Sensing of endogenous retroviruses-derived RNA by ZBP1 triggers PANoptosis in DNA damage and contributes to toxic side effects of chemotherapy

doi:10.21203/rs.3.rs-4846739/v1

Download PDF

Article

Sensing of endogenous retroviruses-derived RNA by ZBP1 triggers PANoptosis in DNA damage and contributes to toxic side effects of chemotherapy

https://doi.org/10.21203/rs.3.rs-4846739/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Excessive DNA damage triggers various types of programmed cell death (PCD), yet the regulatory mechanism of DNA damage-induced cell death is not fully understood. Here, we report that PANoptosis, a coordinated PCD pathway including pyroptosis, apoptosis and necroptosis, is activated by DNA-damage. The Z-DNA binding protein 1 (ZBP1) is the apical sensorof PANoptosis and essential for PANoptosome assembly in response to DNA damage. We find endogenous retroviruses (ERVs) are activated by DNA damage and act as ligands for ZBP1 to trigger PANoptosis. By using ZBP1 knock-out and knock-in mice disrupting ZBP1 nucleic acid-binding activity, we demonstrate that ZBP1-mediated PANoptosis contributes to toxic effects of chemotherapeutic drugs, which is dependent on ZBP1 nucleic acid-binding activity. We found ZBP1 expression is downregulated in tumor tissue. Furthermore, in colorectal cancer patients, dsRNA is induced by chemotherapy and sensed by ZBP1 in normal colonic tissues, suggesting ZBP1-mediated PANoptosis is activated by chemotherapy in normal tissues. Our findings indicate ZBP1-mediated PANoptosis is activated by DNA damage and contributes to toxic side effects of DNA-damage based chemotherapy. These data suggest that ZBP1 could be a promising therapeutic target to alleviate chemotherapy-related side effects.

Biological sciences/Biochemistry/DNA

Biological sciences/Cell biology/Autophagy

Biological sciences/Molecular biology/Epigenetics

DNA damage

PANoptosis

ZBP1

Chemotherapy

Side-effects

Triggering DNA damage-induced cell death has been implicated as an important mechanism in cancer treatments such as chemotherapy or radiotherapy¹. However, many aspects of DNA damage-induced cell death are not fully understood. For example, theoretically, the main role of DNA damage compounds in chemotherapy is to target rapidly dividing cancer cells to trigger cell death while minimizing damage to normal, healthy cells². However, normal cells can also be damaged by chemotherapy drugs, which could contribute to side effects of chemotherapy³. The toxic side effects of chemotherapy to the human body are not only the major dose-limiting-factors in clinical practice but also cause serious reduction in the quality of life. Therefore, identification of key mechanisms that are involved in chemotherapy-induced damage in normal cells could provide an exciting opportunity to optimize chemotherapy treatment and improve cancer care.

PANoptosis is a coordinated cell death pathway that integrates key components of pyroptosis, apoptosis and necroptosis⁴. It is regulated by a single cell death-inducing complex named PANoptosome, which contains key molecules crucial for pyroptosis, apoptosis and necroptosis and is able to activate all three to execute proinflammatory cell death⁵. Currently, several types of PANoptosome complexes have been characterized, including ZBP1- (Z-DNA binding protein 1 or DAI, DNA-dependent activator of interferon regulatory factors), AIM2- (absent in melanoma-2), RIPK1- (receptor interacting protein kinase 1), and NLRP12 (NOD-like receptor family, pyrin domain–containing 12)-PANoptosome⁶. In ZBP1-PANoptosome, ZBP1 acts as a PANoptosis senor to activate NLRP3 inflammasome, caspase-8, RIPK1, and RIPK3 in response to influenza A virus (IAV) infection⁶. In this scenario, caspase-6 (Casp-6) was reported to facilitate the interaction between ZBP1 and RIPK3⁷. ZBP1-mediated PANoptosis has been shown to play a critical role in infectious and inflammatory diseases such as viruses and fungi infections and septic inflammation^{7, 8, 9, 10, 11}. However, whether ZBP1-mediated PANoptosis is involved in DNA damage-induced cell death is not investigated.

ZBP1 is a cytosolic nucleic acid sensor that plays a crucial role in the regulation of cell death and inflammation, particularly in the context of viral infection and immune responses^{12, 13}. ZBP1 contains two Zα domains (Zα1 and Zα2) in its N-terminus and two RHIM (receptor interacting protein [RIP] homotypic interaction motif) domains in the middle. ZBP1 uses its two Zα domains to bind with left-handed Z-DNA or RNA and then drives the RHIM-mediated interactions with RIPK3 (Receptor-interacting protein kinase 3) to trigger inflammatory cell death ^{9, 14, 15, 16, 17}. In sterile conditions, ZBP1 has been shown to recognize ERV-derived dsRNA to induce necroptosis and inflammation ^{18, 19, 20}.

In this study, we find ZBP1-mediated PANoptosis is activated by DNA-damaging compounds. Mechanistically, ERVs are reactivated by DNA damage and act as ligands of ZBP1 to trigger PANoptosis. We further show that ZBP1-mediated PANoptosis contributes to toxic effects of chemotherapeutic drugs. These data suggest that ZBP1 could be a potential therapeutic target to alleviate chemotherapy-induced side effects.

ZBP1 is involved in DNA damage-induced cell death

It is known that ZBP1 mediates various PCD pathways in infectious and sterile conditions¹². However, whether ZBP1 is involved in DNA damage-induced cell death is unknown. To examine the role of ZBP1 in DNA damage-induced cell death, we firstly used wild-type (WT) and ZBP1-null (ZBP1^−/−) mouse (Supplementary Fig. 1) dermal fibroblasts (MDFs) to compare the sensitivity of these cells to DNA damage-induced cell death. By treating the cells with different DNA-damaging compounds, including topoisomerases inhibitor etoposide (ETO), DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), DNA cross-linking agent cisplatin (CDDP) and antimetabolites inhibitor 5-FU, we found DNA damage-induced cell death was significantly attenuated in ZBP1^−/− MDFs compared with WT MDFs, as observed with microscopy and quantitated by propidium iodide (PI) staining (Fig. 1a and b). Since ZBP1 controls the activation of multiple types of PCD pathways including pyroptosis, necroptosis and apoptosis¹³, we then investigated whether these types of PCD were affected in ZBP1^−/− MDFs. By checking the commonly used markers for PCD pathways, including caspase-3 (Casp-3) cleavage for apoptosis, MLKL phosphorylation for necroptosis and Gasdermin-D (GSDMD) or E (GSDME) cleavage for pyroptosis, we found apoptosis, necroptosis and pyroptosis were all activated by treatment with ETO, MNNG and CDDP in WT MDFs, while the activation of these forms of PCD was suppressed in ZBP1^−/− MDFs (Fig. 1c-e). Furthermore, when ZBP1 expression was reconstituted in ZBP1^−/− MDFs, the sensitivity of these cells to ETO- and MNNG-induced cell death was restored in a comparable manner to WT MDFs (Fig. 1f). Additionally, we found Casp-3 cleavage, MLKL phosphorylation and GSDME cleavage were all reactivated by ETO- and MNNG-treatment in ZBP1-reconstituted MDFs (Fig. 1g and h). Thus, these results indicate that ZBP1 plays a critical role in DNA damage-induced PCD pathways, including pyroptosis, apoptosis and necroptosis.

DNA damage induces PANoptosis by promoting ZBP1-PANoptosome assembly

To investigate the action mechanism of ZBP1 in DNA damage-induced cell death, we firstly tested whether ZBP1 was involved in DNA damage response pathways by examining the phosphorylation of γH2AX and p53, two proteins known to be activated specifically in response to DNA damage²¹. We found that loss of ZBP1 had no effects on ETO-induced phosphorylation of γH2AX and p53, suggesting ZBP1 is not involved in DNA damage response pathways (Fig. 2a).

PANoptosis is a coordinated cell death pathway that integrates key components of apoptosis, necroptosis and pyroptosis⁶. As we found ZBP1 was required for DNA damage-induced pyroptosis, apoptosis and necroptosis, we then investigated whether DNA damage was able to induce ZBP1-mediated PANoptosis. In necroptosis signaling pathway, receptor-interacting serine/threonine protein kinase 3 (RIPK3) is the key upstream kinase of MLKL^{22, 23}. We found CRISPR/Cas9-mediated knockout of RIPK3 partially protected MDFs against ETO-induced cell death (Fig. 2b). Additionally, knockout of RIPK3 blocked MLKL phosphorylation but had no effects on cleavage of Casp-3 and GSDME in ETO-treated cells (Fig. 2c), indicating RIPK3 is essential for DNA damage-induced necroptosis but not apoptosis and pyroptosis. Moreover, compared with WT MDFs, ETO-induced RIPK3 phosphorylation was significantly attenuated in ZBP1^−/− MDFs (Fig. 2d), suggesting ZBP1 acts upstream of RIPK3 to regulate DNA damage-induced necroptosis. Previous study reported that Casp-6 is required for virus-induced PANoptosis by regulating ZBP1-PANoptosome assembly⁷. To test whether Casp-6 was involved in DNA-damage induced cell death, we firstly knocked out Casp-6 in MDFs and found that loss of Casp-6 protected cells against ETO-induced cell death (Fig. 2e). Additionally, compared with the control cells, ETO-induced Casp-3 cleavage, MLKL phosphorylation and GSDME cleavage were all suppressed by Casp-6 knockout (Fig. 2f), suggesting Casp-6 is required for DNA damage-induced PANoptosis.

Given ZBP1 regulated RIPK3 phosphorylation in DNA damage and Casp-6 is required for DNA damage-induced PANoptosis, we then tested whether ZBP1 could form a PANoptosome complex with RIPK3 and Casp-6 in response to DNA damage. As ZBP1 antibody is not good for immunoprecipitation²⁴, we used ZBP1-reconstituted MDFs by stably expressing Flag tagged-ZBP1 protein in immortalized ZBP1^−/− MDFs and performed immunoprecipitation experiment with anti-Flag antibody. As shown in Fig. 2g, RIPK3 and Casp-6 protein were both co-precipitated with Flag tagged-ZBP1 after ETO treatment, indicating DNA damage induces ZBP1-PANoptosome assembly. Additionally, although it has been shown that RIPK1 is crucial for DNA damage-induced apoptosis and necroptosis^{25, 26, 27}, we could not detect the presence of RIPK1 in ZBP1-PANoptosome complex, suggesting RIPK1 is not involved in DNA damage-induced PANoptosis (Fig. 2g). Taken together, these data indicate that DNA damage induces ZBP1-PANoptosome assembly to drive PANoptosis.

The Zα domain of ZBP1 is required for DNA damage-induced PANoptosome assembly and PANoptosis

ZBP1 protein contains two Zα domains (Zα1 and Zα2) in its N-terminus, which mediate the interactions with left-handed Z-DNA or RNA. It also contains two receptor-interacting protein homotypic interaction motif (RHIM) domains in the center part, which mediate the interactions with other RHIM domain containing proteins such as RIPK1 and RIPK3 (Fig. 3a)¹². To investigate how ZBP1 senses the signal to trigger PANoptosis in DNA damage, we generated a knock-in mouse with mutations at two Zα domains of ZBP1 (ZBP1^mutZα1α2) (Supplementary Fig. 2), which results in the expression of a mutant ZBP1 that is unable to interact with Z-form nucleic acids²⁸. We then isolated MDFs (MDF^mutZα1α2) from the mice and compared the sensitivity of these cells with WT MDFs to DNA damage-induced cell death. As observed with microscopy and quantitated by PI staining, we found DNA damage-induced cell death was significantly reduced in MDFs^mutZα1α2 compared to WT MDFs (Fig. 3b and c). Moreover, ETO- and MNNG-induced Casp-3 cleavage, MLKL phosphorylation and GSDME cleavage were all attenuated in MDF^mutZα1α2 cells (Fig. 3d and e), indicating the Zα domains of ZBP1 are required for DNA damage-induced PANoptosis.

To investigate whether the Zα domains of ZBP1 regulate PANoptosome assembly in DNA damage, we reconstituted immortalized ZBP1^−/− MDFs with Flag tagged-ZBP1 containing Zα domain mutations (Flag-ZBP1-mutZα1α2) and performed immunoprecipitation experiment with anti-Flag antibody. As shown in Fig. 3f, compared with Flag-ZBP1 protein, Flag-ZBP1-mutZα1α2 protein failed to co-precipitate with RIPK3 and Casp-6 after ETO treatment, suggesting Zα domain of ZBP1 is required for DNA damage-induced PANoptosome assembly. Therefore, these data indicate that the Zα domains of ZBP1 are required for DNA damage-induced PANoptosome assembly and PANoptosis.

ZBP1 binds to dsRNA to promote PANoptosome assembly in DNA damage

As the Zα domains of ZBP1 mediate the binding of Z-form nucleic acids to ZBP1, we then investigated whether some nucleic acids signals were triggered by DNA damage and required for PANoptosome assembly. To determine whether ZBP1-mediated PANoptosome assembly in response to DNA damage requires DNA or RNA, we firstly treated the cell lysate of ZBP1-reconstituted MDFs with DNase I to degrade DNA or RNase A to degrade RNA, respectively, and then performed immunoprecipitation experiment with anti-Flag antibody. We found only RNase A treatment diminished the interaction between ZBP1 and RIPK3 (Fig. 4a), suggesting RNA is required for ZBP1-PANoptosome assembly in DNA damage. We then examined if dsRNA is produced in DNA damage by performing immunofluorescent staining with the specific anti-dsRNA antibody J2. As shown in Fig. 4b, we found the signal produced by J2 antibody was significantly increased in cytoplasm after ETO treatment. Moreover, the signal was sensitive to RNase A and dsRNA-specific RNase III treatment, but not to DNase I treatment (Fig. 4b), suggesting DNA damage induces the production of dsRNA. As ZBP1 was reported to recognize Z-form nucleic acids through its Zα domains, we then examined whether ETO-induced dsRNA was Z-form by performing immunofluorescent staining with an antibody (Z22) specific for Z-form DNA or RNA. As shown in Fig. 4c, we could not detect the signal produced by Z22 antibody in ETO-treated cells, although this antibody detected Z-form DNA very well in the cells treated with CBL0137, a potent inducer of Z-form DNA in mammalian cells²⁹. To examine whether DNA damage-induced dsRNA could bind to ZBP1, we performed a proximity ligation amplification assay (PLA) in ZBP1-reconstituted MDFs. Confocal imaging by using antibodies against dsRNA and Flag showed that a markedly increase of dsRNA-Flag-ZBP1 association in Flag-ZBP1-reconstituted MDFs, but not in Flag-ZBP1-mutZα1α2-reconstituted MDFs in response to ETO treatment (Fig. 4d). Taken together, these data suggest that dsRNA is induced by DNA damage and can be recognized by ZBP1 through its Zα domains to trigger PANoptosome assembly.

ERVs are transcriptionally upregulated by DNA damage and act as ligands for ZBP1

Upon ERV activation, dsRNA species may be formed by pairing of ERV RNA with cellular antisense transcripts³⁰. It has been well established that ZBP1 can recognize dsRNA from ERVs under sterile conditions, which is essential for ZBP1 activation^{18, 19}. To test if ERV-derived dsRNA is involved in DNA damage-induced PANoptosis, we firstly examined whether ERV elements were transcriptionally activated by DNA damage. By examined the RNA-seq data from untreated control and ETO-treated MDFs, we identified a set of retrotransposons was upregulated by ETO and most of them belong to long terminal repeat (LTR)-containing ERVs (Fig. 5a and Supplementary table I). Importantly, a number of upregulated ERVs were expressed in both sense and antisense directions with overlapping sequences, raising the probability that these ERVs could pair and form dsRNAs (Fig. 5b and Supplementary table I). We then further confirmed that the two ERVs identified by RNA-Seq, RLTR45-int and RLTR1B-int, were upregulated by ETO or CDDP treatment through Real-time (RT)-RCR analysis (Fig. 5c, Supplementary Fig. 3a). To tested whether ERV derived-dsRNA could bind ZBP1, we performed RNA-immunoprecipitation and RT-PCR experiments with Flag antibody in ZBP1-reconstituted MDFs. As shown in Fig. 5d and Supplementary Fig. 3a, we found RLTR1B-int and RLTR45-int were markedly increased in Flag-ZBP1 precipitated samples upon ETO or CDDP-treatment, respectively. Together, these data indicate that ERVs are transcriptionally upregulated by DNA damage and can be recognized by ZBP1 in DNA damage.

ZBP1-mediated PANoptosis contributes to chemotherapy-induced toxicity in mice

DNA-damaging agents including ETO, CDDP and 5-FU are among the most effective chemotherapy agents in cancer treatment, however, the clinical utility of these effective chemotherapy agents is dose limited by their toxic adverse effects³. Since we found DNA damage induced ZBP1-mediated PANoptosis, we then tested whether ZBP1 contributed to the adverse effects of DNA damaging agents used in chemotherapy. To do so, a mouse model of chemotherapy-induced toxicity was established by intravenous injection of mice with ETO. We found that ETO severely disrupted the crypts and villi in small intestines and resulted in severe vascular damage, increased neutrophil infiltration and IL-6 expression in lung of WT mice, while these effects were significantly attenuated in ZBP1^−/− and ZBP1^mutZα1α2 mice (Fig. 6a-f). Additionally, the spleen weight and the number of spleen lymphocytes were significantly reduced by ETO treatment in WT mice compared to ZBP1^−/− and ZBP1^mutZα1α2 mice (Fig. 6g and h). Moreover, peritoneal injection of CDDP also caused loss of the crypts in small intestine, increased vascular damage and neutrophil infiltration in lung and decreased number of spleen lymphocytes in WT mice, and all of these effects were alleviated in ZBP1^−/− and ZBP1^mutZα1α2 mice (Fig.S4). To further confirm PANoptosis is involved in chemotherapy-induced toxicity, we then examined Casp-3 cleavage, MLKL phosphorylation and GSDME cleavage in small intestines of the mice and found the activation of these PANoptotic markers by ETO-treatment was blocked in Zbp1^−/− and ZBP1^mutZα1α2 mice (Fig. 6i). Furthermore, we found ETO- and CDDP-treatment induced dsRNA production in mice small intestines (Fig. 6j). We then performed PLA assay by using J2 and ZBP1 antibodies and found ETO- or CDDP-treatment markedly increased red fluorescence signal of PLA in mice small intestines compared to vehicle control treatment, which suggests chemotherapy-induced dsRNA can be recognized by ZBP1 in vivo (Fig. 6k). Taken together, these data suggest that ZBP1-drived PANoptosis contributes to chemotherapy-induced toxicity and inflammation in mice.

Chemotherapy-induced dsRNA is sensed by ZBP1 in noncancerous tissues from the patients with colorectal cancer (CRC)

Expression of ZBP1 has been shown to be downregulated in tumor tissues³¹. Consistent with this study, we found ZBP1 expression is absent in all checked human cancer cell lines (Fig. 7a). Furthermore, by collecting fresh normal and tumorous surgical samples from the same patient with CRC (Supplementary table II), we found ZBP1 expression is significantly lower or absent in tumor compared to their matched noncancerous colonic tissues, while the expression of Casp-6, RIPK3 and MLKL were generally comparable in both normal and tumorous tissues (Fig. 7b). Thus, these data suggest that tumors may evade ZBP1-mediated cell death by downregulation of ZBP1 expression and ZBP1-drived PANoptosis is most likely activated by chemotherapy in noncancerous tissues.

To determine whether ZBP1-drived PANoptosis is activated by chemotherapy, we firstly examined dsRNA expression, as we showed it could be recognized by ZBP1 to trigger PANoptosis, in normal colonic tissues with/out oxaliplatin-based chemotherapy in CRC patients (Supplementary table II). We found dsRNA expression was induced by oxaliplatin-based chemotherapy (Fig. 7c, d and supplementary Fig. 5). Furthermore, the association between dsRNA and ZBP1 was detected by PLA assay in these normal colonic tissues with chemotherapy (Fig. 7e). Thus, these data suggest that chemotherapy-induced dsRNA can be sensed by ZBP1 and may trigger PANoptosis in noncancerous tissues in CRC patients.

Although DNA damage-induced apoptosis and necroptosis have been well characterized^{25, 26, 27}, the involvement of PANoptosis in DNA damage-induced cell death is not investigated. In this study, we found ZBP1-drived PANoptosis was activated by DNA damage. Previous studies showed that ZBP1-drived PANoptosis was induced in infectious diseases^{7, 9}. By binding viral-derived Z-RNA, ZBP1 triggers the assembly of PANoptosome complex, which contains several key components in multiple PCD pathways including RIPKs, NLRP3, ASC, Casp-6 and Casp-8^{7, 9}. In DNA damage, we demonstrated the assembled PANoptosome complex at least included ZBP1, RIPK3 and Casp6. Although RIPK1 is crucial for DNA damage-induced apoptosis and necroptosis²⁵, we found RIPK1 was not involved in the assembly of ZBP1-PANoptosome in response to DNA damage. This observation suggests that the assembly components in ZBP1-PANoptosome are varied under different stress conditions.

The two Zα-domains in ZBP1 have been shown to specifically bind nucleic acids in left-handed Z-conformation (Z-RNA or Z-DNA), which is essential for ZBP1 to trigger inflammatory cell death³². We found dsRNA was induced by DNA damage and the binding of dsRNA to ZBP1 through its Zα-domain was crucial for DNA damage-induced PANoptosis. However, we could not detect the presence of Z-RNA in the cells by immunofluorescence staining with an anti-Z-NA Z22 antibody. It is believed that Z-RNA or Z-DNA duplexes were unstable and difficult to form under natural conditions in living cells³². However, previous studies showed that the Zα domain of an RNA editing enzyme ADAR1 could weakly bind right-handed RNA and promoted its conformational transition into left-handed Z-form under near-physiological conditions in vitro ^{33, 34}. Indeed, the Zα domain of ZBP1 could also bind right-handed B-DNA and facilitate its transition into left-handed Z-DNA^{35, 36}. Thus, although we could not detect the presence of Z-RNA in the cells with DNA damage, ZBP1 may bind right-handed dsRNA and facilitate its conformational transition into left-handed Z-form through its Zα domain. Or there may be other additional molecules that contribute to dsRNA recognition by ZBP1 in DNA damage. It would be worthwhile to investigate these possibilities in future study.

ZBP1 has been emerged as an important innate immune sensor of double-stranded nucleic acids in the Z-conformation¹². Our data indicate that ERVs are transcriptionally upregulated by DNA damage and act as ligands for ZBP1 to trigger PANoptosis. Under normal conditions, expression of ERVs is switched off epigenetically. Multiple processes such as epigenetic aberrations, inflammation as well as infections can lead to the activation of ERVs³⁰. It has been shown that 5-FU could activate ERVs to elicit inflammatory responses in hematopoietic stem cells³⁷. However, to our knowledge, it has not yet been comprehensively demonstrated that ERVs can be transcriptionally upregulated by DNA damage. Our data indicate that DNA damage agent ETO and CDDP also activate ERVs. Therefore, one outstanding question is how ERVs are activated by DNA damage. It has been shown that 5-FU inhibited the expression of SETDB1³⁷, a known epigenetic regulator in ERV silencing³⁸, which may lead to the activation of ERVs. Whether DNA damage agents share a similar mechanism to activate ERVs remains to be determined. And it will also be interesting to investigate whether ADAR1 RNA editing enzyme is able to prevent ZBP1 activation and PANoptosis by disrupting dsRNA formation in DNA damage.

Our data reveal that ZBP1-mediated PANoptosis contributes to chemotherapy-induced toxicity and inflammation in mice. DNA damage agents such ETO, CDDP and 5-FU are commonly used for cancer treatment. However, optimal use of these chemotherapy agents is restricted by dose-limiting side effects, which may result from the damage of normal cells. Consistent with a previous study³¹, we found ZBP1 expression was low or absent in tumor tissue, which suggest ZBP1-drived PANoptosis is most likely activated by chemotherapy in noncancerous tissues. Furthermore, we observed that dsRNA was induced by chemotherapy and can be sensed by ZBP1 in normal colonic tissues in CRC patients. Although we still need to gain more clinic evidence to comprehensively investigate the role of PANoptosis in chemotherapy-induced side-effects, it would be also interesting to develop therapeutic approaches to mitigate side-effects of chemotherapy by targeting ZBP1 in future studies.

In summary, our data reveal that ERVs are activated by DNA damage and can act as ligands for ZBP1 to trigger PANoptosis. This improved our understanding of the mechanistic basis in DNA damage-induced cell death. Furthermore, as ZBP1 expression is largely restricted to normal tissues in cancer patients, our findings suggest that ZBP1-drived PANoptosis contributes to chemotherapy-induced toxicity. These results therefore indicates that the inhibition of ZBP1-drived PANoptosis could be a potential therapeutic approach to alleviate chemotherapy-induced side effects and improve the quality of life in cancer patients.

Chemicals

Etoposide (MCE, China, Cat#HY-13629), MNNG (MCE, China, Cat#HY-128612), CDDP (MCE, China, Cat#HY-17394), 5-FU (MCE, China, Cat#HY-90006), CBL0137 (MCE, China, Cat#HY-18935A).

Antibodies

WB: The following antibodies were from commercial sources: anti-Cleaved Caspase -3 (CST, USA, Cat#9664, 1:1000); anti-Caspase-3 (ABclonal, China, Cat#A2156, 1:1000); anti-phospho-MLKL (Abcam, USA, Cat#ab196436, 1:1000); anti-MLKL (ABclonal, China, Cat#A5579, 1:1000); anti-FLAG-Tag (ABclonal, China, Cat#AE004, 1:1000); anti-ZBP1 (Adipogen, Switzerland, Cat#AG-20B-0010-C100, 1:1000); anti-GSDME-N-terminal (Abcam, USA, Cat#ab215191, 1:1000); anti-phospho-RIPK1 (CST, USA, Cat#31122, 1:1000); anti-RIPK1 (BD, USA, Cat# 610458, 1:1000); anti-phospho-RIPK3 (CST, USA, Cat#91702, 1:1000); anti-RIPK3 (CST, USA, Cat#95702, 1:1000); anti-Caspase-6 (CST, USA, Cat#9762, 1:1000); anti-Cleaved Caspase-6 (CST, USA, Cat#9761T, 1:1000); anti-γ-H2AX (CST, USA, Cat#9718, 1:1000); anti-H2AX (ABclonal, China, Cat#A11463, 1:1000); anti-phospho-p53(CST, USA, Cat#9284, 1:1000) and GAPDH (HUABIO, China, Cat# ET1601-4, 1:100000).

IF/IHC: The following antibodies were from commercial sources: anti-dsRNA J2 (SCICONS, Hungary, Cat#10010200, 1:200); anti-Z-DNA/Z-RNA [Z22] (Absolute antibody, UK, Cat#T2028A11, 1:200); anti-DDDDK-Tag (ABclonal, China, Cat#AE004, 1:200); anti-ZBP1(Proteintech, China, Cat#No. 13285-1-AP, 1:100)

Plasmids and Lentiviral particles

The mammalian cell expression plasmids of Flag-tagged mouse ZBP1 and Flag-tagged mouse ZBP1-mutZα1α2 (N46A/Y50A/N122A/Y126A) were purchased from Synbio Technologies (Suzhou, China). For generating the knockout cell lines by the CRISPR-Cas9 approach, gRNA sequences were firstly cloned into pLenti-CRISPRv2 vector. The gRNA targeting sequences are as follows:

sgRIPK3 #1 sense: 5′ -CTCTGGGTCCAAGTACGCTA-3′

sgRIPK3 #1 antisense: 5′ -TAGCGTACTTGGACCCAGAG-3′

sgRIPK3 #2 sense: 5′ -GCTCTGGGTCCAAGTACGCT-3′

sgRIPK3 #2 antisense: AGCGTACTTGGACCCAGAGC-3′

sgCasp-6 #1 sense: 5′ -CAGGTTGTCTCTGTCTGCGT-3′

sgCasp-6 #1 antisense: 5′ - ACGCAGACAGAGACAACCTG -3′

sgCasp-6 #2 sense: 5′ -CGTTGGTGCCCCGCCTCTCT-3′

sgCasp-6 #2 antisense: 5′ - AGAGAGGCGGGGCACCAACG-3′

For generating lentivirus, HEK293T cells were co-transfected with pCMV-VSV-G and

pCMV-dr8.2-dvpr and either empty or sgRNA targeted plasmids. After 24 hours, supernatant was collected and this lentiviral preparation was used to infect cells. After 24 hours of infection, cells were selected with puromycin for a further 48 hours.

Cell culture and transfection

All the cell lines used in this study were obtained from the American Type Culture Collection (ATCC, Manassasa, VA). Wild-type (WT), ZBP1-deficient and Zα1α2-mutated mouse dermal fibroblast (MDF) cells were isolated from postnatal day 2 of C57BL/6 mouse skin. All cells were maintained in DMEM culture media supplemented with 10% FBS (v/v), 2 mM of L‐glutamine and 100 U/ml of penicillin/streptomycin. Cells were grown at 37℃ in a humidified atmosphere with 5% CO₂ and were harvested in all experiments from exponentially growing cultures.

The plasmids were transfected with Lipo293F™ transfection reagent (Beyotime, China) according to the manufacturer's protocol. After 24 hours, the cell lysates were analyzed by immunoblotting.

Cell treatment and cell death assays

Cells were treated with ETO (50 μM), MNNG (0.5 mM), CDDP (50 μM) or 5-FU (50 μg/mL) for indicated time to induce cell death. If there are any differences, a detailed description will be given in the figure legend. Cell death was examined by propidium iodide (PI) staining. Briefly, cells were trypsinized, collected by centrifugation, washed once with PBS buffer and then resuspended in PBS containing 5 μg/mL of PI. The stained cells were subjected to flow cytometry using a BD FACS Aria II (BD Biosciences, USA). The proportions of PI‐positive cells were quantified with FlowJo™ Software (BD Biosciences, USA).

Immunoblotting

Cell lysates were prepared for immunoblotting analysis using RIPA buffer supplemented with protease/phosphatase inhibitors and PMSF (MCE, Shanghai, China). The RIPA buffer consisted of 10 mM Tris-HCl [pH 8.0], 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl, 0.1% SDS, 1% Triton X-100, 50 mM NaF, 40 mM glycerophosphate, and 0.1 mM sodium vanadate. Cell lysates were separated by SDS‐PAGE and analyzed by immunoblotting. The proteins were visualized by enhanced chemiluminescence according to the manufacturer's instructions (Tanon, China).

Immunoprecipitation

Cells were harvested and lysed in immunoprecipitation lysis buffer (Beyotime, China, Cat#P0013) with protease/phosphatase inhibitors and PMSF. After centrifugation, the cell lysate supernatants were immunoprecipitated with anti-FLAG magnetic beads (15 μl) (MCE, China, Cat#HY-K0207) at 4℃ overnight with rotation. Following extensive washing with lysis buffer, the proteins bound to magnetic beads were eluted by boiling in 1×SDS sample buffer (30 μl). Finally, the precipitated proteins were subjected to immunoblotting using the specified antibodies. Image J (NIH, USA) software was used for greyscale analysis of western blotting. For DNase I or RNase A treatment, cell lysates were incubated with 25 U/mL DNase I (NEB, USA, Cat#M0303S) or 1 mg/mL RNase A (MCE, China, Cat# HY-129046A) for 1 hour at 4 °C. Subsequent immunoprecipitation and western blotting were then performed.

Immunofluorescence microscopy

For tissue staining, paraffin sections of tissues were baked at 65 °C for 1 hour, and then deparaffinized. Antigen retrieval was performed by boiling the sections in Citrate Antigen Retrieval Solution (Beyotime, China, Cat#P0081) for 20 minutes. For cell staining, cells were plated on 24-well glass slides (JingAnBiological, China, Cat#J24001), and cultured for 24 hrs before use in experiments. Following ETO (50 μM) or CBL0137 (5 μM) treatmente, cells were fixed in 4% paraformaldehyde for 15 min and permeabilized with 0.1% Triton-X100 for 5 min. To detect dsRNA and Z-DNA in cells, cells were subjected to proteinase K treatment (0.008 U/mL) for 20-40 min at 37°C post-fixation. If required, the cells will then be treated with RNase A (1mg/mL), RNase III (1 mg/mL) or DNase I (25 U/ml) for 1 hour at 37°C. Subsequently, cells or tissue sections were blocked with 5% BSA-Ⅴ (Solarbio, China, Cat#A8020) in PBS, and then incubated overnight with primary antibodies at 4°C. After washing with PBS for three time, slides were incubated with fluorophore-conjugated secondary antibodies for 1 hour at room temperature and stained with DAPI for 5 min. Following an additional three washes in PBS, slides were mounted in ProLong Gold antifade reagent (Thermo Fisher Scientific). The staining images were acquired using the confocal laser scanning microscope (Nikon, Japan).

Proximity Ligation Assay

The Proximity Ligation Assay (PLA) was performed using the Duolink® In Situ Red Starter Kit (Sigma, USA, Cat#DUO92101) according to the manufacturer's instructions. Briefly, cells were cultured on confocal culture dishes and then fixed in 4% paraformaldehyde (PFA) for 15 minutes, washed three times, permeabilized with 0.1% Triton X-100 for 5 minutes, and then blocked with Duolink blocking solution for 1 hour at 37°C. Cells then incubate overnight at 4°C with primary antibodies diluted in Duolink antibody diluent. Subsequently, secondary antibodies were applied, followed by ligation and signal amplification steps according to the manufacturer's instructions. The PLA dots were visualized using a Nikon confocal microscope.

Real-time (RT) PCR

To measure relative gene expression by RT-PCR, total cellular RNA was isolated using TRIzol reagent (ThermoFisher, USA). The extracted RNA was reversely transcribed into cDNA using the Strand cDNA Synthesis kit (Transgen, China, Cat#AH321-01) according to the manufacturer’s instructions. Levels of mRNA encoding for RLTR45-int, RLTR1B-int or IL-6 were measured by real-time PCR using PerfectStart® Green qPCR SuperMix (Universal Passive Reference Dye) (Transgen, China, Cat#AQ602-01) in the QuantStudio 7 Flex Real-Time PCR system (ThermoFisher, USA). The ratio for the mRNA was normalized to GAPDH. All reagents, buffers and containers used for RNA work were RNase-free grade, to eliminate RNase contaminants in experiments described in this section and other relevant sections. The primer sequence of RLTR45-int and RLTR1B-int have been reported previously¹⁹. The primer sequence are as follows:

RLTR45-int sense: 5′ -CCCCGAGAAGAGGGTCAAAA-3′

RLTR45-int antisense: 5′ -AGCGGGAACTTGGTGGTATC-3′

RLTR1B-int sense: 5′ - AATCCACTGTCTCCTGCGTG-3′

RLTR1B-int antisense: 5′ - CCCCACTCAACTCCCGATTC-3′

mIL-6 sense: 5′ -CAATGGCAATTCTGATTGTATG-3′

mIL-6 antisense: 5′ -AGGACTCTGGCTTTGTCTTTC-3′

mGAPDH sense: 5′ -GTTGTCTCCTGCGACTTCA-3′

mGAPDH antisense: 5′ - GGTGGTCCAGGGTTTCTTA-3′

RNA immunoprecipitation (RIP)

RIP assays were performed following the instructions of the BeyoRIP™ RIP Assay Kit (Beyotime, China, Cat# P1801S). The cell lysates were mixed with magnetic beads bound to the corresponding antibodies, and incubated at 4 °C overnight. RNA was purified with protease K solution and extracted by using RNA isolated Total RNA Extraction Reagent. Subsequent RT-PCR was performed using the primers for RLTR45-int and RLTR1B-int.

Clinical samples

Tumor and matched noncancerous colonic tissues were obtained from the first surgical resection at Xinqiao Hospital. All study participants provided written informed consent and volunteered to participate in the experiment. All samples were collected with the approval of the local ethics Committee and the institutional review board of the hospital. Detailed clinic information of the CRC patients is shown in Supplementary Table II.

Animal experiment

All animal care and experimental procedures complied with the National Institutes of Health guidelines and were approved by the animal care and use committee of Tongji University. Animal studies are reported in compliance with the ARRIVE guidelines³⁹. C57BL/6 mice were purchase from SLAC ANIMAL (Shanghai, China) unless mentioned otherwise. ZBP1^-/- and ZBP1^mutZα1α2 (N46A/Y50A/N122A/Y126A) mice with C57BL/6 background were generated by Bangyao Biologicals (Shanghai, China) with CRISPR-Cas9 gene editing technology. Mice were bred and housed under SPF conditions in individually ventilated cages with a 12 h light/dark cycle and stable temperature (25 °C). All mice used in the experiments were between the age of 8–10 weeks. We used Quick Genotyping Assay Kit for Mouse Tail (Beyotime, China, Cat#D7283S) to identify the genotype of mice. The genotyping primer sequence are as follows:

ZBP1 sense: 5′ - CCTAAGTGTCCCAGGCCATA-3′

ZBP1 antisense: 5′ -ATTTGCCTGGTCTCCAGATG-3′

To establish mouse models of chemotherapy-induced toxicity, ETO was injected intravenously at a dose of 20 mg/kg; CDDP was injected intraperitoneally at a dose of 25 mg/kg. Saline injection was used in control group. Five days after injection, the mice were sacrificed using CO₂ inhalation. The small intestines and lungs were collected for haematoxylin and eosin (H&E) and immunohistochemistry staining.

H&E staining and pathological analysis

The small intestine and lung tissues were fixed in formalin overnight and subsequently embedded in paraffin blocks for sectioning. The tissue sections were then subjected to H&E staining, which facilitated the visualization of the nucleus and cytoplasm, respectively. The pathological images of livers were captured using an upright microscope.

The average number of surviving crypts, villi and neutrophils within the alveolar space were counted in 20 randomly selected fields from each mouse (n=6 per group). Acute lung injury scores were calculated according to previously described method⁴⁰. Briefly, a 3-point scale was used to score the severity of the lung injury (0=none, 1=medium, and 2=severe); the number of neutrophils in the alveolar and interstitial space (0=none, 1=1-5, and 2=>5), the formation of hyaline membranes (0=none, 1=1, and 2=>1), the proteinaceous debris filling the airspaces(0=none, 1=1, and 2=>1) and the extent of alveolar septal thickening (0=<2x, 1=2-4x, and 2=>4x) were graded. Each grade was then multiplied by a factor and then summed to obtain the final score for each mouse.

For spleen injury assessment, the spleens were firstly weighed and then homogenized. The remaining lymphocytes were counted by hemocytometer after lysing the red blood cells using an ACK (ammonium-chloride-potassium) buffer. The mice's weights were recorded daily for a period of five days.

Immunohistochemistry

For immunohistochemistry analysis, intestinal tissues from mouse or patient were fixed in formalin for a minimum of 24 hours, followed by paraffin embedding and sectioning. The sections were then deparaffinized in xylene, rehydrated, and washed with PBS. Antigen retrieval was performed by boiling the sections in Citrate Antigen Retrieval Solution (Beyotime, China, Cat#P0081) for 20 minutes. Subsequently, the sections were blocked with 10% normal goat serum in PBS at room temperature for 1 hour and stained with dsRNA J2 antibodies (SCICONS, Hungary, Cat#10010200, 1:200) overnight. Signals were then developed using VECTASTIN ABC Elite kit (Vector Laboratories, USA) and DAB Substrate Kit (Vector Laboratories, USA).

Four human tissues, the staining sections were then reviewed and scored as follows: Cell with <25% staining was rated as negative staining (-, 1); cell with 10-49% staining was scored as (+, 2); cell with 50-74% staining was scored as (++, 3); cell with 75-100% staining was scored as (+++, 4). According to the score of staining intensity, 0 point for no positive staining (negative), 1 point for light yellow particles (weak positive), 2 points for brown particles (strong positive), and 3 points for brown particles (strong positive). The final score was defined as staining number score multiplied by staining color score⁴¹.

RNA-seq and TE RNA-seq analysis

Total RNA was isolated using RNeasy kit (Qiagen). Purified total RNA was quantified by Qubit (Invitrogen, USA) and analyzed by an Agilent Bioanalyzer to assess RNA integrity. rRNA-depleted RNA was generated using a NEBNext® rRNA Depletion Kit (New England Biolabs, Cat#E6310S). The directional RNA library was constructed with a NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina® (New England Biolabs, Cat#E7760L) according to the manufacturer’s instructions. Library sequencing was performed by Novogene (Tianjin, China) using an Illumina HiSeq 4000 platform.

RNA-seq data processing was performed as described previously⁴². For TE analysis, the reads were mapped to the mouse genome (mm10) using the STAR aligner (v2.5.4b)⁴³. For bi-directional ERV transcripts analysis, the strand specific RNA-seq fastq data were aligned to mm10 genome using STAR, and then the forward and revers strand were separated by samtools(version 1.17)⁴⁴ with the -f flag parameter. The counts for each gene or TE family were counted using scTE9⁴². DESeq2 (v1.20.0) was used for data normalization and differential expression analysis⁴⁵. Differentially expressed TEs were defined by a Benjamini-Hochberg-corrected P value < 0.05 and an absolute fold change > 2 (for genes).

Statistical analysis

The student’s t-test and one-way analysis of variance (ANOVA) were used for comparison among all different groups represented with the mean values ± standard errors. Log-rank (Mantel-Cox) test was performed for survival curve analysis using GraphPad Prism 8 (GraphPad Software, USA). All experiments were repeated at least three times with similar results. p < 0.05 was considered statistically significant.

PCD, Programmed cell death; ZBP1, Z-DNA binding protein 1; ERVs, endogenous retroviruses; DAI, DNA-dependent activator of interferon regulatory factors; RIP, receptor interacting protein; RIPK3, Receptor-interacting protein kinase 3; AIM2, absent in melanoma-2; RIPK1, receptor interacting protein kinase 1; NLRP12, NOD-like receptor family, pyrin domain–containing 12; IAV, influenza A virus; Casp-6, caspase-6; AGS, Aicardi–Goutières syndrome; CDDP, cisplatin; ETO, etoposide; 5-FU, 5-fluorouracil; WT, wild-type; ZBP1^-/-, ZBP1-null; MDFs, mouse dermal fibroblasts; MNNG, N-methyl-N'-nitro-N-nitrosoguanidine; PI, propidium iodide; Casp-3, caspase-3; GSDMD, Gasdermin-D; GSDME, Gasdermin-E; RHIM, receptor-interacting protein homotypic interaction motif; PLA, proximity ligation amplification assay; LTR, long terminal repeat; IHC, immunohistochemistry; CRC, colorectal cancer

Acknowledgements

This work was supported by grants from National Natural Science Foundation of China (No.32170748, No. 32200453 and No.82204481); the Key Research and Development Program of Ningxia (No.2022BFH02012); Shanghai Committee of Science and Technology (No. 21490714300 and No.1841072060) and Fundamental Research Funds for the Central Universities.

Author contributions

Z.C., F.W. and D.M. conceived and designed experiments. F.W., K.L, W.W., H.J., W.R., Y.Z., J.C., Q.S, J.H. and Y.H. performed experiments. Z.C., F.W. and K.L. interpreted the data and wrote the original manuscript. Y.M, Y.L., J.Y. and S.J. provided resources. Y.M, Y.L., J.Y. and S.J. provided helpful discussions and refined the paper.

Competing interests

The authors declare no competing interests.

Goldstein M, Kastan MB. The DNA damage response: implications for tumor responses to radiation and chemotherapy. Annu Rev Med 2015, 66: 129-143.
Cheung-Ong K, Giaever G, Nislow C. DNA-damaging agents in cancer chemotherapy: serendipity and chemical biology. Chem Biol 2013, 20(5): 648-659.
van den Boogaard WMC, Komninos DSJ, Vermeij WP. Chemotherapy Side-Effects: Not All DNA Damage Is Equal. Cancers (Basel) 2022, 14(3).
Wang L, Zhu Y, Zhang L, Guo L, Wang X, Pan Z, et al. Mechanisms of PANoptosis and relevant small-molecule compounds for fighting diseases. Cell Death Dis 2023, 14(12): 851.
Wang Y, Kanneganti TD. From pyroptosis, apoptosis and necroptosis to PANoptosis: A mechanistic compendium of programmed cell death pathways. Comput Struct Biotechnol J 2021, 19: 4641-4657.
Pandeya A, Kanneganti TD. Therapeutic potential of PANoptosis: innate sensors, inflammasomes, and RIPKs in PANoptosomes. Trends Mol Med 2024, 30(1): 74-88.
Zheng M, Karki R, Vogel P, Kanneganti TD. Caspase-6 Is a Key Regulator of Innate Immunity, Inflammasome Activation, and Host Defense. Cell 2020, 181(3): 674-687 e613.
Banoth B, Tuladhar S, Karki R, Sharma BR, Briard B, Kesavardhana S, et al. ZBP1 promotes fungi-induced inflammasome activation and pyroptosis, apoptosis, and necroptosis (PANoptosis). J Biol Chem 2020, 295(52): 18276-18283.
Karki R, Lee S, Mall R, Pandian N, Wang Y, Sharma BR, et al. ZBP1-dependent inflammatory cell death, PANoptosis, and cytokine storm disrupt IFN therapeutic efficacy during coronavirus infection. Sci Immunol 2022, 7(74): eabo6294.
Muendlein HI, Connolly WM, Magri Z, Jetton D, Smirnova I, Degterev A, et al. ZBP1 promotes inflammatory responses downstream of TLR3/TLR4 via timely delivery of RIPK1 to TRIF. Proc Natl Acad Sci U S A 2022, 119(24): e2113872119.
Lee S, Karki R, Wang Y, Nguyen LN, Kalathur RC, Kanneganti TD. AIM2 forms a complex with pyrin and ZBP1 to drive PANoptosis and host defence. Nature 2021, 597(7876): 415-419.
Kuriakose T, Kanneganti TD. ZBP1: Innate Sensor Regulating Cell Death and Inflammation. Trends Immunol 2018, 39(2): 123-134.
Maelfait J, Rehwinkel J. The Z-nucleic acid sensor ZBP1 in health and disease. J Exp Med 2023, 220(8).
Zhang T, Yin C, Boyd DF, Quarato G, Ingram JP, Shubina M, et al. Influenza Virus Z-RNAs Induce ZBP1-Mediated Necroptosis. Cell 2020, 180(6): 1115-1129 e1113.
Lai K, Wang J, Lin S, Chen Z, Lin G, Ye K, et al. Sensing of mitochondrial DNA by ZBP1 promotes RIPK3-mediated necroptosis and ferroptosis in response to diquat poisoning. Cell Death Differ 2024, 31(5): 635-650.
Lei Y, VanPortfliet JJ, Chen YF, Bryant JD, Li Y, Fails D, et al. Cooperative sensing of mitochondrial DNA by ZBP1 and cGAS promotes cardiotoxicity. Cell 2023, 186(14): 3013-3032 e3022.
Liang K, Barnett KC, Hsu M, Chou WC, Bais SS, Riebe K, et al. Initiator cell death event induced by SARS-CoV-2 in the human airway epithelium. Sci Immunol 2024, 9(97): eadn0178.
Jiao H, Wachsmuth L, Kumari S, Schwarzer R, Lin J, Eren RO, et al. Z-nucleic-acid sensing triggers ZBP1-dependent necroptosis and inflammation. Nature 2020, 580(7803): 391-395.
Wang R, Li H, Wu J, Cai ZY, Li B, Ni H, et al. Gut stem cell necroptosis by genome instability triggers bowel inflammation. Nature 2020, 580(7803): 386-390.
Devos M, Tanghe G, Gilbert B, Dierick E, Verheirstraeten M, Nemegeer J, et al. Sensing of endogenous nucleic acids by ZBP1 induces keratinocyte necroptosis and skin inflammation. J Exp Med 2020, 217(7).
Huang R, Zhou PK. DNA damage repair: historical perspectives, mechanistic pathways and clinical translation for targeted cancer therapy. Signal Transduct Target Ther 2021, 6(1): 254.
Sun L, Wang H, Wang Z, He S, Chen S, Liao D, et al. Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell 2012, 148(1-2): 213-227.
Zhao J, Jitkaew S, Cai Z, Choksi S, Li Q, Luo J, et al. Mixed lineage kinase domain-like is a key receptor interacting protein 3 downstream component of TNF-induced necrosis. Proc Natl Acad Sci U S A 2012, 109(14): 5322-5327.
Baik JY, Liu Z, Jiao D, Kwon HJ, Yan J, Kadigamuwa C, et al. ZBP1 not RIPK1 mediates tumor necroptosis in breast cancer. Nat Commun 2021, 12(1): 2666.
Kadigamuwa C, Choksi S, Xu Q, Cataisson C, Greenbaum SS, Yuspa SH, et al. Role of Retinoic Acid Receptor-gamma in DNA Damage-Induced Necroptosis. iScience 2019, 17: 74-86.
Biton S, Ashkenazi A. NEMO and RIP1 control cell fate in response to extensive DNA damage via TNF-alpha feedforward signaling. Cell 2011, 145(1): 92-103.
Hur GM, Lewis J, Yang Q, Lin Y, Nakano H, Nedospasov S, et al. The death domain kinase RIP has an essential role in DNA damage-induced NF-kappa B activation. Genes Dev 2003, 17(7): 873-882.
Maelfait J, Liverpool L, Bridgeman A, Ragan KB, Upton JW, Rehwinkel J. Sensing of viral and endogenous RNA by ZBP1/DAI induces necroptosis. EMBO J 2017, 36(17): 2529-2543.
Zhang T, Yin C, Fedorov A, Qiao L, Bao H, Beknazarov N, et al. ADAR1 masks the cancer immunotherapeutic promise of ZBP1-driven necroptosis. Nature 2022, 606(7914): 594-602.
Liang Y, Qu X, Shah NM, Wang T. Towards targeting transposable elements for cancer therapy. Nat Rev Cancer 2024, 24(2): 123-140.
Yang T, Wang G, Zhang M, Hu X, Li Q, Yun F, et al. Triggering endogenous Z-RNA sensing for anti-tumor therapy through ZBP1-dependent necroptosis. Cell Rep 2023, 42(11): 113377.
Herbert A. Z-DNA and Z-RNA in human disease. Commun Biol 2019, 2: 7.
Brown BA, 2nd, Lowenhaupt K, Wilbert CM, Hanlon EB, Rich A. The zalpha domain of the editing enzyme dsRNA adenosine deaminase binds left-handed Z-RNA as well as Z-DNA. Proc Natl Acad Sci U S A 2000, 97(25): 13532-13536.
Bae S, Kim D, Kim KK, Kim YG, Hohng S. Intrinsic Z-DNA is stabilized by the conformational selection mechanism of Z-DNA-binding proteins. J Am Chem Soc 2011, 133(4): 668-671.
Kim HE, Ahn HC, Lee YM, Lee EH, Seo YJ, Kim YG, et al. The Zbeta domain of human DAI binds to Z-DNA via a novel B-Z transition pathway. FEBS Lett 2011, 585(5): 772-778.
Kim K, Khayrutdinov BI, Lee CK, Cheong HK, Kang SW, Park H, et al. Solution structure of the Zbeta domain of human DNA-dependent activator of IFN-regulatory factors and its binding modes to B- and Z-DNAs. Proc Natl Acad Sci U S A 2011, 108(17): 6921-6926.
Clapes T, Polyzou A, Prater P, Sagar, Morales-Hernandez A, Ferrarini MG, et al. Chemotherapy-induced transposable elements activate MDA5 to enhance haematopoietic regeneration. Nat Cell Biol 2021, 23(7): 704-717.
Johnson E, Salari K, Yang S. SETDB1: A perspective into immune cell function and cancer immunotherapy. Immunology 2023, 169(1): 3-12.
Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, et al. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. BMJ Open Sci 2020, 4(1): e100115.
Wang Y, Gao W, Shi X, Ding J, Liu W, He H, et al. Chemotherapy drugs induce pyroptosis through caspase-3 cleavage of a gasdermin. Nature 2017, 547(7661): 99-103.
Guo Z, Zhang X, Zhu H, Zhong N, Luo X, Zhang Y, et al. TELO2 induced progression of colorectal cancer by binding with RICTOR through mTORC2. Oncol Rep 2021, 45(2): 523-534.
Griffin GK, Wu J, Iracheta-Vellve A, Patti JC, Hsu J, Davis T, et al. Epigenetic silencing by SETDB1 suppresses tumour intrinsic immunogenicity. Nature 2021, 595(7866): 309-314.
Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29(1): 15-21.
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25(16): 2078-2079.
Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 2014, 15(12): 550.

There is no duality of interest

Download PDF

Version 1

posted

You are reading this latest preprint version

Sensing of endogenous retroviruses-derived RNA by ZBP1 triggers PANoptosis in DNA damage and contributes to toxic side effects of chemotherapy

Status:

Version 1

Abstract

Figures

Introduction

Results

ZBP1 is involved in DNA damage-induced cell death

DNA damage induces PANoptosis by promoting ZBP1-PANoptosome assembly

The Zα domain of ZBP1 is required for DNA damage-induced PANoptosome assembly and PANoptosis

ZBP1 binds to dsRNA to promote PANoptosome assembly in DNA damage

ERVs are transcriptionally upregulated by DNA damage and act as ligands for ZBP1

ZBP1-mediated PANoptosis contributes to chemotherapy-induced toxicity in mice

Discussion

Materials and Methods

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1