Circular RNA FTO functions as a miR-314-3p sponge to regulate the growth and migration abilities of human retinal endothelial cells via up-regulating ZEB1

doi:10.21203/rs.3.rs-4845969/v1

Download PDF

Article

Circular RNA FTO functions as a miR-314-3p sponge to regulate the growth and migration abilities of human retinal endothelial cells via up-regulating ZEB1

https://doi.org/10.21203/rs.3.rs-4845969/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Proliferative diabetic retinopathy (PDR) belongs to the microvascular complications of diabetes mellitus. Circular RNAs are involved in PDR. The purpose of this research was to explore the specific mechanism of circFTO in PDR. circFTO expressions were prominently elevated in PDR patients and high glucose (HG) treated HRECs. Knockdown of circFTO suppressed the cell growth, migration and tube formation in the HG treated HRECs. Besides, miR-141-3p levels were decreased and ZEB1 levels were up-regulated in the HG treated HRECs. Dual-luciferase reporter results exhibited miR-141-3p bound to both circFTO and ZEB1. Additionally, miR-141-3p-silenced inverted the si-circFTO effects, and overexpression of ZEB1 reversd the miR-141-3p mimic effects. circFTO aggravated the progression of PDR via miR-141-3p/ZEB1 axi. circFTO may be a possible biomarker for PDR.

Biological sciences/Cell biology

Health sciences/Medical research/Experimental models of disease

circFTO

miR-141-3p

Proliferative diabetic retinopathy

ZEB1

The expression of circFTO was up-regulated in PDR.
circFTO-silenced depressed the growth of the HRECs.
circFTO modulated the miR-141-3p/ZEB1 axi

Diabetic retinopathy (DR) is one of the major ophthalmopathy threatening the laborers all over the world [1; 2]. The incidence rate of diabetes is increasing year by year, and the occurrence and development of DR also aggravates [3]. DR consists of non proliferative and proliferative types [4]. Proliferative DR (PDR) represents the proliferative stage of DR, which induced the retinal ischemia, hypoxia, abnormal neovascularization, vitreous body hemorrhage and traction retinal detachment. PDR is the primary cause of non traumatic vitreous hemorrhage, which seriously endangers patients' vision and even leads to blindness [5]. Previous studies have confirmed that excessive proliferation is the important causes of PDR [6; 7]. Hyperglycemia can induce excessive release of inflammatory factors in retinal tissue, and eventually lead to retinal injury [8]. In addition, the pathogenesis of DR is a process involving multiple genes and multiple factors [9]. Many protein-coding genes related to hyperglycemia have been studied during the progression of PDR [10–12]. However, the underlying mechanism of PDR still requires further investigation.

Circular RNAs (circRNAs) belongs to non-coding RNA molecules. The 3'end and the 5'end are covalently linked to form a "Backsplicing" closed loop structure by selective splicing of the precursor mRNA [13; 14]. CircRNAs were observed in RNA viruses by electron microscopy in 1976, and subsequently observed in various animals and other kinds of organisms [15; 16]. Recent studies have found that circRNAs participated in many pathophysiological processes including autophagy, apoptosis and proliferation in vivo, and were regulated to the pathological process of nervous, cardiovascular and tumor diseases [17–19]. What’s more, it has been demonstrated that circRNAs are closely related to various complications of diabetes, such as diabetic nephropathy [20], diabetes related cardiovascular disease [21], diabetic peripheral neuropathy [22] and DR [23]. The study of circRNAs and DR microvascular lesions can provide new biomarkers for the treatment of these diseases. He et al. [24] found that circFTO was prominently higher in PDR patients. However, how circFTO regulates PDR has not been reported. Therefore, in this study, we predicated and confirmed that circFTO functions as miR-141-3p sponge to regulate the ZEB1 in PDR using bioinformatic tools. We established a PDR model in vitro to investigate the functions of circFTO in PDR.

Patients and specimens

Sixty patients were recruited from Taizhou Hospital of Zhejiang Province and divided into two groups: PDR group: the retinal proliferative fibrovascular membranes were collected from 30 patients with PDR via pars plana vitrectomy. Non-PDR group: the retinal proliferative fibrovascular membranes were collected from 30 patients with idiopathic epiretinal membrane via pars plana vitrectomy. In addition, aqueous humor samples of 30 non-diabetic controls (Cataract patients) were collected as Control group via cataract surgery. This study was performed according to the principles of the Declaration of Helsinki (DOH, 2013 version) and the Association for Research in Vision and Ophthalmology (ARVO) statement for research involving human subjects. The research was agreed by the Ethical Review Committee of the Taizhou Hospital of Zhejiang Province (No. K20211233).

Cell culture

Human retinal endothelial cells (HRECs) were provided by Chinese Academy of Sciences. 30 mmol/L glucose (HG) was added to the cells to establish a PDR model group, 5.5 mmol/L glucose was added to the cells as normal control group (NG). In addition, in order to make the osmotic pressure of the 5.5 mmol/L glucose medium equal to that of the 30 mmol/L glucose medium, 24.5 mmol/L mannitol was added to the 5.5 mmol/L glucose medium. All cells were cultured in DMEM medium (300 mM osmotic pressure ) supplemented with 10% FBS and 1% penicillin-streptomycin for 4 weeks.

Cell transfection

SiRNA targeting circFTO (si-circFTO 1#, si-circFTO 2#) or si-nc, miR-141-3p inhibitor or inhibitor nc, miR-141-3p mimic or mimic nc, overexpression ZEB1 (ZEB1) and Vector was provided by GenePharma (Shanghai, China). Subsequently, all these plasmids were transfected into HRECs by Lipofectamine 2000 reagent. After that, HRECs were cultured for the following experiment. The sequences of si-circFTO 1#, si-circFTO 2#, miR-141-3p inhibitor or si-nc and inhibitor nc were as follows ( 5’-3’)

Si-circFTO 1# ATGGAGGGTGTGATGATCTCA

Si-circFTO 2# GGAGGGTGTGATGATCTCAAT

Si-nc UACUGUGCAUCAUCUGGUUUC

miR-141-3p inhibitor CCAUCUUUACCAGACAGUGUUA

inhibitor nc UCUCCUCUCAACAGGGUAAUAU

miR-141-3p mimic Forward UAUUGCACAUUACUAAGUUGCA; Reverse CAACUUAGUAAUGUGCAAUAUU

Mimic NC UUCUCCGAACGUGUCACUGUU

Cell proliferation assay

Cell proliferation abilities were measured with MTT assay. The main steps were as follows: the cells were cultured in 96-well culture plate (2 × 10³ cells per well). Then 20 µl MTT (5 g/L, Invitrogen company) were added to the cells and maintained for 4 h. Next, 150 µl DMSO (Invitrogen) was supplemented. The absorbance (A) value was detected at 490 nm with a nanodrop technology.

Cell migration assay

HRECs were planted into the upper chamber of the transwell chamber containing Matrigel. The lower chamber was supplemented with 10% FBS. After one day, 4% paraformaldehyde were added to fix the migrated HRECs, then 0.1% crystal violets were added ti stain. Finally, the migrated cells were captured and counted by a microscope in five random fields.

Tube formation assay

The serum-free medium was mixed with Matrigel matrix in the ratio of 1:1, then the medium was added to a 96-well plate at a content of 50 µl/well and placed in a 37 ℃ cell incubator for 60 min. HRECs were digested with 0.25% trypsin. After counting, the cells were resuspended and adjusted to 3 × 10⁵ cell/ml. Then the cells were placed into 96 well plates coated with matrix and maintained for 20 h, and microscope was used to analyze the tubular branches of the HRECs in 5 random fields.

Real-Time quantitative polymerase chain reaction (RT-qPCR)

All RNA of HRECs as well as tissues was obtained with Trizol (Invitrogen company). The cDNA was obtained with Prime Script™ reverse transcription Kit (Takara company). Next, RT-qPCR was carried out with SYBR Premix Ex Taq (Takara company) in CFX96 qPCR detection system (Bio-Rad company). The reaction conditions were 20 µl reaction system, and 95 ℃, 30 s; 95 ℃, 5 s; 60 ℃, 30 s 40 cycles. U6 as well as GAPDH was utilized as internal parameters. The results of RT-qPCR was quantified by 2^−ΔΔCt method.

Dual-luciferase reporter

The targeted relationships between circFTO/ZEB1 and miR-141-3p were confirmed by bioinformatics tools. The wild type (WT) and mutant type (MUT) of circFTO or ZEB1 was transferred into pmiR-RB-Report™ vector. The miR-141-3p mimic as well as WT or MUT 3’-UTR region of circFTO or ZEB1 were co-transfected into HRECs. After 48 h, the Dual Luciferase Reporter Assay Kit (Beyotime, Nantong, China) was utilized to analyze the luciferase activities.

Western blot

All proteins were obtained by RIPA lysis method and the BCA kit was utilized to analyzed the protein concentrations; after SDS-PAGE protein transfer, the transferred membrane was blocked with 5% skimmed milk powder for 1 h; Subsequently, the primary antibody (anti-E-cadherin, 1: 1000; anti-N-cadherin, 1: 1000; anti-Vimentin, 1: 1500; GAPDH, 1:500; Abcam, USA) was added incubated at 4 ℃ overnight; HRP labeled Rabbit anti mouse second antibody (1: 2000, Abcam, USA) was added and incubated at 37 ℃, 2 h. The images were determined by ECL detection system and quantified with Image J software.

Statistical analysis

The statistical analysis was performed with SPSS 21.0 software. The data in current study was expressed as means ± SD. The differences between two groups were detected with Student-T test. One-way ANOVA was carried out to analyze the differences among multiple groups. P < 0.05 indicated that there was significant difference between the groups.

The circFTO level was elevated in PDR

First, the circFTO expression in PDR patients and HG treated HRECs was measured by RT-qPCR analysis. We found that circFTO level was prominently elevated in retinal proliferative fibrovascular membranes of PDR patients compared with that in non-PDR patients and in aqueous humor samples of cataract patients (Fig. 1A). In addition, the circFTO levels weres also elevated in the HRECs of HG group (Fig. 1B).

circFTO-silenced depleted the biological behavior of the HRECs

Then, the HRECs were transtected with si-circFTO 1# and si-circFTO 2#. The circFTO level was depleted after transfection (Fig. 2A), which was more potent in si-circFTO 2# group. Therefore, si-circFTO 2# was selected for further experiments. We found that the proliferation, migration and the tube information number of HRECs in the HG group was prominently elevated, while circFTO-silenced prominently suppressed the proliferation, migration and the tube information number of HG treated HRECs (Fig. 2B-D). Furthermore, in the HG group, protein expression of E-cadherin was depleted and N-cadherin and Vimentin was elevated. However, knockdown of circFTO increased the protein levels of E-cadherin and depleted N-cadherin and Vimentin of HG treated HRECs (Fig. 2E).

circFTO sponged to miR-141-3p in HRECs

Relying on starBase (http://hopper.si.edu/wiki/mmti/Starbase), the binding sites between circFTO and miR-141-3p was displayed in Fig. 3A. Co-transfection circFTO 3’UTR-WT with miR-141-3p mimic depleted decreased the luciferase activity compared with mimic nc group (Fig. 3B). In addition, knockdown of circFTO markedly up-regulated the miR-141-3p levels in HRECs (Fig. 3C). Besides, miR-141-3p level was depleted in HG treated HRECs (Fig. 3D).

miR-141-3p-silenced abrogated si-circFTO effects in HRECs

Then we confirmed that miR-141-3p inhibitor markedly decreased the miR-141-3p expression and miR-141-3p mimic markedly increased it (Fig. 4A). Next, we demonstrated miR-141-3p-silenced abrogated the function of si-circFTO in the proliferation, migration and tube information of HRECs (Fig. 4B-D). Besides, the protein expressions of E-cadherin were depleted after miR-141-3p inhibitor treatment, while N-cadherin and Vimentin were increased (Fig. 4E).

miR-141-3p could bind to ZEB1

Targetscan database (http://www.targetscan.org/vert_72/) confirmed the binding sites between ZEB1 and miR-141-3p (Fig. 5A). Co-transfection ZEB1 3’UTR-WT with miR-141-3p mimic prominently decreased the luciferase activity compared with mimic nc group (Fig. 5B). In addition, over expressed miR-141-3p markedly elevated the ZEB1 expression in HRECs (Fig. 5C) and the ZEB1 expression was increased in HG treated HRECs (Fig. 5D).

Over expressed ZEB1 abrogated the miR-141-3p mimic effects in HRECs

Finally, we confirmed that the ZEB1 expression was markedly up-regulated after ZEB1 transfection (Fig. 6A). After miR-141-3p mimic transfection, the proliferation, migration and the tube information of HRECs was significantly decreased (Fig. 6B-D), which was reversed by overexpressed ZEB1. Moreover, upregulation of ZEB1 antagonized the effects of miR-141-3p mimic on the E-cadherin, N-cadherin and Vimentin levels (Fig. 6E).

In current study, we confirmed circFTO was prominently elevated in the PDR patient as well as HERCs stimulated by HG. Interestingly, circFTO-silenced inhibited the proliferation, migration and tube information of HRECs. Additionally, we demonstrated that circFTO regulated the PDR progression through modulating miR-141-3p/ZEB1 axis.

EMT is a vital step in the cell proliferation and migration[25]. As a physiological and pathological phenomenon, EMT refers to the loss of epithelial cell characteristics and the acquisition of stromal cell characteristics [26]. The EMT process mediates the decrease of the membrane protein Ecadherin expression, which mediates the tight junction between epithelial cells, and the up-regulation of the expression of connexins such as N-cadherin or Vimentin between stromal cells [27]. Excessive proliferation and migration is the main manifestation of PDR [28]. Yang et al. [29] confirmed that E-cadherin was depleted and N-cadherin, Vimentin were elevated in HG treated ARPE19 cells, implying that EMT is the key of the development of DR. Similarly, in this study, we found the E-cadherin protein levels were was decreased, N-cadherin and Vimentin was increased in HG stimulated HERCs. These results suggested that regulation of EMT development might be a novel methods of PDR treatment.

In recent years, many reports discovered that circRNAs are single stranded circular RNA without 3 'and 5' terminal structures [18]. Circular RNAs consist of exonic circular RNAs (ecricRNAs), intron circular RNAs (ciRNAs) and exon intron circular RNAs (ElciRNAs) [30]. Various circRNAs have been demonstrated to be participate in the DR progression. Li et al [31] found circRNA_0084043 was up-regulated in the HG incubated ARPE-19 cells, and induced the oxidative damage and inflammation in the DR development. Jiang et al. [32] confirmed that circZNF532 participated in the modulation of proliferation and differentiation of pericytes in DR. Similarly, current study demonstrated that circFTO was elevated in both PDR tissues and HG-treated HERCs. circFTO-silenced suppressed the biological behavior of the HG-treated HERCs. These results were consistent with He et al study [24].

As sponge adsorbents or competitive endogenous RNA molecules of miRNA, circRNAs can compete with corresponding miRNA to regulate the mRNA expression [22]. MiRNAs have been demonstrated to inhibit the mRNA translation, and regulate various biological processes [33]. Accumulating reports have found that cricRNAs regulate cell biological behavior through sponging miRNA in DR. Zou et al. [34] found that circCOL1A2 promotes the developments of DR via negative regulating miR-29b expressions. Li et al. [31] confirmed circRNA_0084043 relieved pathological development of DR via sponging miR-140-3p. In this research, we demonstrated circFTO functions as a miR-141-3p sponge in HG treated HERCs via bioinformatic tools. Double Luciferase Report and RNA-pull down assays further confirmed circFTO could binds to miR-141-3p, which was proved to inhibit proliferation as well as migration in various diseases. Zhang et al. [35] showed miR-141-3p suppressed the growth as well as migration of vascular smooth muscle cells to relieve atherosclerosis through regulating the Keap1/Nrf2/HO-1 signaling pathway. Besides, miR-141-3p also exhibited anti-proliferation effects in cancers, including colorectal cancer [36], osteosarcoma [37], and breast cancer [38]. This research confirmed miR-141-3p was elevated in HG treated HERCs. miR-141-3p-silenced antagonized the si-circFTO effects. Zhang et al [39] demonstrated miR-141-3p depressed the growth of retinal vascular epithelial cells and promoted apoptosis of retinal ganglion cells, which was similar to our results. These results indicated that circFTO regulated the development of PDR via sponging miR-141-3p.

Subsequently, we confirmed circFTO up-regulates ZEB1 expression via competitively binding with miR-141-3p. ZEB1 is a transcriptional inhibitor of E-cadherin in the process of epithelial cell transdifferentiation into mesenchymal cells. Up-regulation of ZEB1expressions inhibited the E-cadherin levels [40]. For instances, miR-873 regulated the growth as well as metastasis of papillary thyroid cancer cells via modulating ZEB1 [41]. Additionally, Han et al. [42] demonstrated miRNA-150-5p negatively regulated ZEB1 in the development of diabetic cardiomyopathy. However, the research on ZEB1 in PDR is very limited. In present research, miR-141-3p had a direct targeting relationship with ZEB1. Overexpression of miR-141-3p prominently depleted the ZEB1 expression, while over expressed ZEB1 inverted the miR-141-3p mimic effects in HERCs. Our results suggested that circFTO may promote the biological behavior of HG treated HERCs through modulating the miR-141-3p/ZEB1 axis.

To sum up, circFTO functioned as a sponge of miR-141-3p in PDR via regulating ZEB1. Moreover, circFTO may regulate the biological behavior of HERCs through modulating the miR-141-3p/ZEB1 axis. This research may provide a novel theoretical basis for the PDR therapy in the future.

Ethics approval and consent to participate

This study was performed in line with the principles of the Declaration of Helsinki. All methods were carried out in accordance with relevant guidelines and regulations. Informed consent was obtained from all individual participants included in the study. The research was agreed by the Ethical Review Committee of the Taizhou Hospital of Zhejiang Province (No. K20211233).

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

The work was supported by Zhejiang Province Taizhou City Science and Technology Bureau Project under grant number KY202211180001.

Authors' contributions

All authors participated in the design, interpretation of the studies and analysis of the data and review of the manuscript; RJ H, EH L, GC L and B X conducted the experiments; YY C wrote the manuscript, and J Z provided the ideas.All authors read and approved the final manuscript.

Acknowledgements

Not applicable.

Lechner, J., O'Leary, O. E. & Stitt, A. W. The Pathology Associated with Diabetic Retinopathy. Vision research (Oxford). 139, 7–14 (2017).
Ebneter, A. & Zinkernagel, M. S. Novelties in Diabetic Retinopathy. Endocrine development. 31, 84 (2016).
Saw, M., Wong, V. W., Ho, I. V. & Liew, G. New Anti-Hyperglycaemic Agents for Type 2 Diabetes and their Effects On Diabetic Retinopathy. Eye (London, England). 33, 1 (2019).
Giuliari, G. P. Diabetic Retinopathy: Current and New Treatment Options. Curr. Diabetes Reviews. 8, 32 (2012).
Nawaz, I. M. et al. Human Vitreous in Proliferative Diabetic Retinopathy: Characterization and Translational Implications. Prog. Retin. Eye Res. 72, 100756 (2019).
Wu, Y. et al. Analysis of Risk Factors for Progressive Fibrovascular Proliferation in Proliferative Diabetic Retinopathy. Int. Ophthalmol. 40, 2495–2502 (2020).
Tomita, Y. et al. Vitreous Metabolomics Profiling of Proliferative Diabetic Retinopathy. Diabetologia. 64, 70–82 (2021).
Zhang, W., Dong, X., Wang, T. & Kong, Y. Exosomes Derived From Platelet-Rich Plasma Mediate Hyperglycemia-Induced Retinal Endothelial Injury Via Targeting the Tlr4 Signaling Pathway. Exp. Eye Res. 189, 107813 (2019).
Heng, L. Z. et al. Diabetic Retinopathy: Pathogenesis, Clinical Grading, Management and Future Developments. Diabetic Med. 30, 640–650 (2013).
Shao, J., Zhang, Y., Fan, G., Xin, Y. & Yao, Y. Transcriptome Analysis Identified a Novel 3-Lncrna Regulatory Network of Transthyretin Attenuating Glucose Induced Hrecs Dysfunction in Diabetic Retinopathy. Bmc Med. Genomics. 12, 134 (2019).
Shao, J. et al. A Novel Transthyretin/Stat4/Mir-223-3P/Fbxw7 Signaling Pathway Affects Neovascularization in Diabetic Retinopathy. Mol. Cell. Endocrinol. 498, 110541 (2019).
Zhang, X., Zou, X., Li, Y. & Wang, Y. Downregulation of Lncrna Bancr Participates in the Development of Retinopathy Among Diabetic Patients. Exp. Ther. Med. 17, 4132–4138 (2019).
Kristensen, L. S. et al. The Biogenesis, Biology and Characterization of Circular Rnas. Nature reviews. Genetics. 20, 675–691 (2019).
Chen, L. The Expanding Regulatory Mechanisms and Cellular Functions of Circular Rnas. Nature reviews. Molecular cell biology. 21, 475–490 (2020).
Memczak, S. et al. Circular Rnas are a Large Class of Animal Rnas with Regulatory Potency. Nature. 495, 333–338 (2013).
Rybak-Wolf, A. et al. Circular Rnas in the Mammalian Brain are Highly Abundant, Conserved, and Dynamically Expressed. Mol. Cell. 58, 870–885 (2015).
D'Ambra, E., Capauto, D. & Morlando, M. Exploring the Regulatory Role of Circular Rnas in Neurodegenerative Disorders. International journal of molecular sciences. 20, 5477 (2019).
Aufiero, S., Reckman, Y. J., Pinto, Y. M. & Creemers, E. E. Circular Rnas Open a New Chapter in Cardiovascular Biology. Nat. Rev. Cardiol. 16, 503–514 (2019).
Li, Z. et al. Tumor-Suppressive Circular Rnas: Mechanisms Underlying their Suppression of Tumor Occurrence and Use as Therapeutic Targets. Cancer Sci. 110, 3630–3638 (2019).
Loganathan, T. S. et al. Interactions Among Non-Coding Rnas in Diabetic Nephropathy. Front. Pharmacol. 11, 191 (2020).
Zaiou, M. Circrnas Signature as Potential Diagnostic and Prognostic Biomarker for Diabetes Mellitus and Related Cardiovascular Complications. Cells. 9, (2020).
Zhang, H. H. et al. Circular Rna Profile in Diabetic Peripheral Neuropathy: Analysis of Coexpression Networks of Circular Rnas and Mrnas. Epigenomics. 12, 843–857 (2020).
Zhang, S. et al. Identification and Characterization of Circular Rnas as a New Class of Putative Biomarkers in Diabetes Retinopathy. Invest. Ophthalmol. Vis. Sci. 58, 6500–6509 (2017).
He, M. et al. Comparison of Expression Profiling of Circular Rnas in Vitreous Humour Between Diabetic Retinopathy and Non-Diabetes Mellitus Patients. Acta Diabetol. 57, 479–489 (2020).
Yang, Y. & Yang, W. Epithelial-to-Mesenchymal Transition in the Development of Endometriosis. Oncotarget. 8, 41679–41689 (2017).
Lamouille, S., Xu, J. & Derynck, R. Molecular Mechanisms of Epithelial-Mesenchymal Transition. Nature reviews. Molecular cell biology. 15, 178–196 (2014).
Piera-Velazquez, S. & Jimenez, S. A. Endothelial to Mesenchymal Transition: Role in Physiology and in the Pathogenesis of Human Diseases. Physiol. Rev. 99, 1281–1324 (2019).
Meng, W. et al. Microrna-126 Suppresses the Proliferation and Migration of Endothelial Cells in Experimental Diabetic Retinopathy by Targeting Polo-Like Kinase 4. Int. J. Mol. Med. 47, 151–160 (2021).
Yang, Y., Zhou, J., Li, W. H., Zhou, Z. X. & Xia, X. B. Lncrna Neat1 Regulated Diabetic Retinal Epithelial-Mesenchymal Transition through Regulating Mir-204/Sox4 Axis. PeerJ (San Francisco, CA). 9, e11817 (2021).
Ruan, Y. et al. Functions of Circular Rnas and their Potential Applications in Gastric Cancer. Expert Rev. Gastroenterol. Hepatol. 14, 85–92 (2020).
Li, Y., Chen, T., Wan, C. & Cang, H. Circrna_0084043 Contributes to the Progression of Diabetic Retinopathy Via Sponging Mir-140-3P and Inducing Tgfa Gene Expression in Retinal Pigment Epithelial Cells. Gene. 747, 144653 (2020).
Jiang, Q. et al. Circular Rna-Znf532 Regulates Diabetes-Induced Retinal Pericyte Degeneration and Vascular Dysfunction. J. Clin. Invest. 130, 3833–3847 (2020).
Shan, K. et al. Circular Noncoding Rna Hipk3 Mediates Retinal Vascular Dysfunction in Diabetes Mellitus. Circulation (New York, N.Y.). 136, 1629–1642 (2017).
Zou, J., Liu, K., Wang, W. & Xu, Y. Circular Rna Col1a2 Promotes Angiogenesis Via Regulating Mir-29B/Vegf Axis in Diabetic Retinopathy. Life sciences (1973). 256, 117888 (2020).
Zhang, C., Kong, X. & Ma, D. Mir-141‐3P Inhibits Vascular Smooth Muscle Cell Proliferation and Migration Via Regulating Keap1/Nrf2/Ho‐1 Pathway. Iubmb Life. 72, 2167–2179 (2020).
Liang, Z. et al. Mir-141-3P Inhibits Cell Proliferation, Migration and Invasion by Targeting Traf5 in Colorectal Cancer. Biochem. Biophys. Res. Commun. 514, 699–705 (2019).
Wang, L. Mir-141-3P Overexpression Suppresses the Malignancy of Osteosarcoma by Targeting Fus to Degrade Ldhb. Biosci. Rep. 40, (2020).
Sun, S., Ma, J., Xie, P., Wu, Z. & Tian, X. Hypoxia-Responsive Mir-141-3P is Involved in the Progression of Breast Cancer Via Mediating the Hmgb1/Hif-1Alpha Signaling Pathway. J. Gene. Med. 22, e3230 (2020).
Zhang, L. Q. et al. Microrna-141‐3P Inhibits Retinal Neovascularization and Retinal Ganglion Cell Apoptosis in Glaucoma Mice through the Inactivation of Docking Protein 5‐Dependent Mitogen‐Activated Protein Kinase Signaling Pathway. J. Cell. Physiol. 234, 8873–8887 (2019).
Manshouri, R. et al. Zeb1/Nurd Complex Suppresses Tbc1D2B to Stimulate E-Cadherin Internalization and Promote Metastasis in Lung Cancer. Nat. Commun. 10, 5115–5125 (2019).
Liu, J. et al. Circfat1(E2) Promotes Papillary Thyroid Cancer Proliferation, Migration, and Invasion Via the Mirna-873/Zeb1 Axis. Comput. Math. Method Med. 2020, (2020).
Han, Y., Tian, H. & Gao, X. Norad Regulates Proliferation and Apoptosis in Cardiomyocytes Under High-Glucose Treatment through Mirna-150-5P/Zeb1 Axis. Eur. Rev. Med. Pharmacol. Sci. 24, 11259–11265 (2020).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Circular RNA FTO functions as a miR-314-3p sponge to regulate the growth and migration abilities of human retinal endothelial cells via up-regulating ZEB1

Status:

Version 1

Abstract

Figures

Highlights

Introduction

Materials and methods

Patients and specimens

Cell culture

Cell transfection

Si-circFTO 1# ATGGAGGGTGTGATGATCTCA

Si-circFTO 2# GGAGGGTGTGATGATCTCAAT

Cell proliferation assay

Cell migration assay

Tube formation assay

Real-Time quantitative polymerase chain reaction (RT-qPCR)

Dual-luciferase reporter

Western blot

Statistical analysis

Results

The circFTO level was elevated in PDR

circFTO-silenced depleted the biological behavior of the HRECs

circFTO sponged to miR-141-3p in HRECs

miR-141-3p-silenced abrogated si-circFTO effects in HRECs

miR-141-3p could bind to ZEB1

Discussion

Declarations

References

Additional Declarations

Status:

Version 1