Immunogenicity of intraperitoneal and intranasal liposome adjuvanted VLP vaccines against SARS-CoV-2 infection

doi:10.21203/rs.3.rs-4865974/v1

Download PDF

Article

Immunogenicity of intraperitoneal and intranasal liposome adjuvanted VLP vaccines against SARS-CoV-2 infection

https://doi.org/10.21203/rs.3.rs-4865974/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Humans get SARS-CoV-2 infection through inhalation; thus, vaccine that induces protective immunity at the virus entry site is appropriate for early control of the infection. In this study, two anionic liposome-adjuvanted VLPs vaccines made of full-length S, M and E proteins SARS-CoV-2 were formulated. S1-S2 junction of S protein displayed on VLPs of one vaccine (L-SME-VLPs) contained furin cleavage site, while VLPs of another (L-S¢ME-VLPs) did not. Both vaccines were similarly/equally immunogenic in mice. Mice immunized parenterally with the vaccines had principally serum IgG3 neutralizing antibodies, while mice immunized intranasally produced predominantly specific Th1-antibody isotypes (IgG2a and/or IgG2b) in bronchoalveolar lavage samples. IgG3 isotype is known to be highly efficient in complement activation, opsonophagocytic activities, and antibody-dependent cell-mediated cytotoxicity, which causes virus clearance upon infection. Nevertheless, complement fixation and immune-complex formation may exacerbate tissue inflammation, cytokine storm, and lung immunopathology in the SARS-CoV-2-infecting host, which exacerbate the COVID-19 morbidity. Th1 antibodies are less efficient in complement fixation and phagocytic activity but exhibit stronger anti-viral effects than other antibody isotypes; thus, confer protection with minimal immunopathology upon new infection. The intranasal liposome-adjuvanted VLP vaccines should be tested further towards the clinical use as effective, safe, and better compliant vaccines against SARS-CoV-2.

Biological sciences/Immunology/Infectious diseases/Viral infection

Biological sciences/Immunology/Vaccines/Protein vaccines

Baculovirus-insect cell system

COVID-19

Liposome

SARS-CoV-2

Virus-like particles

VLP vaccines

Antibody isotypes

Vaccines against SARS-CoV-2 of different platforms have been licensed/authorized for emergency use to cope with the recent COVID-19 pandemic. They are administered parenterally, mainly intramuscularly¹. The pros and cons of these vaccines have been reviewed^2,3. Although the benefits of the vaccines in inducing immunity against the COVID-19 (particularly in reducing morbidity and mortality of the patients and halting community/transcend boundary/global spread of the virus) outweighed any potential vaccine-related risk, however, the health hazard ranging from mild to severe reactions including anaphylaxis, Guillain-Barre syndrome (GBS), myocarditis and pericarditis, thrombosis with thrombocytopenia syndrome (TTS), multisystem inflammatory syndrome MIS), and autoimmune disorders or even death occurred among a fraction of the vaccinees; causing some extent of public worrisome^4-6. The parenteral vaccines induce systemic immunity that could mitigate symptom severity and mortality of the infected subjects but cannot prevent new infection. Besides, immunogenicity of these vaccines is limited in the immunosuppressive populations, like young children, immunosenescent elderly, immunocompromised subjects, and patients with immunosuppressive medication^2,7,8.

SARS-CoV-2 gains body access mainly via upper respiratory tract. The virus can then reach the lower respiratory track and lungs causing severe inflammation including acute respiratory distress syndrome (ARDS)⁹. Intranasal vaccine that engenders protective immune response at the virus entry site is appropriate for early control of the infection and to prevent the virus transmission^10,11. The mucosal immune system differs in many respects from the systemic counterpart including structure, cellular organization, cellular trafficking, inductive and effector sites, and functional activities of the immunological factors. The mucosal immune response to the administered antigen can occur independently from the systemic immune response⁹. Moreover, immune response elicited at one mucosal inductive site (e.g., nasal associated lymphoid tissue of mice or tonsils in the Waldeyer’s ring of human) can be effective at other remote mucosal effector sites, e.g., lungs, intestinal mucosa, genital mucosa, mammary glands¹². Parenteral vaccination induces systemic immune responses, but rarely any mucosal immunity^10,13.

An oral/intranasal vaccine against SARS-CoV-2 has been generated. An adenovirus type 5 SARS-CoV-2 vaccines delivered orally/intranasally to hamsters could reduce disease severity and virus transmission¹⁴. However, the adenovirus-vectored vaccine may induce strong immune response to the vector itself rendering poor immunogenicity of the vaccine especially in individuals with high background immunity to the vectored virus. The vaccine cannot be used repeatedly¹⁵. Besides, the antigen-coding gene delivered by the adenovirus may be expressed only transiently in transfected cells¹⁵. In this study, another version of intranasal vaccines against SARS-CoV-2 were produced and tested for immunogenicity in comparison with the same vaccines administered parenterally (intraperitoneally) to mice. The virus-like particles (VLPs) that consisted of full-length matrix (M), envelope (E) and spike (S) proteins of SARS-CoV-2 were generated using the binary recombinant baculovirus-insect cell system. Two types of the VLPs were produced as the vaccine immunogens, i.e., VLPs which the displayed S protein contains and devoid of the furin protease cleavage site at the S1-S2 junction, designated SME-VLPs and S¢ME-VLPs, respectively. Anionic liposome (L) was used as adjuvant and delivery vehicle of the vaccines containing SME-VLPs and S¢ME-VLPs (L-SME-VLP and L-S¢ME-VLP vaccines). Innocuity, immunogenicity, and antibody isotypes in mice immunized intraperitoneally or intranasally with the two vaccines were investigated and compared.

Generation of recombinant bacmids and baculoviruses for use in VLPs production

Diagrams of the commercially synthesized S-pFastBac^TM1 and ME-pFastBac^TMDual vectors are shown in Fig. 1A and 1B, respectively. The synthetic S-pFastBac^TM1 and ME-pFastBac^TMDual plasmids were used to transform the MAX Efficiency® DH10Bac™ E. coli competent cells to generate S-bacmids and ME-bacmids, respectively. PCR amplicons of the S gene (s) in the S-bacmids of the E. coli clones that were successfully transformed with S-pFastBac^TM1 vector are shown in Fig. 1C; likewise, amplicons of the M-E genes (m-e) in the ME-pFastBac^TMDual vector-transformed E. coli clones are shown in Fig. 1D. The S-pFastBac^TM1 vector-transformed DH10Bac E. coli clone 1 and the ME-pFastBac™ Dual vector-transformed DH10Bac E. coli clone 2 were grown in large scale and the respective bacmids were extracted for use in P1 baculovirus production.

The Sf21 cells were co-transfected with mixture (equal amount) of the S-bacmids and ME-bacmids using Expifectamine or Lipofectamine transfection reagent at the total bacmid amounts 1, 2 and 3 µg. It was found that the cells transfected with 3 µg of the bacmid mixture using Lipofectamine gave the most recombinant VLP proteins (lane 6, Fig. 1E). Western blot analysis of the culture supernatants containing recombinant P1 baculovirus of the Sf21 cells co-transfected with different ratios of the S-bacmids and ME-bacmids (total 3 µg) using Lipofectamine are shown in Fig. 1F. The mixture of S-bacmids (1.8 µg) and ME-bacmids (1.2 µg) or ratio 3:2, gave the best yield of S and M proteins. Morphology of the Sf21 cells that were co-transfected with equal amount (3 µg each) of the S-bacmids and ME-bacmids mixture for 24–96 h is shown in supplementary Fig. S3.

Western blot patterns of the S, M and E proteins from culture supernatants of the Sf21 cells separately transfected with 3 µg S-bacmids and 3 µg ME-bacmids using Lipofectamine are shown in Fig. 1G.

P1 and P2 baculovirus preparations

The concentrations of the P1 baculovirus preparations from co-transfection and separate transfection were determined by focus-forming assay (FFA) before using for P2 baculovirus preparation. The focal characteristics of the Sf21 cells transfected with the S-bacmids and ME-bacmids are shown in Fig. 2.

The concentration of the P1 baculovirus derived from Sf21 cells co-transfected with mixture of S-bacmids and ME-bacmid (3 µg each) (designated SME-P1 baculovirus) was 2.56 × 10⁷ focus-forming units (ffu)/mL. The concentrations of the P2 baculovirus prepared from Sf21 cells infected SME-P1 baculovirus (SME-P2 baculovirus) at MOI 0.1 was 4.8 × 10⁸ ffu/mL. The concentrations of P1 baculoviruses from separate transfections with 3 µg S-bacmids (designated S-P1 baculovirus) and 3 µg ME-bacmids (designated ME-P1 baculovirus) were 2.64 × 10⁶ and 9.6 × 10⁶ ffu/mL, respectively. The concentrations of P2 baculoviruses from separate infections with S-P1 baculovirus (S-P2 baculovirus) and ME-P1 baculovirus (ME-P2 baculovirus) were equal, i.e., 5 × 10⁸ ffu/mL.

Because the concentrations and ratio of S-baculovirus and ME-baculovirus in the SME-P2 baculovirus preparation were not known, this preparation was not used further for preparing VLPs. Large scale production of the VLPs was performed by infecting the Sf21 cells with optimal MOI of S-P1 baculovirus and ME-P2 baculovirus. The VLPs were designated SME-VLPs.

Production of virus-like particles (SME-VLPs)

The optimal MOI ratio of the S-P2 baculovirus and ME-P2 baculovirus for SME-VLPs production was determined. Sf21 insect cells were infected with the S-P2 baculovirus and ME-P2 baculoviruses at different MOI ratios: 1:1, 1:5, 1:10, 5:1, 5:5, 5:10, 10:1 and 10:10. As shown in Fig. 3A, the optimal MOI ratio of S-P2 baculovirus and ME-P2 baculovirus was 5:5 (lane 5) because at this MOI ratio, high amounts of S and M proteins were obtained. Although the MOI ratio 10:1 (lane 7) yielded the highest S protein amount, this MOI ratio was not chosen because low M protein yield was obtained.

Production of VLPs that their displayed S protein did not have furin cleavage site at the S1-S2 junction (S′ME-VLPs)

The S′ME-VLPs were prepared using the same protocol as for the SME-VLPs but the plasmid S′-pFastBac™ containing inserted SARS-CoV-2 S gene without furin cleavage site at the S1-S2 junction (s′) was used for generation of the S′-bacmids and the production of the S′-P1 baculovirus and S′-P2 baculovirus. The S′ME-VLPs contained intact S (without cleavage products: S1 and S2 subunits), M and E proteins as shown in Fig. 3B.

The SME-VLPs and S′ME-VLPS were purified by using Capto CORE 400 columns (Fig. 3C).

Characteristics of SME-VLPs, S′ME-VLPs, liposome-adjuvanted SME-VLP (L-SME-VLP) vaccine, liposome-adjuvanted S′ME-VLP (L-S′ME-VLP) vaccine, and liposome-entrapped PBS (L-PBS; placebo)

Morphology SME-VLP (as a representative) revealed by TEM is illustrated in Fig. 4A. The particle shows an envelope membrane with a few intact spikes. Zeta potentials and particles size of the VLPs and liposome-encapsulated VLPs are detailed in Table 1 and Fig. 4B-4F. They were all anionic micelles.

Table 1

Zeta potentials of the VLPs and liposome-encapsulated VLPs.
Particles	Zeta potential (mV)	Conductivity	Wall-size potential (mV)	Quality factor
SME-VLPs	-1.96	0.287	0	1.03
S′ME-VLPs	-5.31	0.278	0	1.20
L-SME-VLPs	-5.12	0.289	-7.14	1.43
L-S′ME-VLPs	-18.63	0.291	-20.1	1.83

Innocuity and immunogenicity of the liposome-adjuvanted VLP vaccines

Mice injected intraperitoneally (IP) or administered intranasally (IN) with the L-SME-VLP or L-S′ME-VLP vaccines did not show any sign of vaccine-related adverse effects, indicating innocuousness of the vaccines.

Levels of antibodies in serum samples and bronchoalveolar lavage samples (BALF) of mice immunized IP and IN with L-SME-VLP and L-S′ME-VLPs are shown in Table 2. Both vaccines showed no difference in their immunogenicity for inducing systemic immune response (serum antibodies) when administered IP. Both vaccines similarly/equally induced mucosal immune response when administered IN as shown by ELISA (> 1:256) and virus neutralizing (VN) titers in BALF samples of the immunized mice (Table 2). The mice intranasally immunized with L-SME-VLPs (T13-T18) and L-S′ME-VLPs (T19-T24) had negligible serum ELISA titer against S1 protein (two independent and reproducible experiments; data not shown). None of the control mice (C1-C6 and C7-C12) had detectable ELISA/VN antibodies to SARS-CoV-2 S1 protein (data not shown).

Table 2

Indirect ELISA and virus neutralizing (VN) titers in samples of immunized mice.
Experiment 1: mice were immunized IP			Experiment 2: mice were immunized IN
Mouse No.	Serum ELISA titer	Serum VN titer	Mouse No.	BALF ELISA titer	BALF VN titer
L-SME-VLPs			L-SME-VLPs
T1	> 1:12,800	1:80	T13	> 1:256	1:8
T2	> 1:12,800	1:320	T14	> 1:256	1:4
T3	> 1:12,800	1:640	T15	> 1:256	1:256
T4	> 1:12,800	1:320	T16	> 1:256	1:8
T5	> 1:12,800	1:320	T17	> 1:256	1:16
T6	> 1:12,800	1:160	T18	> 1:256	1:16
L-S′ME-VLPs			L-S′ME-VLPs
T7	> 1:12,800	1:640	T19	> 1:256	1:16
T8	> 1:12,800	1:2560	T20	> 1:256	1:8
T9	> 1:12,800	1:1280	T21	> 1:256	1:2
T10	> 1:12,800	1:1280	T22	> 1:256	1:16
T11	> 1:12,800	1:2560	T23	> 1:256	1:16
T12	> 1:12,800	1:2560	T24	> 1:256	1:2

Immunoglobulin isotypes of the antibodies in the immunized mouse samples are shown in Table 3. All antibody isotypes carried k light chains. Serum samples of 5/6 mice that received L-SME-VLP and L-S¢ME-VLP vaccines IP were predominantly IgG3 (Table 3). Some mice also had serum IgA and IgG1 antibodies. Sixty-seven percent of mice (4/6 mice) of mice that were immunized IN with L-SME-VLP/L-S¢ME-VLP vaccines had Th1 antibody isotypes, i.e., IgG2a and/or IgG2b in their BALF samples (Table 3).

Table 3: Immunoglobulin isotypes of antibodies in the immunized mouse samples.

Although VLPs of SARS-CoV and SARS-CoV-2 could be readily generated by expression of M and E proteins together in transfected cells^16,17, the VLPs to be used as immunogen in SARS-CoV-2 vaccine must contain and display the S protein, a key component inducing protective antibodies that prevents viral attachment to cells (S1 subunit) and/or genome uncoating (S2 subunit)¹⁸. The SARS-CoV-2 M protein is a transmembrane protein consisting of 222 amino acid residues that form short N-terminal domain, three transmembrane domains and long C-terminal domain¹⁹. M proteins of beta coronaviruses are O-glycosylated with no other post translational modification^19,20. Naturally, the M protein functions in virus assembly and defines the shape of the assembled particles¹⁸. In the SARS-CoV-2 infected cells, the M protein antagonized the host innate immunity by inhibiting the formation of a functional TRAF3-containing complex of the classical TLR/RLR/TNFR-triggered NF- κB pathway which renders refractoriness of the IRF3/IRF7, hence no innate interferon production^19,21. The M proteins of several coronaviruses induce both protective humoral and cytotoxic immune responses²². The N-terminal portion of M protein contains structural and functional cytotoxic T-cell epitope cluster²². Thus, it should be advantageous to include M protein in a SARS-CoV-2 vaccine. From Western blot analysis, the M protein in the VLPs produced in this study appeared as a protein band of about 18–20 kDa, indicating that the protein was intact. The envelope (E) protein is a multifunctional viroporin of coronaviruses that plays role in promoting reproduction and packaging of the progeny viruses. This protein is a major viral factor causing inflammatory response²³ which leads to the cytokine storm and ARDS associated with respiratory coronavirus infections²⁴. The E protein has important biological functions in maintaining the virion integrity and pathogenicity; thus, it is one of the attractive targets of drugs/therapeutics against coronaviruses²⁵. SARS-CoV-2 E protein contains 75 amino acids and is a single-spanning membrane protein. The molecular size of the coronavirus E protein ranges from 8.4–12 kDa²⁶. In this study, the E protein in the VLPs appeared as a protein band at about 10–12 kDa, indicating that full-length E protein was produced.

In this study, the versatile and efficient recombinant baculovirus-Sf21 insect cell system of which the recombinant baculovirus served as a vector and the SF21 insect cells as the host, was used for production of the VLPs consisting of SARS-CoV-2 S/S′, M and E proteins. VLPs of several enveloped viruses have been produced successfully by using this binary system²⁷. It is known that the recombinant baculovirus vector can provide not only high levels of the heterologous gene expression, but also it can accommodate multiple and large gene insert; thus, suitable for production of VLPs and other recombinant proteins²⁸. Baculoviruses are non-pathogenic to humans and animals. Usually, the baculovirus-insect cell system yields recombinant proteins with proper folding, glycosylation, phosphorylation, acetylation and acylation.

From both methods of Sf21 cell transfection (co-transfection and separate transfection) with S-bacmids and ME-bacmids, the Western blot analysis of the culture supernatants of the transfected cells containing P1 baculoviruses revealed not only intact S protein with apparent molecular size of approximately 250 kDa, but also the cleaved S products, i.e., the S1 and S2 subunits which the apparent molecular sizes were approximately 100–120 and 70–100 kDa, respectively. Theoretically, the nascent S, S1 and S2 proteins (without post translational modification) of the SARS-CoV-2 wildtype strain are 141.2, 75.3 and 58–60 kDa, respectively²⁹. The molecular sizes of the intact S protein and the S1 and S2 subunits may vary from the theoretical molecular weights due to post translational modifications, post translation cleavages, relative charges, and other experimental factors^30,31. The post-translational modification of the recombinant S protein in the insect cells accounted for the apparent larger sizes of the S and its subunits of this study.

The S′-P1 baculovirus derived from Sf21 insect cells separately transfected with S′-bacmids and ME-bacmids showed intact S protein and no S1 and S2 subunits in Western blot analysis. Thus, the S′-P2 baculovirus and S′ME-VLPs derived from the S′-P1 baculovirus should also carry intact S protein. In this study, immunogenicity of the anionic liposome-adjuvanted vaccines consisting of VLPs expressing M, E and S/S′ proteins (with and without furin cleavage site at the S1-S2 junction, respectively) were investigated. They were found to have no difference in immunogenicity in inducing systemic and mucosal immune responses.

The VLPs of this study mimic the structural organization and conformation of the authentic native SARS-CoV-2 particles but lacking the viral ribonucleoprotein (RNP)²⁷. The SME-VLPs and the S′ME-VLPs without spikes were approximately 179 and 207 nm in median diameters, respectively, which are conformed to the size of the commercialized SARS-CoV-2 VLPs produced from transfected HEK293 cells³². The median size of the authentic native SARS-CoV-2 particles without spikes was 100 nm³³. After being encapsulated by liposome (L), the median sizes of the liposome-encapsulated SME-VLPs (L-SME-VLP vaccine) and S′ME-VLPs (L-S′ME-VLP vaccine) were 316 and 237 nm in the average, respectively, which were not significantly different from the average size of the liposome-entrapped PBS (placebo; L-PBS; 342 nm). The correlation of the particulate adjuvant characteristics (including sizes and surface charges) with the resultant immune responses against the adjuvanted vaccines has been reviewed extensively³⁴. The size of the particulate adjuvants may have different effects on the type of the vaccine-induced immune responses. For targeted-delivery systems, nanoparticles (1-1000 nm) are considered more effective than microparticles (1-1000 µm), as the former is more efficient in diffusing through biological barriers, passing through capillaries and being relatively stable in blood circulation^34–36. For vaccines, however, experimental results pertaining to the optimal size ranges of the particulate-based delivery system that will generate strong and sustained immune responses to the co-administered antigen are conflicting^34,37. Nevertheless, evidence indicated that immunization with the 200–600 nm particles favored Th1 immune responses, whereas immunization with the 2–8-µm particles favored Th2 response³⁸. For respiratory infections, like respiratory syncytial virus (RSV) and SARS-CoV/SARS-CoV-2, Th1 response to vaccine is preferred to the Th2 response as it was observed in vaccinated animal models as well as in children that the Th2 response may exacerbate lung inflammation upon experiencing new infection due to immunopathology that reminiscent the type 1 hypersensitivity with eosinophil infiltration and immune complex deposition in the lung^39,40.

Both SME-VLPs and S′ME-VLPs carried negatively charged surface (-1.96 and − 5.31, respectively). After liposome encapsulation, the negative charges of the vaccine micelles were increased to -5.12 and − 18.63, respectively. For parenteral immunization, e.g., intramuscular or subcutaneous route, vaccines using cationic liposome as adjuvant and delivery vehicle offers benefit by causing tissue damage and a release of damage-associated molecular patterns (DAMPs) at the injection site that act as the endogenous adjuvant to activate inflammatory response via binding with pattern recognition receptors (PRRs) of cells of the innate immune system including antigen-presenting cells (APCs) such as dendritic cells (DCs) and macrophages, and stimulation of both helper and cytotoxic lymphocyte responses⁴¹. Besides, the cationic liposome are prone to coalesce with the negatively charged surface of the APCs⁴² and, in the effect, may cause a release of the liposome-entrapped antigen into the APC cytoplasm which is then processed and presented to the CD8 + T cells via the MHC class I (cytotoxic response) and cross-presented to the CD4 + T cells by the MHC class II pathway to elicit the T helper response, i.e., Th1 or Th2 response, or both, depending upon the cytokine milieu. However, administration of cationic liposome made of lipids with quaternary ammonium head groups intravenously to mice (mimicking natural infection such as hematophagous insect bite) causes cell disruption and hemolysis^42,43. In this study, mice were immunized with anionic liposome-adjuvanted VLP vaccines, either intraperitoneally (IP) or intranasally (IN). In the peritoneal cavity, macrophages (that functions in immune surveillance against invader) effectively detect, phagocytose, and process the antigen for T cell presentation and B1 cell stimulation. At the mucosal surface, like nasal cavity and intestine, the mucin glycoproteins in the mucus gel layer carry strongly net-negative surface due to their high sialic acid and sulfate content⁴⁴. Thus, for the mucosal vaccination, anionic or neutral nanoparticles with encapsulated immunogen will not bind to or trapped in the negatively charged mucosa, allowing them to be easily approachable, endocytosed, and transported (by microfold/M cells) to the inductive site of the respective mucosal lymphoid tissue, such as, mouse organized and diffuse nasal-associated lymphoid tissues (ONALT and DNALT), tonsils, Peyer's patches, draining lymph nodes⁴³. Thus, negatively charged carriers may favor mucosal vaccination such as intranasal, oral, or vaginal vaccination^42,44.

Although intraperitoneal route of immunization is not in medical practice, however, intraperitoneal immunization of mice has been utilized extensively in research for vaccine development against respiratory viruses, including influenza, respiratory syncytial virus (RSV), and SARS-CoV-2 vaccines, to gain primary data on innocuity and immunogenicity^45–47. Intraperitoneal inoculation with live influenza A virus confers protection against intranasal infections in mice and ferrets⁴⁶. Intraperitoneal immunization induced acute and memory immune responses capable of effector functions and protection at distal nasal mucosa and lung against RSV⁴⁵. Intraperitoneal immunization was performed in this study for testing innocuousness and immunogenicity of the anionic liposome-adjuvanted VLP vaccines against SARS-CoV-2. The peritoneal cavity is the largest serosal body space that harbors most of the abdominal organs and an important visceral adipose tissue called omentum. The omentum contains milky spots which are clusters of leukocytes that the cells are organized like those in the secondary lymphoid tissues, i.e., a central B cell area surrounded by T cells and myeloid cells that are supported by a fibroblastic stromal cell network^48,49. The omentum (and other serous cavities, e.g., pleural cavity) is a site of B1 cell lymphopoiesis and T cell-independent immune responses to multivalent antigens. B1 cells produce cross-reactive antibodies that are mainly IgM but can be IgG3 and IgA isotypes⁵⁰. Besides, activated B1 cells can migrate to mucosal surface such as intestinal lamina propria and differentiate into plasma cells that secrete IgA antibodies for protection of the mucosal surface⁵¹. Activated B1 cells can migrate to spleen where they serve as precursor of splenic IgM producing cells⁵². Peritoneal B1 cells can switch readily to IgA producing cells in splenic marginal zone⁵³.

After three IP doses of the L-SME-VLP/L-S′ME-VLP vaccines, the titers of the ELISA antibodies to SARS-CoV-2 S1 subunit and VN antibodies were markedly induced. The predominant isotype of the serum anti-S1 antibodies of 5 of 6 immunized mice (83%) were IgG3 which can be either from activated B1 cells that migrated to other lymphoid tissues, i.e., spleen and lymph nodes, or from the activated B2 cells in the peripheral lymphoid tissues in response to the antigen that entered systemic circulation. Mouse IgG3 is highly efficient in complement activation, opsonophagocytic activities as well as antibody-dependent cell-mediated cytotoxicity (ADCC)⁵⁴ which cause virus clearance upon infection. Nevertheless, complement fixation and immune-complex formation may exacerbate the inflammation and cytokine storm as well as causing infiltration of inflammatory cells (especially eosinophils) into lungs of the virus infecting host which exacerbates the critical morbidity^39,55.

The upper respiratory tract is an important prime site of host defense against inhalant pathogens, e.g., respiratory viruses like influenza virus, RSV and SARS-CoV-2. Advantages of intranasal vaccination in induction of the mucosal and systemic immunity have been reviewed⁵⁶. Intranasal immunization effectively induces protective immunity by triggering both mucosal and systemic responses following antigen administration which contrasts with intramuscular injection that primarily induces systemic immune responses^56,57. Intranasal vaccination can confer protection against infections at other mucosal sites, such as the lower respiratory tract and lungs, intestines, and genital tract, and may provide cross-protection against variant strains due to cross-reactive/poly-reactive nature of antibodies produced by activated B1 cells⁵⁸. Three doses of the L-SME-VLP and L-S′ME-VLP vaccines containing 30 µg VLPs/dose, administered intranasally did not induce significant rise of serum antibodies, indicating that the immunizing dose might be too low, or the time of sample collection was too soon⁵⁹. Both vaccines were found to induce predominantly Th1 response as shown by IgG2a and/or IgG2b antibody isotypes in the BALF, and less IgG3 production. IgG2a and IgG2b are relatively poor in complement activation and opsonophagocytic activities compared to the IgG3⁶⁰. On contrary, several studies have demonstrated that specific IgG2a exhibits stronger anti-viral effects than other antibody isotypes^61,64. Predominant IgG2a among many IgG antibody responses elicited by live viruses could confer the best protection for the infected host⁶⁵. The intranasal route of vaccination is best suited for pandemic/epidemic control of highly contagious/infectious respiratory viruses following the outbreak, because it is easy to do; thus, less skilled allied health personnels can be recruited for doing the mass vaccinations⁵⁶. The intranasal route causes minimal discomfort with no intrusive and pain; therefore, it should receive better compliance from children, needle-fear subjects, and patients with morbidities that required multiple/frequent injections^60,66.

In conclusion, the anionic liposome (L) encapsulated/adjuvanted VLPs (L-SME-VLP and L-S′ME-VLP vaccines) were innocuous and immunogenic in mice after IP and IN immunization. Both vaccines induced principally serum IgG3 antibody isotype response in the IP immunized mice while mice immunized intranasally with the vaccines had principally Th1-type response as shown by predominant IgG2a and/or IgG2b antibody isotypes in the bronchoalveolar lavage fluids. The intranasal anionic liposome-adjuvanted VLP vaccines should be tested further towards the clinical use as an effective, safe and well-compliant vaccine that induces the first line defense against the inhalant SARS-CoV-2.

Cells, media, bacteria, viruses, and virus propagation

Sf21 insect cells were from Invitrogen, Thermo Scientific, Waltham, Massachusetts, USA. Sf-900 III serum-free medium was from Thermo Fisher Scientific. Super optimal broth with catabolite repression (SOC) was from Invitrogen, Thermo Scientific. Dulbecco's modified Eagle’s medium (DMEM) was from Gibco, Thermo Scientific. Fetal bovine serum (FBS) was from Hyclone, Cytiva, Marlborough, USA. MAX Efficiency® DH10Bac™ Escherichia coli competent cells containing Autographa californica Multiple Nuclear Polyhedrosis Virus (AcMNPV) Bacmids were from Invitrogen by life technology, Thermo Fisher Scientific.

SARS-CoV-2 virus, Wuhan strain Si01 (isolated from Thai patient with COVID-19) was propagated in the Vero E6 cells. The Vero E6 cells (5 × 10⁶ cells) were seeded to T75-flasks (Nunc, Thermo Scientific) and incubated overnight at 37°C in 5% CO2 atmosphere. The flasks were moved to biosafety level 3 (BSL-3) laboratory, Department of Microbiology, Faculty of Medicine Siriraj Hospital, Bangkok. The SARS-CoV-2 was diluted in DMEM and added to the Vero E6 cells at MOI 0.1. The infected cells were incubated at 37°C in 5% CO₂ atmosphere for 1 h; the supernatant was removed, and the DMEM supplemented with 2% FBS was added to the infected cells and incubated in 37°C, 5% CO2 incubator for 72 h. The preparation was centrifuged; the SARS-CoV-2 concentration in the cell-free supernatant was titrated by plaque-forming assay (PFA)⁶⁷. The virus was kept at -80°C until use.

Preparation of recombinant bacmids

Full-length gene sequences coding for S, M and E of SARS-CoV-2 Wuhan-Hu-1 (GenBank accession no. MN908947.3) were used for generation of recombinant plasmids, including recombinant S-pFastBac™ and ME-pFastBac^TMDual vectors (GenScript, Piscataway, NJ, USA). One nanogram of each recombinant vector was mixed with 100 µL of log-phage grown MAX Efficiency® DH10Bac™ E. coli competent cells in separate tubes. The tubes were placed in ice-bath for 20 min, then transferred to 42°C water-bath for 45 sec, and ice-bath for 2 min (heat-shock transformation). Competent cell recovery medium (Super optimal broth with catabolite repression (SOC; 900 µL) was added to each tube and incubated at 37°C with shaking aeration (225 rpm) for 4 h. Each preparation was then diluted 10-fold serially; each dilution (100 µL) was spread onto Luria-Bertani (LB) agar plates containing antibiotics [50 µg/mL kanamycin (Kangen, Bangkok, Thailand), 7 µg/mL gentamycin, and 10 µg/mL tetracycline (AppliChem GmbH, Damstadt, Germany), 100 µg/mL Blue-Gal (Abcam, Cambridge, USA) and 40 µg/mL isopropyl β-d-1-thiogalactopyranoside (IPTG) (Vivantis Technologies, Selangor Darul Ehsan, Malaysia). The plates were incubated at 37°C for 48 h. White colonies were streaked on fresh LB agar plates containing the antibiotics and Blue-Gal for the colonies’ verification. The transformed DH10Bac™ E. coli colonies with respective recombinant bacmids (derived from transposition of S, M and E genes from S-pFastBac^TM1 and ME-pFastBac^TMDual plasmids to bacmids in E. coli; as shown by diagram in supplementary Fig. S1) were checked by PCR using pUC/M13 forward primer: 5′CCCAGTCACGACGTTGTAAAACG3′ and pUC/M13 reverse primer: 5′-AGCGGATAACAATTTCAACAGG-3′.

The recombinant bacmids, designated S-bacmids and ME-bacmids, were extracted from the respective PCR-positive DH10Bac™ E. coli clones by using PureLink™ HiPure Plasmid DNA Purification kit (Invitrogen by life technology, Thermo Fisher Scientific). Escherichia coli colonies were grown in 5 mL LB broth containing antibiotics at 37°C with shaking aeration (250 rpm) overnight. Individual cultures were added to 500 mL of fresh LB broth, incubated overnight, and centrifuged (4500 × g, 30 min). Each bacterial pellet was resuspended in a 10 mL R3 buffer (buffers and columns were provided with the plasmid DNA purification kit) before adding with 10 mL L7 lysis buffer. The tubes were inverted several times and kept at room temperature (25 ± 2°C) for 5 min, added with 10 mL N3 precipitation buffer, mixed well, and centrifuged (11,000 × g, 4 ºC, 15 min). Supernatants were loaded to separate columns; the columns were equilibrated with EQ1 buffer, and the samples were allowed to flow through, followed by washing each column with 60 mL W8 buffer. The bacmids were eluted with 15 mL E4 elution buffer; each eluate was added with 10.5 mL isopropanol, and centrifuged (11,000 × g, 4 ºC, 15 min). Supernatants were discarded; the pellets containing bacmids were washed thrice with 70% ethanol and finally suspended in 500 µL Tris-EDTA (TE) buffer (10 mM Tris-HCl containing 1 mM EDTA•Na2). Bacmid DNA amounts were determined by nanodrop (Thermo Scientific).

Preparation of P1 and P2 baculoviruses

For preparing P1 baculovirus, Sf21 cells were transfected with either mixture of the S-bacmids and ME-bacmids (co-transfection) or transfected separately with the S-bacmids and ME-bacmids (separate transfection).

For the co-transfection, Sf21 cells were seeded into 6-well culture plates (1 × 10⁶ cells in 2 mL Sf-900 III SFM medium/well) and the plates were kept at 27°C, non-CO2 atmosphere and non-humidified in New Brunswick S41i incubator shaker (Eppendorf, Hamburg, Germany) for 1 h. Two types of transfection reagents were used for the cell transfection: Expifectamine™ Sf transfection reagent (Gibco, Thermo Fisher Scientific) and Lipofectamine™ 3000 transfection reagent (Thermo Fisher Scientific). The S-bacmids and ME-bacmids were mixed (equally at total bacmid amounts 1, 2 or 3 µg) and added separately to 10 µL of the Expifectamine transfection reagent in 250 µL of Opti-MEM™ I reduced serum medium (Invitrogen). The preparations were kept at room temperature for 5 min before adding to appropriate wells containing Sf21 cells. For transfection using Lipofectamine, individual bacmids (1, 2 or 3 µg) were mixed with 5 µL P3000™ in 125 µL Opti-MEM™ I reduced serum in a tube (tube A). In another tube (tube B), 5 µL of Lipo-3000 and 117.5 µL of Opti-MEM™ I reduced serum were mixed. The contents of both tubes were combined, kept at room temperature for 15 min, and added to wells containing Sf21 cells. The plates were kept at 27°C, non-CO₂ atmosphere and non-humidified in New Brunswick S41i incubator shaker for 24–96 h. The cells were observed daily for morphological change; then the culture supernatants containing recombinant P1 baculoviruses were collected. SARS-CoV-2 proteins (S and M) in the culture supernatants were determined by Western blot analysis (E protein was not detected because the anti-E antibody was not available at the time this experiment was done). The concentrations/titers of individual P1 baculovirus preparations were determined by focus-forming assay (FFA). The P2 baculovirus stock was prepared by infecting the Sf21 cells with P1 baculovirus at the MOI 0.1.

The optimal ratio of the S-bacmids and ME-bacmids for the co-transfection was investigated. The Sf21 insect cells (1 × 10⁶ cells in 200 µL of Sf-900 III SFM medium) established in individual wells of the 6-well culture plate at 27°C, non-CO₂ atmosphere and non-humidified in the New Brunswick S41i Incubator shaker, were added with the Lipofectamine containing mixture of the S- and ME- bacmids at 1:1, 1:2, 1:3, 2:1, 2:3, 3:1 and 3:2 (total amount of bacmids in each mixture was 3 µg). The optimal ratio of the two bacmids was used for large scale production of recombinant P1 baculovirus carrying the SARS-CoV-2 S, M and E genes. Recombinant P2 baculovirus was prepared by transfecting the Sf21 cells with the P1 baculovirus at MOI 0.1.

For the separate transfection, 3 µg of S-bacmids and ME-bacmids were added separately to Lipofectamine. The Sf21 cells in different 6-well culture plates were transfected separately with the Lipofectamine-bacmid mixtures, and the plates were kept at 27°C, non-CO₂ atmosphere and non-humidified in New Brunswick S41i incubator shaker until the infected cells showed morphological change. The S-P1 baculovirus and ME-P1 baculovirus were collected from the respective cell culture supernatants. The SARS-CoV-2 proteins in the supernatants were determined by Western blot analysis. For preparing the P2 baculovirus, the S-P1 baculovirus and ME-P1 baculovirus (3 µg each) were mixed and added to the Sf21 cells in 6-well culture plates at the MOI 0.1. The P2 baculovirus contained in the cell spent medium was collected.

Determination of optimal MOI for production of virus-like particles (VLPs)

Recombinant P2 baculovirus was added to Sf21 cells maintained in 6-well culture plates at MOI 1, 5 and 10, and the plates were kept at 27°C, non-CO₂ and non-humidified atmosphere for 96 h. The supernatants containing the VLPs were checked for the S, M and E proteins by Western blot analysis. Optimal MOI that gave the highest VLP yield was used for large scale production of the VLPs that contained S, M and E proteins (SME-VLPs).

Preparation of SARS-CoV-2 VLPs without furin cleavage site at the S1-S2 junction

The plasmid containing inserted SARS-CoV-2 S gene without furin cleavage site at the S1-S2 junction⁶⁸, designated S′-pFastBac™, was synthesized commercially (GenScript). The S′-pFastBac™ and the ME-plasmids were used for production of the VLPs (designated S′ME-VLPs) by means of the separate transfection using Lipofectamine as described above.

Large scale production of VLPs

Sf21 cells (2 × 10⁶ cells/mL) were seeded into 50 mL of Sf-900 III SFM medium in 250 mL-flat bottom shake flasks. The flasks were kept at 27°C, non-CO₂ and non-humidified atmosphere in the New Brunswick S41i Incubator shaker (125 rpm) for 30 min. Recombinant P2 baculovirus was added to the cells at optimal MOI and the flasks were kept shaking further for 96 h. The supernatant containing VLPs was filtered through sterile 0.45 µm-membrane (Pall Corporation, New York, USA); the filtrate containing VLPs was set aside. The cell pellet was added with 20 mL NE buffer, pH 8.0 (50 mM Tris, pH 8.0, 100 mM NaCl, 1.0 mM EDTA) and the cells were lysed by five cycles of freezing (liquid nitrogen) and thawing (37°C water-bath). After centrifugation (10,000 × g, 4°C, 30 min), the supernatant containing VLPs, and the kept filtrate were combined. The preparation was concentrated by using 100-K Omega Macrosep Advance Centrifugal device (Pall corporation) to about 20 mL.

Purification of virus-like particles

The VLPs were purified by using HiTrap Capto™ CORE 400 column (Cytiva, Marlborough, USA) and AKTA avant (Cytiva). The column was washed with 10 mL deionized water (10 column volumes) at 1 mL/min flow rate and equilibrated with 10 mL TNE buffer [50 mM Tris–HCl (pH 7.4), 100 mM NaCl, and 0.1 mM EDTA]. The concentrated VLP preparation was loaded to the column at 0.2 mL/min. The flow through fraction containing the VLPs was collected, and the column was cleaned by washing with TNE buffer containing 1.2 M NaCl. The VLPs were concentrated to 7 mL and overlaid onto a gradient of 20% sucrose solution (2.6 mL) and 65% sucrose solution (1.3 mL) contained in an ultracentrifuge tube (PA Thin-walled tube, Thermo Fisher Scientific). The tube was centrifuged at 35,000 rpm, 4°C for 3 h; the VLP fraction between the 20 and 60% sucrose layers was collected, added with 7 mL TNE buffer, overlaid onto 2.5 mL 20% sucrose solution in a new ultracentrifuge tube, and centrifuged (34,000 rpm, 4°C, 3 h). The supernatant was discarded and the pellet containing purified VLPs was added with a small volume of 0.15 M phosphate-buffered saline, pH 7.4 (PBS).

Focus-forming assay (FFA) for determination of baculovirus quantity

Sf21 cells (1 × 10⁵ cells in 100 µL Sf-900 III SFM medium) were added to individual wells of 96-well-plate and kept at 27°C, 5% CO₂ and non-humidified atmosphere in a New Brunswick S41i Incubator shaker for 1 h. The recombinant baculovirus preparation was diluted 10-fold serially and 50 µL of each dilution were added to appropriate cell-containing wells (triplicate). The plates were kept as above for 1 h. The fluids in all wells were discarded and each well was added with 100 µL Sf-900 III SFM medium mixed with carboxy methyl cellulose (CMC) (Sigma, Kanagawa, Japan) (0.6% CMC final concentration). The plates were incubated further for 45 h. The cells were fixed with 4% paraformaldehyde (Sigma, Kanagawa, Japan) in PBS at room temperature for 30 min, washed with 200 µL 5% normal goat serum in PBS containing 0.05% Tween-20 (PBS-T) at room temperature for 30 min. After discarding the normal goat serum, each well was added with 50 µL mouse anti-baculovirus gp64 antibody (Thermo Fisher Scientific). The plates were placed on a shaker (110 rpm) at 37°C for 30 min; the cells were washed with PBS-T, added with mouse-IgGκ binding protein-horseradish peroxidase (HRP) conjugate (Santa Cruz Biotechnology, Dallas, Texas 75220, USA) and incubated on the shaker for 30 min. The cells were washed with PBS-T before adding with 50 µL TrueBlue peroxidase substrate (KPL, Seracare, Milford, MA, USA) to develop signal at room temperature in the dark for 2–3 h. The number of foci in each well were counted under a light microscope (40× magnification) and the focus-forming units (ffu)/mL of the baculovirus preparation was calculated: ffu/mL = (number of foci × dilution factor) / infection volume (mL).

Characterization of virus-like particles

SARS-CoV-2 proteins in the VLP preparation were analyzed by Western blotting. Each sample was added with 6 × sample buffer [197.4 mM Tris pH 6.8, 6% sodium dodecyl sulfate (SDS), 60% glycerol, 0.06% bromophenol blue and 15% β-mercaptoethanol], boiled for 5 min, and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in 4% stacking and 12% separating gels. The separated components were transblotted onto nitrocellulose (NC) membranes; the NC blots were blocked with 5% skim milk in TBS-T [0.25 M Tris-HCl (pH 7.6), 0.15 M NaCl and 0.1% Tween-20] for 1 h, washed, and submerged in solution of either mouse anti-S monoclonal antibody (in house production), rabbit anti-SARS-CoV M protein antibody (Arigo Biolaboratories, Hsinchu City 300, Taiwan) or rabbit anti-SARS-E antibody (Abcam, Cambridge, USA) for detection of S, M and E proteins, respectively. After 1 h, the NC membranes were washed with PBS-T and placed into a solution of secondary antibodies, i.e., goat-anti-rabbit immunoglobulin (Ig)-HRP conjugate (Southern Biotech, Birmingham, AL 35209, USA) and mouse-IgGκ binding protein-HRP conjugate (Thermo Scientific). After 1 h, the NC membranes were washed with TBS-T and the color signal was developed by using Immobilon® Forte Western HRP substrate (Merck, Darmstadt, Germany). The antigen-antibody reactive bands were visualized by using ImageQuant LAS 4010 (GE Healthcare, Cytiva).

The VLPs were negatively stained by uranyl acetate and observed under transmission electron microscopy (TEM) for their apparent morphology. The VLP sizes and surface charges were determined by using dynamic light scattering (DSL)-zetasizer (Malvern, DKSH, Zurich, Switzerland).

Preparation of liposome and formulation of liposome-adjuvanted VLP vaccines

Multilamellar liposome was prepared as described previously⁶⁹ from mixture of 148 mg phosphatidylcholine (LIPOID S 100; LIPOID AG, CH – 6312 Steinhausen, Switzerland) and 72.5 mg cholesterol (Merck) using 153 mg dodecyl dioctadecyl ammonium bromide (DDAB) as a cationic surfactant and 25 mL dichloromethane as a solvent. A film of 1 mL lipid stock (30 µM) was made on the inner surface of a round-bottom flask; then, 240 µg of VLPs (SME-VLPs/S′ME-VLPs) in 800 µL PBS were added to the lipid film and mixed until a homogeneous creamy preparation was obtained. Liposome-adjuvanted VLP vaccines were prepared. For placebo, PBS was used instead of the VLPs for preparing liposome-entrapped PBS.

Mouse immunization and vaccine innocuity and immunogenicity

Female BALB/c mice, 5 weeks old, were purchased from Nomura Siam International, Bangkok, Thailand. Mice were accustomed in the animal facility of the Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, before commencing the experiments. Each mouse bled (submandibular) to collect preimmunized serum sample. They were divided into 6 mice per group.

For experiment 1, mice were divided into three groups. Mice of group 1 (T1-T6) received IP three doses of the L-SME-VLPs vaccine (100 µL of vaccine containing 30 µg SME-VLPs) at two-week intervals. Mice of group 2 (T7-T12) received IP three doses of the L-S′ME-VLPs vaccine (100 µL of vaccine containing 30 µg S′ME-VLPs), and mice of group 3 (C1-C6) received three doses of placebo (100 µL of liposome-entrapped PBS), also at two-weeks apart. Fourteen days post last booster, the mice bled and were euthanized. Specific antibodies to SARS-CoV-2 S protein in all mouse serum samples were determined by indirect ELISA. The virus-neutralizing (VN) antibody titers were measured by microneutralization test performed in BSL-3 laboratory.

For the second experiment, mice of group 1 (T13-T18) and group 2 (T19-T24) were immunized intranasally (IN) with L-SME-VLP and S′ME-VLPs (50 µL of vaccine containing 30 µg of SME-VLPs/S′ME-VLPs; 25 µL per nostril), respectively, at two-weeks intervals. Mice of group 3 (C13-C18) were administered IN with 50 µL of L-PBS (25 µL per nostril) using the same timeline. Two weeks after the third dose, bronchoalveolar lavage fluid (BALF) was collected from each mouse after euthanasia by flushing the respiratory tract with 1 mL PBS. ELISA and VN titers (FFA) in BALF samples against S1 protein and the antibody isotypes were determined. Timeline of the mouse immunization and samplings are summarized in supplementary Fig. S2.

Indirect enzyme-linked immunosorbent assay (indirect ELISA)

Recombinant S1 of SARS-CoV-2 Wuhan wildtype (in house production from transformed E. coli) was used to coat wells of a 96-well microplate (Nunc, Thermo Scientific) (0.5 µg in 100 µL bicarbonate buffer, pH 9.6, per well) and kept at 4°C overnight. All wells were blocked with 300 µL of 3% BSA in PBS-T at 37°C for 1 h. After washing the wells with PBS-T to discard excess blocking protein, diluted samples (100 µL) were added to appropriate antigen-coated wells and the plates were kept at 30°C for 1 h. After washing with PBS-T, wells were added with 100 µL goat-anti mouse Ig-HRP conjugate (Southern Biotech, Birmingham, AL, USA; diluted 1:3000 with PBS-T) and incubated at 37°C for 1 h. ABTS [2,2′-azinobis (3-ethylbenzothiazoline-6-sulfonic acid)] substrate (100 µL; KPL, Seracare) was used for color development at room temperature in the dark for 30 min. The enzymatic reaction was stopped by adding 100 µL of 1 M orthophosphoric acid. Optical density at 405 nm (OD405) of contents in all wells were determined by using BioTek Synergy H1 microplate reader (Biotek, Sata Clara, CA, USA).

Antibody isotyping

Isotypes of antibodies to SARS-CoV-2 S1 protein in mouse samples were determined by using Ig isotyping mouse uncoated ELISA kit (Invitrogen). The wells of ELISA plate were coated with recombinant S1 and the empty sites on the well surface were blocked as above. The samples were added to appropriate coated wells, and the plates were incubated at 37°C for 1 h. After washing, rat anti-mouse Ig isotypes (IgG1, IgG2a, IgG2b, IgG3, IgA, IgM, κ light chain, λ light chain) were added to appropriate wells and incubated at 37°C for 1 h. Thereafter, wells were washed with PBS-T before adding with 100 µL goat anti-rat Ig-HRP conjugate (diluted 1:3000 in PBS-T), kept at 37°C for 1 h, washed again with PBS-T, and added each well with SureBlue™ TMB 1-Component Microwell Peroxidase Substrate (3,3′,5,5′- tetramethylbenzidine) (KPL, Seracare). The plate was kept at room temperature in the dark for 30 min. OD450 of the content in each well was determined (BioTek Synergy H1).

Statistical analysis. The mean values and standard deviations (SD) between groups were compared using an independent t-test (GraphPad Prism version 9 software, GraphPad Software, San Diego, CA, USA). P-value of 0.05 or lower was considered statistically significant: p > 0.05 (ns, not significant); p < 0.05 (*), p < 0.01 (**).

Statement of approval

Animal experiments received ethical approval from Animal Care and Use Committee (ACUC), Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok (No. 013/2563). Biological safety experiments were approved by Siriraj Safety Risk Management Taskforce, Mahidol University (No. SI 2020-033). All experiments in this study are reported in accordance with the ARRIVE guidelines.

Data availability

The data supporting this study's findings are presented within the manuscript and its supplementary materials. Additional raw data and detailed protocols are available from the corresponding author upon reasonable request, subject to data sharing agreements.

Acknowledgements

The authors thank Professor Dr. Prasert Auewarakul and colleagues, Department of microbiology, Faculty of medicine Siriraj hospital, Mahidol university, Bangkok 10700, Thailand for providing SARS-CoV-2 wildtype strain Si and Vero E6 cells.

Funding

The authors gratefully acknowledge the support from the Government Pharmaceutical Organization (GPO) of Thailand (grant no. 07/2563) and Mahidol University, Thailand (grant no. MU-SRF-PF-06C/66).

Author information

Authors and Affiliations

Center of Research Excellence in Therapeutic Proteins and Antibody Engineering, Department of Parasitology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand

Monrat Chulanetra, Kodchakorn Mahasongkram, Wanpen Chaicumpa & Kantaphon Glab-ampai

Department of Biochemistry, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand

Primana Punnakitikashem

Contributions

WC conceived the research project. WC, KG and MC designed the experiments and analyzed the data. MC, KG, PP, and KM performed the experiments. KG and MC prepared Figures. WC wrote the manuscript.

Corresponding Author

Correspondance to Kantaphon Glab-ampai

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional Information

Publisher's note

Springer Nature remains neutral regarding jurisdictional claims in published maps and institutional affiliations.

Supplementary information.

The online version contains supplementary material available at https://doi.org/10.-----------------------

Alu, A., Chen, L., Lei, H., Wei, Y., Tian, X. & Wei, X. Intranasal COVID-19 vaccines: from bench to bed. EBioMedicine. 76, 103841; 10.1016/j.ebiom.2022.103841 (2022).
Brisse, M., Vrba, S.M., Kirk, N., Liang, Y. & Ly, H. Emerging concepts and technologies in vaccine development. Front. Immunol. 11, 583077; 10.3389/fimmu.2020.583077 (2020.
Sharifzadeh, M., Mottaghi-Dastjerdi, N. & Soltany, R.R.M. A review of virus-like particle-based SARS-CoV-2 vaccines in clinical trial phases. Iran J. Pharm. Res. 21, e1270422022; 10.5812/ijpr-127042 (2022).
CDC National Center for Immunization and Respiratory Diseases. https://www.cdc.gov/ncird/index.html. Accessed 27 June 2024.
Zheng, H., Zhang, T., Xu, Y., Lu, X. & Sang, X. Autoimmune hepatitis after COVID-19 vaccination. Front. Immunol. 13, 1035073; 10.3389/fimmu.2022.1035073 (2022).
Vojdani, A. & Kharrazian, D. Potential antigenic cross-reactivity between SARS-CoV-2 and human tissue with a possible link to an increase in autoimmune diseases. Clin. Immunol. 217, 108480; 10.1016/j.clim.2020.108480 (2020).
Kollmann, T.R., Levy, O., Montgomery, R.R. & Goriely, S. Innate immune function by toll-like receptors: Distinct responses in newborns and the elderly. Immunity 37, 771–783; 10.1016/j.immuni.2012.10.014. (2012)
Aiello, A., Farzaneh, F., Candore, G., Caruso, C., Davinelli, S., Gambino, C.M., Ligotti, M.E., Zareian, N. & Accardi, G. Immunosenescence and its hallmarks: how to oppose aging strategically? A review of potential options for therapeutic intervention. Front. Immunol. 10, 2247; 10.3389/fimmu.2019.02247 (2019).
Russell, M.W. & Mestecky, J. Mucosal immunity: the missing link in comprehending SARS-CoV-2 infection and transmission. Front. Immunol. 13, 957107; 10.3389/fimmu.2022.957107 (2022).
Lycke, N. Recent progress in mucosal vaccine development: Potential and limitations. Nat. Rev. Immunol. 12, 592–605; 10.1038/nri3251. (2012)
Fraser, R., Orta-Resendiz, A., Mazein, A. & Dockrell D.H. Upper respiratory tract mucosal immunity for SARS-CoV-2 vaccines. Trends Mol. Med. 29, 255–267; 10.1016/j.molmed.2023.01.003 (2023).
Russell, M.W. & Mestecky, J. Mucosal vaccines: overview. In: Mestecky J, Strober W, Russell MW, Kelsall BL, Cheroutre H, Lambrecht BN, editors. Mucosal immunology, 4th edition, Amsterdam: Academic Press/Elsevier; 1039–1046 (2015).
Li, M., Wang, Y., Sun, Y., Cui, H., Zhu, S.J. & Qiu, H.J. Mucosal vaccines: strategies and challenges. Immunol. Lett. 217, 116–125; 10.1016/j.imlet.2019.10.013 (2020).
Langel SN, Johnson S, Martinez CI, Tedjakusuma SN, Peinovich N, Dora EG, Kuehl PJ, Irshad H, Barrett EG, Werts AD, Tucker SN. Adenovirus type 5 SARS-CoV-2 vaccines delivered orally or intranasally reduced disease severity and transmission in a hamster model. Sci. Transl. Med. 14, eabn6868; 10.1126/scitranslmed.abn6868 (2022).
Zhang, H., Wang, H., An, Y. & Chen, Z. Construction and application of adenoviral vectors. Mol. Ther. Nucleic Acids. 34, 102027; 10.1016/j.omtn.2023.09.004 (2023).
Tseng, Y.T., Wang, S.M., Huang, K.J., Wang, C.T. SARS-CoV envelope protein palmitoylation or nucleocapsid association is not required for promoting virus-like particle production. J. Biomed. Sci. 21, 34; 10.1186/1423-0127-21-34 (2014).
Xu, R., Shi, M., Li, J., Song, P. & Li, N. Construction of SARS-CoV-2 virus-like particles by mammalian expression system. Front. Bioeng. Biotechnol. 8, 862; 10.3389/fbioe.2020.00862. (2020). Erratum in: Front. Bioeng. Biotechnol. 8, 1026; 10.3389/fbioe.2020.01026 (2020).
Kumavath, R, Barh, D, Andrade, BS, Imchen, M, Aburjaile, FF, Ch, A, Rodrigues, DLN, Tiwari, S, Alzahrani, K.J., Góes-Neto, A., Weener, M.E., Ghosh, P. & Azevedo, V. The spike of SARS-CoV-2: Uniqueness and applications. Front. Immunol. 12, 663912; 10.3389/fimmu.2021.663912 (2021).
Wong, N.A. & Saier, M.H. Jr. The SARS-coronavirus infection cycle: A survey of viral membrane proteins, their functional interactions and pathogenesis. Int. J. Mol. Sci. 22:1308; 10.3390/ijms22031308 (2021).
Holmes, K.V., Doller, E.W. & Sturman, L.S. Tunicamycin resistant glycosylation of coronavirus glycoprotein: demonstration of a novel type of viral glycoprotein. Virology. 115, 334–344; 10.1016/0042-6822(81)90115-x (1981).
Lin, M., Ji, X., Lv, Y., Cui, D. & Xie, J. The role of TRAF3 in immune responses. Dis. Markers. 2023, 7787803; 10.1155/2023/7787803 (2023).
Liu, J., Sun, Y., Qi, J., Chu, F., Wu, H., Gao, F., Li, T., Yan, J. & Gao, GF. The membrane protein of severe acute respiratory syndrome coronavirus acts as a dominant immunogen revealed by a clustering region of novel functionally and structurally defined cytotoxic T-lymphocyte epitopes. J. Infect. Dis. 202, 1171–1180; 10.1086/656315 (2010). Erratum in: J. Infect. Dis. 203, 1699. (2011).
DeDiego, M.L., Nieto-Torres, J.L., Jimenez-Guardeno, J.M., Regla-Nava, J.A., Castano-Rodriguez, C., Fernandez-Delgado, R., Usera, F. & Enjuanes, L. Coronavirus virulence genes with main focus on SARS-CoV envelope gene. Virus Res. 194, 124–137; 10.1016/j.virusres.2014.07.024 (2014).
Ye, Q., Wang, B. & Mao, J. The pathogenesis and treatment of the ‘cytokine storm’ in covid-19. J. Infect. 80, 607–613; 10.1016/j.jinf.2020.03.037 (2020).
Zhou, S., Lv, P., Li, M., Chen, Z., Xin, H., Reilly S. & Zhang, X. SARS-CoV-2 E protein: Pathogenesis and potential therapeutic development. Biomed. Pharmacother. 159, 114242; 10.1016/j.biopha.2023.114242 (2023).
Cao, Y., Yang, R., Lee, I., Zhang, W., Sun, J., Wang, W. & Meng, X. Characterization of the SARS-CoV-2 E protein: sequence, structure, viroporin, and inhibitors. Protein Sci. 30, 1114–1130; 10.1002/pro.4075 (2021). Erratum in: Protein Sci. 30, 2482; 10.1002/pro.4216 (2021).
Roldão, A., Silva, A.C., Mellado, M.C.M., Alves, P.M. & Carrondo, M.J.T. Viruses and Virus-like Particles in Biotechnology: Fundamentals and Applications. Comprehensive Biotechnology. P. 633–656; 10.1016/b978-0-12-809633-8.09046-4 (2017).
Li, Y., Wang, X., Guo, H. & Wang, S. Axonal transport of recombinant baculovirus vectors. Mol. Ther. 10, 1121–1129; 10.1016/j.ymthe.2004.08.018 (2004).
Liu, J., Kan, M., Zhang, L., Yue, Y., Wang, S., Hong, M. & Hong, X. Rapid degradation of SARS-CoV-2 spike S protein by a specific serine protease. Molecules. 27, 1882; 10.3390/molecules27061882 (2022).
Recombinant SARS-CoV-2 S1 subunit protein (RBD) with c-terminal his-tag, transfected HEK293 cell culture supernatant. https://www.raybiotech.com/recombinant-sars-cov-2-s1-subunit-protein-rbd-with-c-terminal-his-tag-transfected-hek293-cell-culture-supernatant-230-20406-200. Accessed 5 July 2024.
Recombinant SARS-CoV-2 spike his protein. https://www.novusbio.com/products/recombinant-sars-cov-2-spike-his-protein-cf_10549-cv. Accessed 5 July 2024.
SARS-CoV-2 virus-like particles. https://www.leadgenebio.com/sars-cov-2-virus-like-particles-ldg002pvm.html. Accessed 5 July 2024.
Laue, M., Kauter, A., Hoffmann, T., Möller, L., Michel, J. & Nitsche, A. Morphometry of SARS-CoV and SARS-CoV-2 particles in ultrathin plastic sections of infected Vero cell cultures. Sci. Rep. 11, 3515; 10.1038/s41598-021-82852-7 (2021).
Oyewumi, M.O., Kumar, A. & Cui, Z. Nano-microparticles as immune adjuvants: Correlating particle sizes and the resultant immune responses. Expert Rev. Vaccines. 9, 1095–1107; 10.1586/erv.10.89 (2010).
Mumper, R.J., Cui, Z. & Oyewumi, M.O. Nanotemplate engineering of cell specific nanoparticles. J. Dispers. Sci. Technol. 24, 569–588. https://doi.org/10.1081/DIS-120021814 (2003).
Monfardini, C. & Veronese, F.M. Stabilization of substances in circulation. Bioconjug. Chem. 9, 418–450; 10.1021/bc970184f (1988).
Xiang, S.D., Scholzen, A, Minigo, G., David, C., Apostolopoulos, V., Mottram, P.L. & Plebanski, M. Pathogen recognition and development of particulate vaccines: does size matter? Methods. 40, 1–9; 10.1016/j.ymeth.2006.05.016 (2006).
Kanchan, V. & Panda, A.K. Interactions of antigen-loaded polylactide particles with macrophages and their correlation with the immune response. Biomaterials. 28, 5344–357; 10.1016/j.biomaterials.2007.08.015. (2007).
Tseng, C.T., Sbrana, E., Yoshikawa, N.I., Newman, P.C., Tania Garron, T., Atmar, R.L, Peters C.J & Couch, R.B. Immunization with SARS coronavirus vaccines lead to pulmonary immunopathology on challenge with the SARS virus. PLoS One. 7, e35421; 10.1371/journal.pone.0035421 (2012).
Waris, M.E., Tsou, C., Erdman, D.D., Zaki, S.R. & Anderson L.J. Respiratory syncytial virus infection in BALB/c mice previously immunized with formalin-inactivated virus induces enhanced pulmonary inflammatory response with a predominant Th2-like cytokine pattern. J. Virol. 70, 2852–2860; 10.1128/JVI.70.5.2852-2860.199 (1996)
Shi. Y. & Rock, K.L. Cell death releases endogenous adjuvants that selectively enhance immune surveillance of particulate antigens. Eur. J. Immunol. 32, 155–162; 10.1002/1521–4141(200201)32:1 < 155::AID-IMMU155 > 3.0.CO;2-P (2002).
Wang, N., Chen, M. & Wang, T. Liposomes used as a vaccine adjuvant-delivery system: from basics to clinical immunization. J. Control Release. 303,130–50; 10.1016/j.jconrel.2019.04.025 (2019).
Gall, D. The adjuvant activity of aliphatic nitrogenous bases. Immunology. 11, 369–386. PMID: 5924622, PMCID: PMC1423838 (1966).
Leal, J., Smyth, H.D.C. & Ghosh, D. Physicochemical properties of mucus and their impact on transmucosal drug delivery. Int. J. Pharm. 532, 555–572; 10.1016/j.ijpharm.2017.09.018 (2017).
Power, U.F., Plotnicky-Gilquin, H., Huss, T., Robert, A., Trudel, M., Ståhl, S., Uhlén, M., Nguyen, T.N. & Binz, H. Induction of protective immunity in rodents by vaccination with a prokaryotically expressed recombinant fusion protein containing a respiratory syncytial virus G protein fragment. Virology. 230, 155–166; 10.1006/viro.1997.8465 (1997).
Gautam, A., Park, B.K., Kim, T.H., Akauliya, M., Kim, D., Maharjan, S.., Park, J, Kim, J., Lee, H., Park, M.S., Lee, Y. & Kwon, H.J. Peritoneal cells mediate immune responses and cross-protection against influenza A virus. Front. Immunol. 10, 1160; 10.3389/fimmu.2019.01160 (2019).
Lei, Z., Zhu, L., Pan, P., Ruan, Z., Gu, Y., Xia, X., Wang, S., Ge, W., Yao, Y., Luo, F., Xiao, H., Guo, J., Ding, Q., Yin, Z., Li, Y., Luo, Z., Zhang, Q., Chen, X & Wu, J. A vaccine delivery system promotes strong immune responses against SARS-CoV-2 variants. J. Med. Virol. 95, e28475; 10.1002/jmv.28475 (2023).
Krist, L.F., Eestermans, I.L., Steenbergen, J.J., Hoefsmit, E.C, Cuesta, M.A., Meyer, S. & Beelen, R.H. Cellular composition of milky spots in the human greater omentum: an immunochemical and ultrastructural study. Anat. Rec. 241, 163–174; 10.1002/ar.1092410204 (1995).
Rangel-Moreno, J., Moyron-Quiroz, J.E., Carragher, D.M., Kusser, K., Hartson, L., Moquin, A. & Randall, T.D. Omental milky spots develop in the absence of lymphoid tissue-inducer cells and support B and T cell responses to peritoneal antigens. Immunity. 30, 731–743; 10.1016/j.immuni.2009.03.014 (2009).
Bertrand, Y., Sánchez-Montalvo, A., Hox, V., Froidure, A. & Pilette, C. IgA-producing B cells in lung homeostasis and disease. Front. Immunol. 14, 1117749; 10.3389/fimmu.2023.1117749 (2023).
Kroese, F.G, Butcher, E.C., Stall, A.M., Lalor, P.A., Adams, S. & Herzenberg, L.A. Many of the IgA producing plasma cells in murine gut are derived from self-replenishing precursors in the peritoneal cavity. Int. Immunol. 1, 75–84; 10.1093/intimm/1.1.75 (1989).
Kawahara, T., Ohdan, H., Zhao, G., Yang, Y.G. & Sykes, M. Peritoneal cavity B cells are precursors of splenic IgM natural antibody-producing cells. J. Immunol. 171, 5406–5414; 10.4049/jimmunol.171.10.5406 (2003).
Kaminski, D.A. & Stavnezer, J. Enhanced IgA class switching in marginal zone and B1 B cells relative to follicular/B2 B cells. J. Immunol. 177, 6025–6029; 10.4049/jimmunol.177.9.6025 (2006).
Damelang, T., Rogerson, S.J., Kent, S.J, & Chung, A.W. Role of IgG3 in infectious diseases. Trends Immunol. 40, 197–211; 10.1016/j.it.2019.01.005 (2019).
Kim, D.M., Kim, Y., Seo, J.W., Lee, J., Park, U., Ha, N.Y., Koh, J., Park, H., Lee, J.W., Ro, H.J., Yun, N.R., Kim, D.Y., Yoon, S.H., Na, Y.S., Moon, D.S. Lim, S.C., Kim, C.M., Jeon, K., Kang, J.G., Jang, N.Y., Jeong, H., Kim, J., Cheon, S., Sohn, K.M., Moon, J.Y., Kym, S., Han, S.R., Lee, M.S., Kim, H.J., Park, W.Y., Choi, J.Y., Shin, H.W., Kim, H.Y., Cho, C.H., Jeon, Y.K., Kim, Y.S. & Cho, N.H. Enhanced eosinophil-mediated inflammation associated with antibody and complement-dependent pneumonic insults in critical COVID-19. Cell Rep. 37, 109798; 10.1016/j.celrep.2021.109798 (2021).
Birkhoff, M., Leitz, M, & Marx, D. Advantages of intranasal vaccination and considerations on device selection. Indian J. Pharm. Sci. 71, 729–731; PMCID: PMC2846493 (2009).
Xing, M., Hu, G., Wan,g X., Wang, Y., He, F., Dai, W., Wang, X., Niu, Y., Liu, J., Liu, H., Zhang, X., Xu, J., Cai, Q. & Zhou, D. An intranasal combination vaccine induces systemic and mucosal immunity against COVID-19 and influenza. NPJ Vaccines. 9, 64; 10.1038/s41541-024-00857-5 (2024).
Sindhava, V.J. & Bondada, S. Multiple regulatory mechanisms control B-1 B cell activation. Front. Immunol. 3, 372; 10.3389/fimmu.2012.00372 (2012).
Kawai, A., Tokunoh, N., Kawahara, E., Tamiya, S., Okamura, S., Ono, C., Anindita, J., Tanaka, H., Akita, H., Yamasaki, S., Kunisawa, J., Okamoto, T., Matsuura, Y., Hirai T. & Yoshioka, Y. Intranasal immunization with an RBD-hemagglutinin fusion protein harnesses preexisting immunity to enhance antigen-specific responses. J. Clin. Invest. 133, e166827; 10.1172/JCI166827 (2023).
Michaelsen, T.E., Kolberg, J., Aase, A., Herstad, T.K. & Høiby, EA. The four mouse IgG isotypes differ extensively in bactericidal and opsonophagocytic activity when reacting with the P1.16 epitope on the outer membrane PorA protein of Neisseria meningitidis. Scand. J. Immunol. 59, 34–39; 10.1111/j.0300-9475.2004.01362.x (2004).
Hocart, M.J., Mackenzie, J.S. & Stewart G.A. The immunoglobulin G subclass responses of mice to influenza A virus: the effect of mouse strain, and the neutralizing abilities of individual protein A-purified subclass antibodies. J. Gen. Virol. 70, 2439–2448; 10.1099/0022-1317-70-9-2439 (1989).
LeClerc, C., Martineau, P., Van der Werf, S., Deriaud, E., Duplay, P. & Hofnung, M. Induction of virus-neutralizing antibodies by bacteria expressing the C3 poliovirus epitope in the periplasm. The route of immunization influences the isotypic distribution and the biologic activity of the anti-poliovirus antibodies. J. Immunol 144, 3174–182. (1990).
Monteyne, P. & Coutelier,J.P. Difference in neutralization between lactate dehydrogenase-elevating virus isolated from acutely and chronically infected mice. J. Gen. Virol. 75, 1173–1176; 10.1099/0022-1317-75-5-1173 (1994).
Smucny, J.J., Kelly, E.P., Macarthy, P.O. & King, AD. Murine immunoglobulin G subclass responses following immunization with live dengue virus or a recombinant dengue envelope protein. Am. J. Trop. Med. Hyg. 53, 432–437; 10.4269/ajtmh.1995.53.432 (1995).
Markine-Goriaynoff, D. & Coutelier, JP. Increased efficacy of the immunoglobulin G2a subclass in antibody-mediated protection against lactate dehydrogenase-elevating virus-induced polio encephalomyelitis revealed with switch mutants. J. Virol. 76, 432–435; 10.1128/jvi.76.1.432-435.2002 (2002).
Skwarczynski, M. & Toth, I. Non-invasive mucosal vaccine delivery: advantages, challenges and the future. Expert Opin. Drug Deliv. 17, 435–437; 10.1080/17425247.2020.1731468 (2020).
Glab-Ampai, K., Kaewchim, K., Saenlom, T., Thepsawat, W., Mahasongkram, K., Sookrung, N., Chaicumpa, W. & Chulanetra, M. Human superantibodies to 3CL^pro inhibit replication of SARS-CoV-2 across variants. Int. J. Mol. Sci. 23, 6587; 10.3390/ijms23126587 (2022).
Papa, G., Mallery, D.L., Albecka, A., Welch, L.G., Cattin-Ortolá, J., Luptak, J., Paul, D., McMahon, H.T., Goodfellow, I.G., Carter, A., Munro, S. & James L.C. Furin cleavage of SARS-CoV-2 spike promotes but is not essential for infection and cell-cell fusion. PLoS Pathog. 17, e1009246; 10.1371/journal.ppat.1009246 (2021).
Meechan, P., Tungtrongchitr, A., Chaisr,i U., Maklon, K., Indrawattana, N., Chaicumpa, W., Sookrung, N. Intranasal, liposome-adjuvanted cockroach allergy vaccines made of refined major allergen and whole-body extract of Periplaneta americana. Int. Arch. Allergy Immunol. 161, 351–362; 10.1159/000348314 (2013).

No competing interests reported.

SupplementaryMaterials.pdf

Download PDF

Editorial decision: Revision requested
12 Sep, 2024
Reviews received at journal
07 Sep, 2024
Reviews received at journal
28 Aug, 2024
Reviewers agreed at journal
28 Aug, 2024
Reviewers agreed at journal
27 Aug, 2024
Reviewers invited by journal
27 Aug, 2024
Editor assigned by journal
27 Aug, 2024
Editor invited by journal
16 Aug, 2024
Submission checks completed at journal
16 Aug, 2024
First submitted to journal
06 Aug, 2024

You are reading this latest preprint version

Immunogenicity of intraperitoneal and intranasal liposome adjuvanted VLP vaccines against SARS-CoV-2 infection

Status:

Version 1

Abstract

Figures

Introduction

Results

Generation of recombinant bacmids and baculoviruses for use in VLPs production

P1 and P2 baculovirus preparations

Production of virus-like particles (SME-VLPs)

Innocuity and immunogenicity of the liposome-adjuvanted VLP vaccines

Discussion

Materials and methods

Cells, media, bacteria, viruses, and virus propagation

Preparation of recombinant bacmids

Preparation of P1 and P2 baculoviruses

Determination of optimal MOI for production of virus-like particles (VLPs)

Preparation of SARS-CoV-2 VLPs without furin cleavage site at the S1-S2 junction

Large scale production of VLPs

Purification of virus-like particles

Focus-forming assay (FFA) for determination of baculovirus quantity

Characterization of virus-like particles

Preparation of liposome and formulation of liposome-adjuvanted VLP vaccines

Mouse immunization and vaccine innocuity and immunogenicity

Indirect enzyme-linked immunosorbent assay (indirect ELISA)

Antibody isotyping

Statement of approval

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1