PiR-26681: A Promising Therapeutic Inhibitor Targeting METTL3/METTL14 Complex-Mediated FBXO16 M6A Modification and Suppressing the EMT/WNT Pathway in Ovarian Cancer

doi:10.21203/rs.3.rs-4867343/v1

Download PDF

Article

PiR-26681: A Promising Therapeutic Inhibitor Targeting METTL3/METTL14 Complex-Mediated FBXO16 M6A Modification and Suppressing the EMT/WNT Pathway in Ovarian Cancer

https://doi.org/10.21203/rs.3.rs-4867343/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Ovarian cancer (OV), a prevalent gynecological malignancy, is characterized by poor outcomes and limited treatment options. Compared to patients with early stages of the disease, patients with advanced ovarian cancer have significantly lower survival rates. For these reasons, investigating a nucleic acid that may be a promising treatment for ovarian cancer was the main goal of this study, particularly in terms of preventing the disease from progressing from its primary stage to an advanced one. Significantly, individuals with ovarian cancer displayed a diminished amount of piR-26681, particularly in the later stages of the disease. Moreover, piR-26681 is associated with a favorable prognosis. Overexpression of piR-26681 in ovarian cancer cells significantly inhibited malignant behaviors. Mechanistically, piR-26681 interacted with METTL3 and METTL14, enhancing their stability and facilitating their binding. It also elevated the levels of m6A methylation and enhanced the stability of METTL14 and FBXO16 mRNAs. Consequently, this led to downregulation of β-catenin and suppression of the WNT and EMT signaling pathways. In vivo, experiments using xenograft models and patient-derived organoids (PDOs) further confirmed the tumor-suppressive effects of piR-26681. These findings indicate that piR-26681 represents a potentially promising strategy for improving the treatment outcomes of ovarian cancer.

Biological sciences/Cancer/Gynaecological cancer/Ovarian cancer

Biological sciences/Cancer/Cancer genomics

ovarian cancer

piR-26681

patient-derived organoids

m6A methylation

WNT signaling

EMT signaling

Ovarian cancer is one of the most prevalent gynecological cancers, characterized by high mortality rates and poor outcomes ^1–3. The mainstays of ovarian cancer treatment are cytoreductive surgery and platinum-paclitaxel maintenance chemotherapy, though their therapeutic effects are often suboptimal ^1,4. Recent advancements in targeted treatment research have led to the use of ovarian cancer immunotherapy, employing strategies such as cancer vaccines, immune checkpoint blockade, and other methods. Specific treatments, like polyadenosine diphosphate ribose polymerase (PARP) inhibitors, have shown considerable therapeutic efficacy ⁵. However, a significant proportion of patients, particularly those with intact homologous recombination repair (HRR), drive minimal benefit from these treatments.

Epithelial Ovarian cancer survival rates vary significantly by stage: 89% for stage I, 71% for stage II, 41% for stage III, and 20% for stage VI ⁶, indicating a dramatic decrease in survival as the disease progresses beyond stage III. Furthermore, many individuals with ovarian cancer do not exhibit noticeable clinical symptoms in the early phases ⁷, and over 75% of patients are diagnosed at advanced stages during their initial or confirmed diagnosis^8,9. Notwithstanding advances in treatment options, such as extensive surgical cytoreduction and novel adjuvant treatments, the survival rates for ovarian cancer remain dismally low ¹⁰. Thus, a deeper understanding of the molecular pathways involved in the onset and progression of ovarian cancer is crucial for developing more effective treatment options.

The field of RNA-based treatments has attracted considerable attention due to its exceptional specificity for targeting RNA or DNA, offering a promising approach to modulating gene expression in response to the widespread prevalence of cancer ¹¹. Discovered in 2006, P-element-induced wimpy testis (PIWI) interacting RNAs (piRNAs) are a class of short non-coding RNAs that specifically bind to PIWI proteins in testicular germ cells. These RNAs, ranging from 24 to 31 nucleotides in length, play a crucial role in cell biology regulation ^12,13. Initially, the piRNAs-PIWI protein pathway was recognized for its role in protecting the genetic integrity of reproductive cells from harmful transposon-induced mutation ^14,15. However, recent studies have shown that piRNAs are not only prevalent in healthy somatic cells but are also actively expressed in cancerous cells. Significant dysregulation of various piRNAs has been observed in tumor tissues, where they can either promote or inhibit tumor growth¹⁶. This dual role highlights their potential as targets for innovative therapeutic strategies in oncology.

This study aims to investigate the differences in piRNA expression between individuals diagnosed with early-stage and advanced-stage ovarian cancer. Our objective is to identify a specific short nucleic acid molecule that not only serves as a prognostic indicator but also inhibits the invasion and progression of ovarian cancer, presenting a potential therapeutic avenue. We have examined the expression level of piR-26681 in ovarian cancer and its correlation with patient prognosis. Additionally, we aim to deepen our understanding of piR-26681’s role in the epigenomic regulation within ovarian cancer and its possible involvement in disease development.

Conventional cancer models often fall short of accurately representing the complex tumor microenvironment and heterogeneity seen in human patients. In response, patient-derived organoids (PDOs) have emerged as a promising model system that more closely mirrors the clinical scenarios. PDOs are three-dimensional structures developed from tumor cells extracted from patients, capable of replicating the original tumor’s diverse cellular makeup and architectural complexity ^17,18. To further investigate the therapeutic potential of piR-26681, we created ovarian cancer PDO (OC-PDO) models using samples from various patients. Our findings indicate that piR-26681 effectively suppresses the growth of OC-PDOs.

These results suggest that piR-26681 could be a viable therapeutic target for ovarian cancer and may also serve as a valuable biological marker for predicting clinical outcomes.

2.1 PiR-26681 is decreased in ovarian cancer and correlated with primary stage and positive patient outcomes

We analyzed a pair of human ovarian cancer samples, comparing primary-stage samples with matched advanced-stage samples using Pandora sequencing to identify differentially expressed piRNAs. PiR-26681 (piRBase Id: piR-has-26681, NCBI GenBank: DQ596465.1) was selected for further analysis due to its low expression in the advanced stages (fold change value= -3.436), as shown in Fig. 1A. Subsequent verification on a larger dataset, which included 43 patients with primary-stage ovarian cancer, 42 patients with advanced-stage ovarian cancer, and 19 normal ovaries, revealed that piR-26681 expression is significantly lower in ovarian cancer tissues than in normal ovarian tissues (Fig. 1B). Additionally, piR-26681 levels were higher in primary-stage ovarian cancer compared to the advanced stage (Fig. 1C). Kaplan-Meier analysis showed that low levels of piR-26681 in patients with ovarian cancer are associated with poorer progression-free survival (PFS) (Fig. 1D).

Further, qRT-PCR studies confirmed that piR-26681 expression was lower in ovarian cancer cell lines compared to normal ovarian cell lines (IOSE-80), with the lowest expression observed in CAOV3 cells and the highest in OVCAR3 cells (Fig. 1E). Consequently, our forthcoming experiments will be conducted in CAOV3 and OVCAR3 cells.

2.2 Overexpression of piR-26681 inhibited the malignant biological behavior of ovarian cancer cells

To examine the physiological impacts of piR-26681 on ovarian cancer, we upregulated its expression in CAOV3 and OVCAR3 cells using the mimic technique and subsequently assessed its biological properties. qRT-PCR was used to validate the transfection efficiency of cells transfected with mimic (Fig. 1F, 1G). A series of assays, including CCK8, plate clone, EdU incorporation assay, apoptosis, wound healing, and transwell assays, were conducted to evaluate the impact of piR-26681 on the proliferation, apoptosis, migration, and invasion of ovarian cancer cells. Overexpressing piR-26681 resulted in the suppression of malignant biological activity in ovarian cancer cells, including proliferative ability as observed in CCK8 assay (Fig. 1H, 1I), clonal formation (Fig. 1J), and the EDU test (Fig. 1K, 1L). This was also accompanied by a reduction in migration (Fig. 1M, 1N) and invasion (Fig. 1O) and an increase in cell apoptosis (Fig. 1P).

2.3 Downregulation of piR-26681 promoted the malignant biological behavior of ovarian cancer cells

To further confirm the function of piR-26681 in ovarian cancer, we down-regulated piR-26681 by transfecting sh-piR-26681 in the CAOVR3 and OVCAR3 cells. qRT-PCR was used to validate the transfection efficiency of cells transfected with sh-piR-26681 (Fig. 2A). The malignant nature of cancer cells was enhanced by interference with piR-26681 expression, as evidenced by their proliferative ability in the CCK8 assay (Figs. 2B), clonal formation (Fig. 2C), and the EDU test (Figs. 2D). Alongside this, there was an increase in invasion (Fig. 2E) and migration (Fig. 2F) and a decrease in cell apoptosis (Fig. 2G). These findings suggest the crucial role of piR-26681 in suppressing the malignant behavior of ovarian cancer cells, suggesting that its manipulation could influence the progression of the diseases.

2.4 PiR-26681 forms a bond with METTL3 and METTL14

To explore the precise mechanisms through which piR-26681 exerts its anti-cancer effects in ovarian cancer, we utilized the RBPsuite website (http://www.csbio.sjtu.edu.cn/bioinf/RBPsuite/) ¹⁹ to predict potential binding protein. PiR-26681 is likely to interact with METTL3 (score: 0.997) and METTL14 (score: 0.904). Prior research has shown that many piRNAs are involved in regulating m6A-associated genes in cancer, playing either a pro-cancer or anti-cancer role. Thus, it is crucial to investigate the relationship between pir-26681 and METTL3 and METTL14, enzymes responsible for m6A modification. The interactions of piR-26681 with METTL3 and METTL14 were further validated by RNA immunoprecipitation (RIP) and pulldown assays (Fig. 3A, 3D). Additionally, immunofluorescence tests confirmed the co-localization of piR-26681 with METTL3 and METTL14, providing visual evidence of their interaction (Fig. 3B,3E). These findings highlight the potential regulatory pathways through which piR-26681 may influence the progression of ovarian cancer.

2.5 The upregulation of piR-26681 increases the expression of METTL3 and METTL14

Previous experiments have confirmed that piR-26681 can bind to METTL3 and METTL14. To investigate further the impact of piR-26681 on the biological function of these enzymes, we manipulated piR-26681 levels in CAOV3 and OVCAR3 cells. Specifically, we increased the level of piR-26681 in CAOV3 cells and decreased it in OVCAR3 cells. The result showed that overexpression of piR-26681 in CAOV3 cells led to an up-regulation of METTL3 and METTL14 expression. Conversely, suppressing piR-26681 expression in OVCAR3 cells resulted in a down-regulation of these enzymes. These findings suggest that piR-26681 directly influences the expression levels of METTL3 and METTL14, which may contribute to its effects on ovarian cancer cell behavior (Fig. 3C, 3F).

2.6 Simultaneous knockdown of METTL3 and METTL14 inhibits ovarian cancer development

Previous research indicates that METTL3 acts as a stimulator in ovarian cancer ²⁰, whereas METTL14 has an anti-cancer function in various cancers, including ovarian cancer ^21,22. The finding that piR-26681 suppresses ovarian cancer while increasing the expression of both METTL3 and METTL14 presents an apparent contradiction. Yang et al. reported that the simultaneous knockdown of METTL3 and METTL14 increased cell proliferation and invasion ²³. We conducted separate and combined knockdowns of METTL3 and METTL14 in CAOV3 and OVCAR3 cells to further investigate these effects. The results revealed that knocking down METTL3 alone inhibited cell growth, whereas suppression of METTL14 alone and concurrent suppression of both METTL3 and METTL14 enhanced cell growth, as evidenced by the CCK-8 test and plate cloning experiment (Fig. 3G,3H). Likewise, as METTL3 was knocked down, cell migration decreased, METTL14 was knocked down, and both genes were knocked down together, increasing cell migration. (Fig. 3I,3K). Additionally, Transwell experiment results demonstrated that inhibiting METTL3 reduced the invasion of ovarian cancer cells. In contrast, knocking down METTL14, as well as both METTL3 and METTL14 together, enhanced invasion (Fig. 3J, 3L). Furthermore, cell apoptosis was observed to increase following METTL3 knockdown, while a decrease was noted following METTL14 knockdown and when both genes were knocked down simultaneously (Fig. 3M, 3N).

These findings highlight the complex role that METTL3 and METTL14 play in ovarian cancer progression and underscore the need for nuanced approaches to targeting these enzymes in cancer therapy.

2.7 PiR-26681 improves the protein stability of METTL3 and METTL14 and facilitates their binding

The catalytic functions of methyltransferases, such as their ability to bind to target RNA and transfer methyl groups, are largely contingent upon the formation of a stable METTL3-METTL14 heterodimer, as demonstrated in previous studies ^24,25. METTL3 and METTL14 typically function as heterodimers ²⁴. The co-localization of piR-26681 with METTL3 and METTL14 was observed in an immunofluorescence experiment (Fig. 4A).

To further analyze these interactions, we utilized ZDOCK 3.0.2 software to forecast the binding sites of piR-26681 on the METTL3-METTL14 protein complexes ²⁶( Fig. 4B). The interaction score between piR-26681 and the METTL3-METTL14 heterodimer was significant, at scored as 1071.365. ZDOCK 3.0.2 prediction helped us to determine the binding pattern of piR-26681 with the METTL3-METTL14 complex, showing METTL14 in green and METTL3 in magenta. PiR-26681 is illustrated in yellow, and the yellow dashed line signifies hydrogen bonding. This visualization shows piR-26681 binding between two proteins and interacting with both simultaneously. Hydrogen bonding plays a crucial role in these interactions. For example, residues A-23, A-6, and T-22 on piR-26681 from hydrogen bonds with S299, R298, and P402 on the METTL14 proteins, respectively. Additionally, T-22, A-5, C-8, and G-20 on piR-26681 interact through hydrogen bonding with T-9, C-10, T-19, R471, H400, E403, E481, K459, Q462, T469, and H474 on the METTL3 protein. These interactions highlight the complex molecular interplay between piR-26681 and the METTL3-METTL14 complex, suggesting a potential mechanism by which piR-26881 may influence the methylation landscape in ovarian cancer cells.

The anticipated binding location of amino acid R298 on METTL14 is crucial for the activity of the heterodimer complex it forms with METTL3. Additionally, amino acids Q462, T469, and H474 on METTL13 are involved in the formation of an interfacial loop that interacts with METTL14 ²⁷. These structural details provide strong evidence that piR-26681 influences the interaction between METTL3 and METTL14. Our co-immunoprecipitation (Co-IP) test revealed that overexpression of piR-26681 led to an increase in the binding affinity between METTL3 and METTL14. Conversely, knocking down piR-26681 resulted in a decreased interaction between these proteins (Fig. 4C). These findings suggest that piR-26681 plays a significant role in regulating the interaction between METTL3 and METTL14, potentially affecting the function of their heterodimer complex.

Furthermore, the interplay between METTL13 and METTL14 contributes to the stability of each other’s proteins ²⁸. Wang et al. demonstrated that the binding of METTL3 to METTL14 not only enhances the stability of METTL14 protein but also protects it from degradation²⁹. Based on these observations, we speculate that piR-26681 not only promotes the binding between METTL3 and METTL14 but also increases their protein stability. To test this hypothesis, we conducted cycloheximide (CHX) chase experiments and MG132 treatments to assess the effect on protein stability. Our results demonstrated that overexpression of piR-26681 enhances the stability of the METTL3 protein (Fig. 4D, 4E). Similarly, there was a notable increase in the stability of METTL14 protein following piR-26681 overexpressing (Fig. 4G, 4H). Conversely, interference with piR-26681 expression resulted in decreased stability of both METTL3 and METTL14 protein (Fig. 4F, 4I).

2.8 Analysis of the m6A methylome and downstream targets of piR-26681 in ovarian cancer

The immunostaining data showed that the global m6A levels are increased in CAOV3 cells overexpressing piR-26681, a finding that is corroborated by the m6A dot blot assay (Fig. 4J). Conversely, in OVCAR3 cells, m6A levels decreased when piR-26681 expression was inhibited (Fig. 4K). The observation that cells with overexpressed piR-26681 exhibit higher levels of m6A suggests that piR-26681 may improve m6A methylation. This enhancement could play a crucial role in regulating gene expression and various cellular processes, highlighting the potential mechanistic impact of piR-26681 on cellular processes.

To clarify the molecular mechanisms by which piR-26681 influences m6A modifications, we conducted m6A methylation RNA immunoprecipitation sequencing (MeRIP-seq) on both control and piR-26681-overexpressing CAOV3 cells. The analysis of m6A peaks showed that the consensus motif GGAC was notably enriched in the immune-purified RNA (Fig. 3L). Additionally, MeRIP-seq confirmed an increase in mRNA m6A peaks in the piR-26681 overexpression group (Fig. 4M).

Analysis of all differentially methylated genes showed significant enrichment in Gene Ontology (GO) pathways, with the top two pathways being cadherin binding and cell adhesion molecule binding (Fig. 4N). Notably, METTL14 emerged as one of the top 10 genes with increased levels of m6A modification. Among the genes exhibiting high m6A modifications, FBXO16 showed the most significant fold change in differential expression (Fig. 4O). Consequently, METTL14 and FBXO16 were selected as the focal points of our investigation. Specifically, the m6A modification site of METTL14 was identified in the 3’UTR area (Fig. 4P), while the m6A modification sites of FBXO16 were identified in the CDS area (Fig. 4Q).

2.9 PiR-26681 promotes METLL3-METTL14 mediated m6A methylation of METTL14 and FBXO16 mRNA and increases their stability through the IGF2BP2 reader

Upregulation of piR-26681 was found to elevate mRNA levels and improve RNA stability in METTL14 and FBXO16(Fig. 5A,5C). In contrast, blocking piR-26681 reduced both the quantity of RNA and the stability of these genes (Fig. 5B,5D). Moreover, overexpression of piR-26681 led to an increase in FBXO16 protein levels, whereas suppression of piR-26681 resulted in a decrease in FBXO16 protein levels (Fig. 5E,5F).

IGF2BP2, a known m6A reader protein, binds to and stabilizes m6A-modified RNAs ³⁰. Prediction tools from the RBP binding prediction site indicated that IGBF2BP2 would bind to the m6A modification sites identified on METTL14 and FBXO16 ¹⁹³¹. Subsequent RIP experiments confirmed that IGF2BP2 significantly enriches the RNA of both METTL14 and FBXO16 (Fig. 5G). Knockdown of IGF2BP2 in CAOV3 cells overexpressing piR-26681 resulted in reduced stability of METTL14 and FBXO16 mRNAs (Fig. 5H), as well as decreased protein level of genes (Fig. 5I). Meanwhile, knocking down METTL3 and METTL14 reduced FBXO16 protein levels in cells overexpressing piR-26681 (Fig. 5J). Additionally, suppressing IGF2BP2 in these cells neglected the cancer-suppressing impact of piR-26681(Fig. 5K,5L,5M, 5N).

2.10 PiR-26681 downregulated Beta-Catenin and suppressed WNT and EMT pathway by increasing FBXO16 expression

Previous experiments have demonstrated that piR-26681 increases the m6A modification of FBXO16 mRNA through the METTL3-METTL14 complex, leading to increased FBXO16 expression. As an E3 ubiquitin ligase, FBXO16 acts as a tumor suppressor in ovarian cancer, with high levels of FBXO16 expression correlating with a better prognosis ³². Additionally, FBXO16 promotes nuclear β-catenin degradation, which suppresses Wnt signaling and inhibits the epithelial-to-mesenchymal transition (EMT) by reducing the amount of β-catenin ³³³⁴.

To investigate the effects of piR-26681 on β-catenin, we analyzed protein levels following the overexpression or knockdown of piR-26681. Overexpression of piR-26681 resulted in a decrease in β-catenin levels, mainly in the nucleus, whereas knockdown of piR-26681 resulted in increased β-catenin levels (Fig. 5O). We also assessed the expression of EMT markers in the presence of piR-26681. Cells overexpressing piR-26681 showed increased E-cadherin expression and decreased N-cadherin and vimentin levels. Conversely, the knockdown of piR-26681 led to the opposite effects (Fig. 5P). Further studies into the downstream targets of β-catenin in the Wnt pathway, such as cyclin D1 and C-Myc, revealed that these proteins were decreased in cells overexpressing piR-26681 and increased in which piR-26681 was knocked down (Fig. 5Q).

2.11 Knockdown of FBXO16 or concurrent knockdown of METTL3 and METTL14 rescues the cancer suppression function of piR-26681

In addition, we explored the impact of inhibiting FBXO16 or concurrently knocking down METTL3 and METTL14 in cells that overexpressed piR-26681. We observed that these manipulations suppressed the cancer-inhibitory impacts of piR-26681 (Fig. 6A-H). Specifically, the depletion of FBXO16 or IGF2BP2, or the simultaneous depletion of METTL3 and METTL14, in CAOV3 cells that overexpressed piR-26681 resulted in elevated levels of N-cadherin and vimentin proteins and decreased levels of E-cadherin protein. This indicates an up-regulation of the EMT pathway, which is blocked by piR-26681(Figure S1A). In addition, the knockdown of FBXO16 or IGF2BP2 or depletion of METTL3 and METTL14 also reduced inhibition of the WNT pathways in cells overexpressing piR-26681 (Figure S1B). These results suggest that FBXO16, METTL3, METTL14, and IGF2BP2 are crucial in how piR-26681 stops cancer from growing. In summary, piR-26681 increases the m6a modification of FBXO16 by stabilizing the METTL3-METTL14 methyltransferase complex, which in turn blocks the WNT and EMT pathways.

2.12 PiR-26681 as a promising agent in ovarian cancer

Previous experiments showed the potent cancer-inhibiting effect of piR-26681. For in vivo validation, we upregulated piR-26681 using agopiR-26681 in xenograft models and OC-PDOs. We created xenograft ovarian cancer models using OVCA3 cells to evaluate the impact of piR-26681 on ovarian cancer progression in vivo (Fig. 7A). Treatment with agopiR-26681 resulted in a significant reduction in tumor volume compared to the control group (Fig. 7B, 7C). Western blot and immunohistochemistry analysis of tumor tissue collected from nude mice further showed an increase in METTL3, METTL14, and FBXO16 proteins (Fig. 7D-F).

Consistent with the in vivo tumor model results, treatment with agopiR-26681 in OC-PDOs also reduced organoid diameter compared to the control group (Fig. 7H). These findings indicated that piR-26681 is a promising therapeutic target for ovarian cancer.

Ovarian cancer accounts for 2.5% of all malignancies among females but represents 5% of female cancer deaths due to its low survival rates, largely driven by late-stage diagnoses ⁶. The disease often presents with vague or subtle symptoms, such as bloating, abdominal discomfort, pelvic pain, and changes in urinary habits, which can easily be mistaken for less serious conditions. Consequently, diagnosis frequently occurs at advanced stages when the cancer has already spread beyond the ovaries. Ovarian cancer cells tend to metastasize from the original tumor site to other organs within the abdominal cavity and to more distant areas such as the liver, lungs, and lymph nodes. This metastatic spread significantly limits treatment options and worsens the prognosis.

According to the 2024 NCCN guidelines, staging is pivotal in determining treatment strategies. For instance, patients with stage IA-IIA are recommended to undergo primary cytoreduction to achieve maximum removal of all pelvic diseases and to evaluate for potential disease in the upper abdomen or retroperitoneum. Patients with stages greater than IIB should receive primary debulking surgery (PDS). Early detection and targeted interventions are essential to mitigate the devastating impact of ovarian cancer and improve patient outcomes. Our investigation revealed that piR-26681 is lowly expressed in ovarian cancer patients, particularly in those at advanced stages of the disease. Additionally, we discovered that piR-26681 significantly inhibits cancer invasion and proliferation by reducing activity in the EMT and Wnt signaling pathways (Fig. 8). These findings suggest that piR-26681 could serve as a potential therapeutic target for ovarian cancer, offering new hope for patients battling this aggressive disease.

In recent years, the field of cancer research has been energized by groundbreaking discoveries regarding the dysregulation of m6A modification machinery—comprising writers, erasers, and readers—which plays a significant role in tumorigenesis and cancer progression ³⁵. N6-methyladenosine (m6A) is recognized as the predominant chemical modification of eukaryotic messenger RNA (mRNA), influencing several fundamental bioprocesses through the regulation of gene expression ³⁶. This dysregulation has been linked to various types of cancer, highlighting its potential as a therapeutic target ³⁷. The discovery and exploration of m6A RNA modification have ushered in new avenues for cancer therapeutics ³⁵. Notably, piRNAs, a class of small non-coding RNAs, have been shown to interact with m6A-associated genes in roles that can either promote or inhibit cancer. For example, piRNA-14633 is known to bind selectively to the 3’ UTR of METTL14, enhancing m6A RNA methylation and encouraging the development of cervical cancer ³⁸. These findings suggest that exploring the interaction between piRNAs and m6a-related genes could lead to the identification of new therapeutic targets. Gaining insight into the function of m6A in the progression of cancer could potentially result in novel therapeutic tactics and individualized medical methodologies. However, the precise involvement of m6A methylation in the advancement of ovarian cancer remains to be clearly defined, culminating in a need for further research in this area.

Our study revealed an interaction between piR-26681 and the METTL3 and METTL14 proteins, which are crucial for forming the m6A methyltransferase complex and subsequent regulation of RNA modification. In our research, piR-26681 has been recognized for its potent anti-cancer properties, but our findings surprisingly suggest that it may simultaneously increase the levels of the oncogene METTL3 and the tumor suppressor METTL14 in ovarian cancer. Research conducted by Yang and others showed that blocking both METTL3 and METTL14 simultaneously can improve cell growth and invasion in endometriosis, underscoring the complex roles these proteins play in cellular phenotypes ²³. To further explore these dynamics, we silenced METTL3 and METTL14, both individually and concurrently, in CAOV3 and OVCAR3 ovarian cancer cell lines. Our results showed that while METTL3 depletion inhibits cancer cell growth, inhibiting METTL14 or both proteins together promotes it. These findings suggest that the anti-cancer effect of the METTL3-METTL14 complex outweighs the pro-cancer effect of METTL3. These findings emphasize the importance of not focusing only on METTL3 or METTL14 in future studies but considering both proteins together as a complex to understand their impact on pathogenesis. This comprehensive approach could provide valuable insights into potential therapeutic strategies targeting the METTL3 and METTL14 complexes in cancer treatment.

Further investigation observed that overexpression of piR-26681 increases the protein levels of METTL3 and METTL14 and improves their stability and interaction. The positively charged region required for RNA binding is located on METTL3 between amino acids 465–478, while amino acids 297–299 on METTL14 are associated with RNA binding²⁷. Notably, the R298P mutation in METTL14 affects its target recognition for m6A modification, altering gene expression patterns and influencing cell growth. The heterozygous R298P mutation promotes cancer cell proliferation, whereas the homozygous mutation reduces it ³⁹. Given these complexities, we argue that piR-26681 may affect the ability of the METTL3-METTL14 complex to identify or bind RNA, potentially skewing the complex toward identifying tumor-suppressing genes.

The proteins METTL3 and METTL14 play a crucial role in the process of m6A modification, typically functioning as complexes. However, their roles in various cancers have given rise to contradictory results, with METTL3 often acting as a cancer-promoting factor ^40,41, while METTL14 usually plays a role as a cancer suppressor ^21,42,43. Liu et al. explored these dynamics in hepatocellular carcinoma (HCC) and observed that the knocking down of these proteins led to the dysregulation of different mRNAs, signaling pathways, and biological processes. They observed that Some m6A-modified translational efficiency genes (TEGS) regulated by METTL14 also regulate cell cycle and protein ubiquitination in collaboration with TEGs regulated by METTL3, which suggests that METTL3 and METTL14 have synergistic effects ²³. Further investigation into other disorders also highlights the combined functionality of METTL3 and METTL14. Feng et al. demonstrated that inhibiting both proteins effectively reduced LPS-induced m6A hypermethylation and activation of Kupffer cells, effectively evidenced by a decrease in the LPS response in transforming growth factor-β1 (TGF-β1) production ⁴⁴.

Our research confirmed, through MeRIP Seq sequencing, that overexpression of piR-26681 significantly increased the number of the number of mRNA m6A peaks across the entire genome. All identified genes were enriched in Gene Ontology pathways, particularly in cadherin binding and cell adhesion molecule binding, suggestive of the ability of piR-26681 to regulate gene expression through m6A modification, potentially influencing cancer metastasis. Notably, METTL14 was among the top 10 genes showing elevated m6a modification levels.

FBXO16 exhibited the most significant fold change in differential expression among genes with strong m6A mutations. Test on RNA stability demonstrated that piR-26681 enhances the stability of RNA in both METTL14 and FBXO16. Higher levels of FBXO16 expression are associated with better prognoses in individuals ³². FBXO16, as an E3 ubiquitin ligase and tumor suppressor, promotes nuclear β-catenin degradation ³³³⁴. Our results also showed that overexpression of piR-26681 led to decreased β-catenin protein levels in the nucleus and altered expression of EMT and WNT pathway proteins. The EMT pathway refers to the process in which epithelial cells transform, losing their original surface markers and acquiring the features of mesenchymal cells. This transformation enables tumors to detach from their initial site and disseminate to faraway places⁴⁵. WNT/β-catenin is involved in multiple aspects of cell cycle progression⁴⁶. The EMT and WNT pathways are both significant contributors to the development of ovarian cancer.

Despite piR-26681’s efficacy as a therapeutic target, RNA therapeutics grapple with challenges in clinical success due to issues with delivery systems. Efforts to improve stability and efficacy include chemical modifications and novel delivery methods. However, such chemical modifications could increase the risk of off-target effects by altering their structure, folding, biological activity, and safety of synthesized RNA molecules ^47,48. Nanodelivery technologies, utilizing natural compounds like gelatin, chitosan, and polyphenols, have shown the potential to decrease drug toxicity, enhance bioavailability, and provide tailored drug delivery ⁴⁹. The combination of piR-26681 with a nano-delivery system is promising and could revolutionize treatment options for ovarian cancer by improving drug efficacy and reducing side effects. Further research and clinical trials are needed to fully explore the benefits of integrating piR-26681 with these innovative delivery technologies in the treatment of ovarian cancer.

4.1 Ovarian cancer specimens

We collected 19 cases of normal ovary tissues and 85 cases of ovarian cancer tissues from patients undergoing gynecological surgery at the Third Affiliated Hospital of Guangzhou Medical University. Informed consent was obtained from all subjects involved in the research. All specimens were treated and anonymous according to ethical and legal standards.

4.2 Cell culture and transfection

Human ovarian cancer cell lines A2780, CAOV3, HO8910, OVCAR3, SKOV3, and IOSE-80 were acquired from Jennio Biotech (Guangzhou, China) and ATCC (Manassas, VA, USA). All media were supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin (100 U/mL). The cells were incubated at 37°C in a 5% CO₂ atmosphere. For transfection purposes, Lipofectamine 2000 was used according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA, USA). The piR-26681 mimic, si-METTL14, si-METTL3, si-IGF2BP2, si-FBXO16, and the negative control were synthesized by Ribobio (Guangzhou, China). Additionally, the short hairpin (sh) RNA for piR-26681 was designed and synthesized by Han Heng Company (China).

4.3 Cell proliferation, migration, invasion assays, and Flow cytometry analysis of apoptosis

Cell growth was detected using CCK-8 assays and EDU. The abilities to migrate and invade were assessed through scratch assays and Transwell invasion assays, respectively. Apoptosis was detected by Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) double staining. All these assays were conducted as previously reported ⁵⁰.

4.4 Real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR)

TRIZOL was used to extract the total RNA from cells or tissues, followed by the generation of endogenous complementary DNA using a Fast Reverse Transcription Kit. The cDNA served as a template for qRT-PCR, which was performed using the QuantStudio 3 (Thermo). The relative expression of the gene was calculated by comparing the cycle threshold (Ct) value of the target gene with that of the control gene (U6) using the 2 − ΔCt method. The probe sequence is available in the supplementary file.

4.5 RNA Immunoprecipitation (RIP)

Briefly, cells were lysed using RIP lysis buffer, where an RNA inhibitor and protease were contained. The supernatant from the cell lysate was collected and incubated with antibody-conjugated beads at four °C overnight. Subsequently, the binding complexes were washed, purified, and analyzed by qRT-PCR.

4.6 Fluorescence In Situ Hybridization (FISH)

The reverse probe for piR-26681 (GUGAGUUAGCAGUUCUUGUGAGCUUUCUC) was synthesized by Sangon Biotech. Subsequently, Fluorescent In Situ Hybridization (FISH) experiments were conducted using a FISH Kit from RIBOBIO, following the manufacturer’s protocol.

4,7 RNA stability test

After transfection with an overexpressed piR-26681 plasmid, CAOV3 and OVCAR3 cells were treated with 5 µg/ml actinomycin D (ActD, CAS# S8964, Selleck). Total RNA was extracted from the cells at 0, 2, 4, 6, and 8 hours after the addition of actinomycin D. The extracted RNA was then analyzed using qRT-PCR.

4.8 Western-blot analysis

Proteins were extracted using RIPA lysate (Beyotime) or Nuclear and Cytoplasmic Protein Extraction Kit (Beyotime), and protein concentrations were measured with a BCA protein assay kit (Beyotime). Protein (30ug) was pipetted into an SDS-PAGE gel and subsequently transferred to a PVDF membrane. The membranes were blocked and incubated with primary antibodies, such as METTL3, METTL14, ZENBIO), Cyclin D1, C-Myc, E-cadherin, N-cadherin, vimentin, beta-actin, and GAPDH (Proteintec) and FBXO16 (Zenbio). After three washes with TBST, the membranes were incubated with appropriate anti-rabbit/mouse secondary antibodies at room temperature for 2 hours. Imaging was performed using equipment from BIORAD.

4.9 RNA pulldown assay

Bioprobes, including BIO-NC (UUGUACYACACAAAAGUACUG) and PiR-26681 (GAGAAAGCTCACAAGAACTGCTAACTCAC), were synthesized by Sangon company. Subsequently, pulldown experiments were performed using an RNA pulldown kit from BersinBio, following the company’s protocol.

4.10 MeRIP-seq

Total RNA was extracted using TRIzol. Subsequently, 10µg total RNA was fragmented into 100–200 nt RNA fragments using 10X RNA Fragmentation Buffer (100 mM Tris-HCl, 100 mM ZnCl₂ in nuclease-free H₂O). The fragmentation reaction was stopped by adding 10X EDTA (0.5M EDTA). Methylated RNA immunoprecipitation was performed using an EpiTM m6A immunoprecipitation kit (Epibiotek, R1804). The m6A-enriched RNA was purified using TRIzol™ Reagent (Invitrogen, 15596018). Libraries for sequencing were prepared using the Smart-seq method. Both the input samples without IP and the m6A IP samples underwent 150-bp, paired-end sequencing on an Illumina NovaSeq 6000 sequencer.

4.11 m6A dot blot

Poly(A) RNA was purified from total cellular RNA using the Dynabeads mRNA Purification Kit (ThermoFisher). The purified Poly(A) RNA was denatured at 95°C for 3 minutes and subsequently spotted onto a nylon membrane. The membrane was then subjected to UV crosslinking at 254 nm, 0.12 J/cm². After blocking in PBS with Tween 20 containing 5% bovine skimmed milk for 1 hour, the membrane was incubated with an anti-m6A antibody (2 ug/ml, Proteintech) followed by an anti-mouse IgG secondary antibody. Visualization was performed using a BIO-RAD Imaging System. Subsequently, the same poly(A) RNA was again spotted on a separate section of the membrane, which was then stained with 0.02% methylene blue in 0.3 M sodium acetate (pH 5.2) for 1 hour. The membrane was washed with TBST for 1 hour to remove excess stain.

4.12 In vivo tumor xenograft model

In a separate experiment, OVCAR3 cells (5 × 106 in 150 µL FBS-free medium) were injected subcutaneously into 5-week-old female mice (n = 12). After the tumor volume reached 100mm³, the mice were randomly divided into two treatment groups. Each group received subcutaneous injections of either 250 mg/kg/week AgopiR-26681 or PBS for 18 days. The conduct of these animal experiments adhered to the Guide for the Care and Use of Laboratory Animals, published by the National Institute of Health. All animal experiments were approved and conducted by Guangdong Medical Laboratory Animal Center (Approval No. B202208-8).

4.13 PDO models and AGO treatment

Ovarian cancer tissues were sectioned into 1-3-mm³ pieces and digested for 30 min in TrypLE (12604013, Thermo Fisher Scientific). Subsequently, a mixture of 40% complete medium and 60% Matrigel was used to support the organoid culture. Next, 20 µL droplets of this mixture were placed in pre-heated 48-well plates (Corning dishes). The organoids were passaged every 10–15 days. To the medium, 50 nmol/L AgopiR-26681 was added, and the organoids were co-incubated for either 6 days. To visualize organoid proliferation, images were captured using an inverted microscope at 4×magnifcation.

4.14 Data analysis

GraphPad Prism (version 9.5.0) was used for graphics generation and data analysis. The Kaplan–Meier curve was drawn by https://www.bioinformatics.com.cn, an online platform for data analysis and visualization. All experiments were performed at least three times. The data were expressed as the mean ± standard error of the mean. Statistical analysis was conducted using a two-sample t-test, and a p-value of < 0.05 was considered to indicate a significant difference.

Acknowledgments

I would like to acknowledge my teammates for their wonderful collaboration. Many thanks to the FIGDRAW website for their help during the production process of Figure.

Authors' Contributions

Jie-Lin Wang: Writing – review & editing, Writing – original draft, Methodology, Investigation, Formal analysis, Conceptualization. Qing-Hua Wu: Writing – review & editing, Writing – original draft, Methodology, Investigation. Jing Yuan: Software, Investigation, Formal analysis, Data curation. Hai-Juan Bao: Writing – review & editing, Investigation. Xiang-Chun Huang: Writing – review & editing, Investigation. Yang Han: Writing – review & editing, Methodology, Investigation. Yu-Meng Ji: Investigation, Formal analysis. Jia-Chen Cheng: Writing – review & editing, software. Shuo Chen: Writing – review & editing, Writing – original draft, Supervision, Resources, Project administration, Methodology, Funding acquisition, Formal analysis, Conceptualization.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 82272985 to Shuo Chen;). Natural Science Foundation of Guangdong Province [No. 2022A1515012293].

Ethics approval and consent to participate

The Ethics Committee of Guangzhou Medical University (No: 2021-055) approved the use of human tissue in this study. All animal experiments were approved and conducted by Guangdong Medical Laboratory Animal Center (Approval No. B202208-8). We conformed with the Helsinki Declaration of 1975 (as revised in 2008) concerning Human and Animal Rights.

Data availability statements

All data needed to evaluate the conclusions in the paper are presented in the paper. The resources, tools, and codes used in our analyses were described in the methods section. For any further data requests, please contact the corresponding author.

Competing interests

The authors declare that they have no conflict of interest.

1Armstrong, D.K., et al.: NCCN Guidelines® Insights: Ovarian Cancer, Version 3.2022. J NATL COMPR CANC NE 20 972 (2022)
2Gaona-Luviano, P., Medina-Gaona, L.A., Magaña-Pérez, K.: Epidemiology of ovarian cancer. CHIN CLIN ONCOL 9 47 (2020)
3Lavoue, V., et al.: Management of epithelial cancer of the ovary, fallopian tube, and primary peritoneum. Long text of the Joint French Clinical Practice Guidelines issued by FRANCOGYN, CNGOF, SFOG, and GINECO-ARCAGY, and endorsed by INCa. Part 1: Diagnostic exploration and staging, surgery, perioperative care, and pathology. J Gynecol Obstet Hum Reprod 48 369 (2019)
4Kuroki, L., Guntupalli, S.R.: Treatment of epithelial ovarian cancer. BMJ-BRIT MED J 371 m3773 (2020)
5Gonzalez-Martin, A., et al.: Niraparib in Patients with Newly Diagnosed Advanced Ovarian Cancer. NEW ENGL J MED 381 2391 (2019)
6Torre, L.A., et al.: Ovarian cancer statistics, 2018. CA-CANCER J CLIN 68 284 (2018)
7Gardner, G.J., Chi, D.S.: Recurrent Ovarian Cancer - Sculpting a Promising Future with Surgery. NEW ENGL J MED 385 2187 (2021)
8Falandry, C., Freyer, G., Pujade-Lauraine, E.: What Is the Optimal Treatment for Vulnerable Older Women With Ovarian Cancer?-Reply. JAMA ONCOL 7 1727 (2021)
9Kurian, A.W., et al.: Association of Genetic Testing Results With Mortality Among Women With Breast Cancer or Ovarian Cancer. JNCI-J NATL CANCER I 114 245 (2022)
10Matz, M., et al.: Worldwide comparison of ovarian cancer survival: Histological group and stage at diagnosis (CONCORD-2). GYNECOL ONCOL 144 396 (2017)
11Anguela, X.M., High, K.A.: Entering the Modern Era of Gene Therapy. ANNU REV MED 70 273 (2019)
12Aravin, A., et al.: A novel class of small RNAs bind to MILI protein in mouse testes. NATURE 442 203 (2006)
13Lau, N.C., et al.: Characterization of the piRNA complex from rat testes. SCIENCE 313 363 (2006)
14Czech, B., et al.: piRNA-Guided Genome Defense: From Biogenesis to Silencing. ANNU REV GENET 52 131 (2018)
15Gainetdinov, I., Colpan, C., Arif, A., Cecchini, K., Zamore, P.D.: A Single Mechanism of Biogenesis, Initiated and Directed by PIWI Proteins, Explains piRNA Production in Most Animals. MOL CELL 71 775 (2018)
16Liu, Y., et al.: The emerging role of the piRNA/piwi complex in cancer. MOL CANCER 18 123 (2019)
17Grönholm, M., et al.: Patient-Derived Organoids for Precision Cancer Immunotherapy. CANCER RES 81 3149 (2021)
18Yoshida, G.J.: Applications of patient-derived tumor xenograft models and tumor organoids. J HEMATOL ONCOL 13 4 (2020)
19Pan, X., Fang, Y., Li, X., Yang, Y., Shen, H.B.: RBPsuite: RNA-protein binding sites prediction suite based on deep learning. BMC GENOMICS 21 884 (2020)
20Chen, J., Fang, Y., Xu, Y., Sun, H.: Role of m6A modification in female infertility and reproductive system diseases. INT J BIOL SCI 18 3592 (2022)
21Guan, Q., et al.: Functions, mechanisms, and therapeutic implications of METTL14 in human cancer. J HEMATOL ONCOL 15 13 (2022)
22Li, Y., et al.: Downregulation of Methyltransferase-Like 14 Promotes Ovarian Cancer Cell Proliferation Through Stabilizing TROAP mRNA. FRONT ONCOL 12 824258 (2022)
23Shen, L., Zhang, C., Zhang, Y., Yang, Y.: METTL3 and METTL14-mediated N(6)-methyladenosine modification promotes cell proliferation and invasion in a model of endometriosis. REPROD BIOMED ONLINE 46 255 (2023)
24Liu, J., et al.: A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. NAT CHEM BIOL 10 93 (2014)
25Xu, Y., et al.: Novel insights into the METTL3-METTL14 complex in musculoskeletal diseases. CELL DEATH DISCOV 9 170 (2023)
26Pierce, B.G., Hourai, Y., Weng, Z.: Accelerating protein docking in ZDOCK using an advanced 3D convolution library. PLOS ONE 6 e24657 (2011)
27Wang, X., et al.: Structural basis of N(6)-adenosine methylation by the METTL3-METTL14 complex. NATURE 534 575 (2016)
28Wang, Y., et al.: N6-methyladenosine modification destabilizes developmental regulators in embryonic stem cells. NAT CELL BIOL 16 191 (2014)
29Zeng, Z.C., et al.: METTL3 protects METTL14 from STUB1-mediated degradation to maintain m(6) A homeostasis. EMBO REP 24 e55762 (2023)
30Wang, J., Chen, L., Qiang, P.: The role of IGF2BP2, an m6A reader gene, in human metabolic diseases and cancers. CANCER CELL INT 21 99 (2021)
31Li, J., Liu, S., Zhou, H., Qu, L., Yang, J.: starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein–RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids ResearchNucleic Acids Research 42 D92 (2013)
32Ji, M., et al.: FBXO16-mediated hnRNPL ubiquitination and degradation plays a tumor suppressor role in ovarian cancer. CELL DEATH DIS 12 758 (2021)
33Khan, M., Muzumdar, D., Shiras, A.: Attenuation of Tumor Suppressive Function of FBXO16 Ubiquitin Ligase Activates Wnt Signaling In Glioblastoma. NEOPLASIA 21 106 (2019)
34Paul, D., et al.: F-box protein FBXO16 functions as a tumor suppressor by attenuating nuclear β-catenin function. J PATHOL 248 266 (2019)
35He, P.C., He, C.: m(6) A RNA methylation: from mechanisms to therapeutic potential. EMBO J 40 e105977 (2021)
36Liu, N., Pan, T.: N6-methyladenosine–encoded epitranscriptomics. NAT STRUCT MOL BIOL 23 98 (2016)
37He, L., et al.: Functions of N6-methyladenosine and its role in cancer. MOL CANCER 18 176 (2019)
38Xie, Q., et al.: piRNA-14633 promotes cervical cancer cell malignancy in a METTL14-dependent m6A RNA methylation manner. J TRANSL MED 20 51 (2022)
39Miyake, K., et al.: A cancer-associated METTL14 mutation induces aberrant m6A modification, affecting tumor growth. CELL REP 42 112688 (2023)
40Jin, Q., Qu, H., Quan, C.: New insights into the regulation of METTL3 and its role in tumors. CELL COMMUN SIGNAL 21 334 (2023)
41Zeng, C., Huang, W., Li, Y., Weng, H.: Roles of METTL3 in cancer: mechanisms and therapeutic targeting. J HEMATOL ONCOL 13 117 (2020)
42Chen, X., et al.: METTL14-mediated N6-methyladenosine modification of SOX4 mRNA inhibits tumor metastasis in colorectal cancer. MOL CANCER 19 106 (2020)
43Ma, J.Z., et al.: METTL14 suppresses the metastatic potential of hepatocellular carcinoma by modulating N(6) -methyladenosine-dependent primary MicroRNA processing. HEPATOLOGY 65 529 (2017)
44Feng, Y., et al.: METTL3/METTL14 Transactivation and m(6)A-Dependent TGF-β1 Translation in Activated Kupffer Cells. CELL MOL GASTROENTER 12 839 (2021)
45Xu, X., et al.: FSH induces EMT in ovarian cancer via ALKBH5-regulated Snail m6A demethylation. THERANOSTICS 14 2151 (2024)
46Fischer, M.M., et al.: WNT antagonists exhibit unique combinatorial antitumor activity with taxanes by potentiating mitotic cell death. SCI ADV 3 e1700090 (2017)
47Morena, F., Argentati, C., Bazzucchi, M., Emiliani, C., Martino, S.: Above the Epitranscriptome: RNA Modifications and Stem Cell Identity. GENES-BASEL 9 (2018)
48Yu, A.M., Jian, C., Yu, A.H., Tu, M.J.: RNA therapy: Are we using the right molecules? PHARMACOL THERAPEUT 196 91 (2019)
49Shui, M., et al.: Engineering polyphenol-based carriers for nucleic acid delivery. THERANOSTICS 13 3204 (2023)
50Bao, H.J., et al.: Box C/D snoRNA SNORD89 influences the occurrence and development of endometrial cancer through 2'-O-methylation modification of Bim. CELL DEATH DISCOV 8 309 (2022)

There is NO Competing Interest.

COMMSBIO244782reportingsummary.pdf
Reporting Summary
GraphicalAbstractImage.tif
OriginalWesternBlots.pdf
Supplement1.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

PiR-26681: A Promising Therapeutic Inhibitor Targeting METTL3/METTL14 Complex-Mediated FBXO16 M6A Modification and Suppressing the EMT/WNT Pathway in Ovarian Cancer

Status:

Version 1

Abstract

Figures

1. Introduction

2. RESULT

2.1 PiR-26681 is decreased in ovarian cancer and correlated with primary stage and positive patient outcomes

2.2 Overexpression of piR-26681 inhibited the malignant biological behavior of ovarian cancer cells

2.3 Downregulation of piR-26681 promoted the malignant biological behavior of ovarian cancer cells

2.4 PiR-26681 forms a bond with METTL3 and METTL14

2.5 The upregulation of piR-26681 increases the expression of METTL3 and METTL14

2.6 Simultaneous knockdown of METTL3 and METTL14 inhibits ovarian cancer development

2.7 PiR-26681 improves the protein stability of METTL3 and METTL14 and facilitates their binding

2.8 Analysis of the m6A methylome and downstream targets of piR-26681 in ovarian cancer

2.10 PiR-26681 downregulated Beta-Catenin and suppressed WNT and EMT pathway by increasing FBXO16 expression

2.12 PiR-26681 as a promising agent in ovarian cancer

3. DISCUSSION

4. Materials and methods

4.1 Ovarian cancer specimens

4.2 Cell culture and transfection

4.3 Cell proliferation, migration, invasion assays, and Flow cytometry analysis of apoptosis

4.4 Real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR)

4.5 RNA Immunoprecipitation (RIP)

4.6 Fluorescence In Situ Hybridization (FISH)

4,7 RNA stability test

4.8 Western-blot analysis

4.9 RNA pulldown assay

4.10 MeRIP-seq

4.11 m6A dot blot

4.12 In vivo tumor xenograft model

4.13 PDO models and AGO treatment

4.14 Data analysis

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1