharmacol, 2024, 181(3): 362-74.
Gupta VG, Hirst J, Petersen S, et al. Entinostat, a selective HDAC1/2 inhibitor, potentiates the effects of olaparib in homologous recombination proficient ovarian cancer [J]. Gynecol Oncol, 2021, 162(1): 163-72.
Domcke S, Sinha R, Levine DA, et al. Evaluating cell lines as tumour models by comparison of genomic profiles [J]. Nat Commun, 2013, 4: 2126.
Khvorova A, Reynolds A, Jayasena S D. Functional siRNAs and miRNAs exhibit strand bias [J]. Cell, 2003, 115(2): 209- 16.
Mccormick A, Donoghue P, Dixon M, et al. Ovarian Cancers Harbor Defects in Nonhomologous End Joining Resulting in Resistance to Rucaparib [J]. Clin Cancer Res,2017, 23(8): 2050-60.
Hatchi E, Livingston DM. Opening a Door to PARP Inhibitor-Induced Lethality in HR-Proficient Human Tumor Cells [J]. Cancer Cell, 2020, 37(2): 139-40.
Rother MB, Pellegrino S, Smtth R, et al. CHD7 and 53BP1 regulate distinct pathways for the religation of DNA double-strand breaks [J]. Nat Commun, 2020, 11(1): 5775.
Audebert M, Salles B, Calsou P. Involvement of poly(ADP-ribose) polymerase- 1 and XRCC1/DNA ligase III in an alternative route for DNA double-strand breaks rejoining [J]. J Biol Chem, 2004, 279(53): 55117-26.
Srivastava M, Nambiar M, Sharma S, et al. An inhibitor of nonhomologous end-joining abrogates double-strand break repair and impedes cancer progression [J].Cell, 2012, 151(7): 1474-87.
Pierce AJ, Johnson RD, Thompson L H, et al. XRCC3 promotes homology-directed repair of DNA damage in mammalian cell
Moschetta M, George A, Kaye SB, et al. BRCA somatic mutations and epigenetic BRCA modifications in serous ovarian cancer [J]. Ann Oncol, 2016, 27(8): 1449-55.
Junior HLR, De Oliveira RTG, De Paula Borges D, et al. Can synthetic lethality approach be used with DNA repair genes for primary and secondary MDS? [J]. Med Oncol, 2019, 36(12): 99.
Pujol P, Barberis M, Beer P, et al. Clinical practice guidelines for BRCA1 and BRCA2 genetic testing [J]. Eur J Cancer, 2021, 146: 30-47
Ledermann JA, Pujade-Lauraine E. Olaparib as maintenance treatment for patients with platinum-sensitive relapsed ovarian cancer [J]. Ther Adv Med Oncol, 2019, 11:1758835919849753.
Zheng H, Gao Y, Guo H, et al. Real-world Experience of Olaparib Treatment in Patients with Ovarian Cancer: A Chinese Multicenter Study [J]. Mol Cancer Ther, 2021,20(9): 1735-42.s [J]. Genes Dev, 1999, 13(20): 2633-8.
Toma M, Witusik-Perkowska M, Szwed M, et al. Eradication of LIG4-deficient glioblastoma cells by the combination of PARP inhibitor and alkylating agent [J].Oncotarget, 2018, 9(96): 36867-77

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Inhibition of DNA ligase IV affects the DNA damage repair pathway and decreases the sensitivity of olaparib to platinum-sensitive BRCA wild-type ovarian cancer

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials and Methods

2.1 TCGA database analysis

2.2 Cell culture and reagents

2.3 Cell viability analysis

2.4 Establish stable knockdown LIG IV cell lines

2.5 Establishment of stable overexpression cell lines

2.6 Quantitative RT-qPCR

2.7Western blot assay

2.8 Colony formation assay

2.9 Commet assay

2.10 DNA damage repair detection system containing the GFP reporter gene was constructed

2.11 Statistical Analysis

3. Results

4. Disccusion

Declarations

References

Additional Declarations

Status:

Version 1