β-tcp/collagen composite scaffolds facilitate bone remodeling in vertebral plate fusion

doi:10.21203/rs.3.rs-4873280/v1

Download PDF

Article

β-tcp/collagen composite scaffolds facilitate bone remodeling in vertebral plate fusion

https://doi.org/10.21203/rs.3.rs-4873280/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Purpose

Beta-tricalcium phosphate (β-TCP) exhibits rapid osteogenesis and poor ductility. To overcome these disadvantages, we selected β-TCP/collagen for this study.

Methods

β-TCP/collagen and β-TCP were used as experimental and control groups, respectively. MC3T3-E1 cells were co-cultured with the material, and the osteogenic ability of the cells was observed using experimental methods such as scanning electron microscopy, flow cytometry, alizarin red staining, ALP staining, RT-qPCR and Western blotting. In the animal experiment, we selected lumbar 3–4 and lumbar 4–5 vertebral plates of the kid goat for implantation of β-TCP/collagen and β-TCP materials, and observed the osteogenesis of vertebral plates at different time periods.

Results

The β-TCP/collagen have larger mesh pores, which facilitates successful cell crawling growth in in vitro experiments, generates more bone trabeculae from implant fusion in animal experiments, and permits inclusion body formation. Moreover, inclusion body formation was later in the β-TCP/collagen group than in the β-TCP group, but continued for a long period of osteogenesis, and its osteogenic fusion capacity was stronger.

Conclusions

We hypothesized that the timing of vascular emergence during bone remodeling affects the ability of autologous bone fusion and also suggested that β-TCP/collagen possess longer and stronger osteogenic capacity, making them more suitable for a wide range of clinical applications.

Health sciences/Anatomy/Musculoskeletal system/Bone

Health sciences/Medical research/Translational research

β-TCP/collagen

bone remodeling

osteogenic

fusion

inclusion body

Bone remodeling is comprised of two phases, bone formation and bone resorption, and is essential to skeletal homeostasis in adults [1–3]. Unfortunately, environmental factors such as the presence of bacteria and inflammation can alter bone tissue homeostasis and cause disruption of the "osteogenesis-osteolysis" metabolic balance, leading to bone resorption and affecting the repair and regeneration of bone tissue and bone reconstruction [4–7]. Autologous bone grafting is the mainstay for the conventional repair of bone tissue, but it has drawbacks, and it remains a major challenge to generate good replacement materials for the regenerative repair of damaged bone tissue and for their application in clinical treatment [8].

Since the beginning of the present century, bone replacement materials have been widely used in clinical disciplines such as orthopedics, dentistry, orthopedics, and brain surgery [9]. However, their ability to promote bone growth requires further investigation. Different materials have been reported to be useful as synthetic, inorganic, and biocompatible bone substitutes, which can be used as fillers to repair skeletal defects.

These materials include calcium phosphate cementum and its variants, β-tricalcium phosphate (β-TCP) ceramics, biphasic calcium phosphate, and other bone substitutes [10]. Among them, β-TCP is one of the main members of the family of bone grafting materials with good biocompatible and high osteoconductive, and therefore it is widely used in clinical practice [11]. The key to its performance lies in its structure, such as pore size, inner diameter, and porosity [12]. Moreover, its functional reconstruction and biodegradation can only be met by designing a unique porous microstructure according to the needs of bone tissue growth and resorption in vivo [14]. Although β-TCP significantly promotes the growth of new bone, it has the disadvantage of a shorter bone reconstitution time [15, 16]. Therefore, it is necessary to increase the osteogenesis time in order to utilize the osteogenic effect as early as possible.

Collagen is the main component of human bone tissue and has stabilizing properties that promote cell proliferation, differentiation and growth [17, 18]. To overcome this drawback of β-TCP, we focused on the effects of β-TCP/collagen on osteoblast proliferation in vitro and in vivo, and further investigated the effects of β-TCP/collagen composites on bone remodeling after fusion of vertebral plate implants in a large animal model (Fig. 1).

2.1 Cellular experiments

MC3T3-E1 cells were inoculated onto β-TCP/collagen composite scaffolds and β-TCP scaffolds, and the morphology of the materials and the attachment of osteoblasts were observed by scanning electron microscopy after 24 and 48 h of culture. Then the experiment with CCK-8 was carried out. MC3T3-E1 cells were then inoculated onto different scaffold materials, cultured for one, four and seven days, and detected by flow cytometry. Finally cells were cultured for 14 and 21 days and subjected to alizarin red staining, RT-qPCR and Western blotting experiments to assess the effects of the two scaffolds on the osteogenic differentiation ability of osteogenic precursor cells. (1) The primer sequences used in this study were as follows (Table 1). (2) The reaction structure is shown in Table 2.

Table 1

Primer sequences of osteogenesis-related genes
Gene	Upstream Sequence	Downstream Sequence
BMP2	TGCCCGGCACAATATCCTC	TGTCTGTGTGGGCTCAGGTATCTC
RUNX2	GAACCAAGAAGGCACAGACAA	GGCGGGACACCTACTCTCATAC
OPN	TACGACCATGAGATTGGCAGGATGTA	TATAGGATCTGGGTGCAGGCTGTA
OCN	ACCATCTTTCTGCTCACTCTGCT	CCTTATTGCCCTCCTGCTTG
ALP	TTGGGCAGGCAAGACACA	GAAGGGAAGGGATGGAGGAG
COL1	GACATGTTCAGCTTTGTGGACCTC	GGGACCCTTAGGCCATTGTGTA

Table 2

Reaction systems are as follows
Groups	Single dose
2×perfectstart SYBR Green qPCR master mix	12.5 µL
Forward primers, 10µmol/L	1 µL
Reverse Primers, 10µmol/L	1 µL
Template	2 µL
DEPC Water	8.5 µL

2.2 Experimental Animals

Thirteen 2–3 years old common grade small-tailed cold sheep were selected for implantation of dorsal artificial bone repair material in the lumbar vertebral plate. The materials were collected at 1st, 3rd and 8th months after surgery. This experiment was approved by the Ethics Committee of Ningxia Hui Autonomous Region People's Hospital (2022-NZR-159). All experiments were performed in accordance with relevant guidelines and regulations.

The specific surgical procedures were as follows:

1. After fasting and anesthesia [19, 20], the sheep were fixed on a special operating table to shave the back and waist and fix the limbs. The surgical site was sterilized with iodophor. A longitudinal incision was made in the posterior midline to expose the lumbar vertebrae 3–5 spinous processes, vertebral plates, and lesser articular processes. The β-TCP/collagen and β-TCP were then implanted, the incision was closed, and the sheep could eat and walk freely after they were awake. Samples were taken after one, three and eight months of rearing for relevant experiments[21]. Adopt the method of euthanasia to execute the animals. The specific method is as follows: select the jugular vein of the small-tailed cold sheep and inject sodium pentobarbital (75 mg per kg body weight) intravenously with a syringe rapidly, observe to make sure that the animal does not move, does not breathe, and the pupils are dilated, and then observe the animal for 5 minutes to make sure that the animal is dead.

2.3 Statistical Analysis

GraphPad Prism (version 9.0) was applied for graphing and SPSS 26.0 was used for statistical analysis. For statistics that met parametric tests, one-way analysis of variance (ANOVA) was used to assess generalized differences, and unpaired t-tests were used to assess differences between the two groups. Differences were statistically significant when P < 0.05.

3.1 Surface morphology and cell adhesion analysis and effects on MC3T3-E1 cell proliferation of β-TCP/collagen

To study the adhesion of MC3T3-E1 cells to different scaffold surfaces, scanning electron microscopy was used to observe the appearance and morphology of the adherent cells. As shown in Fig. 2A, the porous structure of the β-TCP and the cross-linked collagen on the surface of the β-TCP/collagen were visible at low magnification. Subsequently, cell adhesion to the surfaces of both scaffolds was observed under high magnification (Fig. 2B). MC3T3-E1 cells exhibited a long shuttle shape on the surface of the β-TCP, indicating a smaller cell spreading area and fewer pseudopods, whereas on the surface of the β-TCP/collagen, the cell spreading area was larger and the cells extended more pseudopods, indicating stronger cell adhesion to the material.

As shown in Fig. 2C, cell proliferation increased with increasing duration of co-culture and was significantly higher on the surface of the β-TCP/collagen than on β-TCP alone or the blank control group from the third day onwards. Cell proliferation on the β-TCP surface alone was slightly higher than in the control group, but was not statistically significant at 3rd day, increased slightly at 5th day, and the difference decreased again at 7th day. In contrast, there were no statistically significant differences between the cells treated with the scaffold extracts at any time point.

Figure 2D depicts cell apoptosis detected by flow cytometry, where apoptotic cells are the sum of cells in quadrants B2 and B4 of the flow plot. As seen from the figure, apoptosis was rare in all groups of cells at all time points, with the percentage of apoptotic cells < 5%. Regardless of whether the cells were cultured on the surface of the two scaffolds for one, four, and seven days, the apoptosis rate did not change significantly in each group, and there were no significant differences between them.

3.2 Effect of β-TCP/collagen on mineralization and osteogenic differentiation of MC3T3-E1 extracellular matrix

The effects of different scaffolds on extracellular matrix mineralization were evaluated by alizarin red and ALP staining of extracellular matrix calcium nodules at two time points. As shown in Fig. 3A and 3B, after 14 days of incubation, the number of calcium nodules in the culture dishes of all groups was low (red spots), but the number of nodules in the β-TCP/collagen group was slightly higher and had a darker appearance. Thus, the extracellular matrix of the β-TCP/collagen group already exhibited darker-colored mineralized areas at 14 days, as observed under a light microscope. Twenty-one days later, more obvious calcium nodules appeared in the culture dishes of all the groups. However, the number of calcium nodules in the β-TCP group was similar to that in the blank control group, which was lower than that in the β-TCP/collagen group. Light microscopy images showed a large number of calcium nodules in the extracellular matrix after twenty-one days. The number and aggregation of calcium nodules in both groups were significantly higher than those in the blank control group, whereas the color of the β-TCP/collagen group was darker than that of the β-TC group.

The effects of both scaffold materials on the osteogenic differentiation of MC3T3-E1 cells were analyzed by measuring the expression of osteogenic genes. Overall, the β-TCP/collagen promoted osteogenic differentiation of MC3T3-E1 cells. As shown in Fig. 3C, the expression of BMP2, ALP, and COL1 on the surface of the β-TCP/collagen was significantly higher than that in the β-TCP group or the controls on seventh day. However, the expression of RUX2, OPN, and OCN was not different. At 14 days, the expression of osteogenic differentiation-related genes in the cells of both the β-TCP/collagen and β-TCP was higher than that in the control group. Thus, the expression levels of RUX2, OPN, OCN, and COL1 in the β-TCP/collagen were significantly higher than those in the β-TCP. Figure 3D shows the western blotting results for osteogenesis-related proteins in MC3T3-E1 cells for each group, where the blank control group was labeled as the control, the β-TCP group as TCP, and the β-TCP/collagen group as collagen/TCP. Osterix was significantly higher in both the TCP and collagen/TCP groups than that in the control group. However, there was no difference between the two scaffolds. This remained the same at 14 days compared to the control group, but the expression of OPN and RUX2 was significantly higher in the collagen/TCP group than in the TCP group.

3.3 X-ray and micro-CT Results of β-TCP/collagen at Different Bone Implantation Times

Figure 4A illustrates the live model showing the approximate shape of the animal, intraoperative position, intraoperative surgical incision markings, surgical procedure, shape of the two sets of materials, and postoperative incision healing. Figure 4B shows X-ray and micro-CT scan images at various times after surgery. After one month, imaging showed that a small portion of the β-TCP/collagen had been absorbed and a portion had not been absorbed. At the third month after surgery, most of the β-TCP/collagen and β-TCP were resorbed, and some of the bone plates began to grow into new bone tissue. After eight months, β-TCP/collagen and β-TCP were completely absorbed, and there was a large amount of bone tissue growth and partial fusion of the vertebral plates. Figure 4Cshows the results of the statistical analysis of BMD, bone trabecular volume fraction, and number in the micro-CT examination results at 1, 3, and 8 months postoperatively, which were found to be statistically significant in the β-TCP and β-TCP/collagen composite scaffold groups at three and eight months, respectively (P < 0.05).

3.4 Van Gieson Staining

Van Gieson's staining was performed at one, three, and eight months after implant fusion surgery, after new bone tissue was collected for hard tissue sectioning. Figure 5A shows the tissue staining at different times. One month postoperatively, a thick fibrous connective tissue membrane began to form behind the implanted plates in both groups, with some tissue mechanization and formation of fresh collagen fibers. Some gradual osteogenic differentiation was observed; however, the degree of collagen fiber formation was similar in both groups, with the difference that inclusion bodies appeared earlier in the β-TCP group. After three months, new bone formation was observed in both the β-TCP and β-TCP/collagen groups, with a clear boundary between it and the original bone layer, and the results were better in the β-TCP/collagen group than in the β-TCP group. After eight months, the efficacy of the β-TCP and β-TCP/collagen groups was superior to that of the β-TCP group. At eight months, both the β-TCP and β-TCP/collagen groups had completed new bone remodeling, and the β-TCP/collagen group had more new bone tissues and well-aligned trabeculae. The inclusion bodies were still present in the TCP/collagen group but completely disappeared in the β-TCP group. Figure 5B The positive areas were statistically analyzed using ImageJ analysis, which showed that there was no significant difference in the area of the separate areas of bone trabeculae at one month postoperatively (P = 0.7833), but there was a significant difference at three and eight months postoperatively (P = 0.0003 and P < 0.0001, respectively).

Osteoblast adhesion is the first step in the early osteogenesis of implanted bone biomaterials and is related to the surface morphology of these biomaterials, the surface coating, the nature of the composite material, and the pore structure. [22–25]. Consequently, the adhesion of osteoblasts to biomaterials is not only a simple physical process but also involves the initiation and regulation of important biological processes [23, 26].

Suresh et al. studied that scaffolds can provide the space needed to deliver and confine mesenchymal stem cells to the bone target site, and provide an environment suitable for stem cell proliferation and thus bone formation. [27]. In this case, our results suggest that β-TCP/collagen is more cytocompatible and osteogenic than β-TCP alone. Tampieri et al. showed that the morphology of collagen during calcium phosphate precipitation is very similar to that of human bone trabeculae[28]. Therefore, β-TCP/collagen increases the effective area of osteoblast contact and facilitates cell crawling. In addition, prevention of osteoblast apoptosis and maintenance of normal morphology play an important role in osteogenesis. Osteoblasts will have harmful effects on bone once apoptosis occurs [29, 30]. The effects on osteoblast apoptosis were similar for the two biological scaffolds tested.

According to Liu et al. nano tantalum-coated 3D printed porous polylactic acid/β-tricalcium phosphate scaffolds have enhanced biological properties to guide bone regeneration [31]. Dong et al. further found that the incorporation of porous magnesium-based composites and manganese materials together with β-TCP in appropriate proportions increased the desired biodegradability, mimicked the mechanical properties of bone, and improved the biological activity of bone cells [32, 33]. These studies reinforce the notion that β-TCP exhibits different biological properties when combined with different materials, and our study also found that osteoblast extracellular matrix mineralization was enhanced when β-TCP was combined with collagen.

According to many previous studies from osteogenesis-related genes it was found that MC3T3-E1 cells can show an increase in genes related to proliferation and osteogenic differentiation [34–36]. Ye et al. reported that the addition of PHA significantly improved the proliferation, adhesion, and migration of MC3T3-E1 cells in PHA/β-TCP scaffolds in vitro [37]. Our results suggest that β-TCP/collagen is superior to β-TCP alone, and these findings support its application in large animal models.

Spinal fusion experiments in large mammals have become a major area of interest in recent years as animal models are closer to humans in terms of biomechanical environment, vertebral body, and lamina bone density [38]. In terms of the characteristics of the different scaffold shapes, β-TCP is relatively homogeneous, whereas the β-TCP/collagen can change shape at will, which increases the effective area of osteoblast contact and facilitates cell crawling.

We chose small-tailed cold sheep as the experimental animal for fusion experiments using interlaminar implantation of β-TCP/collagen and β-TCP materials because of this advantage. X-ray and micro-CT non-invasively monitor bone growth and fusion with the advantage of being intuitive and frequently used to detect trabecular remodeling and bone density in bone fusion imaging [39, 40]. In our animal model, the stereotactic meshwork of vertebral plate trabeculae remodeling after implantation of different materials at different times differed, with the TCP/collagen group showing a denser and more homogeneous structure. In addition, because type I collagen fibers are mainly present in tissues such as bone, skin, and tendon [41–43], Van Gieson staining is considered to fully reveal bone tissue morphology and is the most commonly used and best staining method for hard tissue sections [44, 45]. We accidentally observed that after the implantation of β-TCP and β-TCP/collagen materials into the vertebral plates of the spinal column of small-tailed cold sheep, the accumulation of residual material and the formation of inclusion bodies in the β-TCP group occurred earlier, which led to a decrease in osteogenesis, and the inclusion bodies in the β-TCP/collagen group appeared later, which had more influence on osteogenesis and existed longer, which means it had an effect on bone remodeling. What is the exact tissue structure of the inclusion body? Based on our research, we hypothesized that inclusion bodies may be early prototypes of blood vessels. Evidence indicates the presence of molecular crosstalk from the osteoblast and osteoclast lineage cells to ECs to promote angiogenesis[46]. In turn, collagen may promote vascular growth by facilitating the release of pro-endothelial factors from tissues [47]. These two actions may be the main reasons why β-TCP/collagen promotes osteogenesis.

This suggests that it has a certain effect on bone remodeling. In addition, by combining different experimental methods and different characteristics exhibited during bone remodeling, it can be clearly observed that the β-TCP/collagen group had a more trabecular network and better bone remodeling. However, there is no relevant literature on the pathological features of bone remodeling after bone grafting, such as the formation of blood vessels by inclusion bodies.

We found that the osteogenic capacity of the β-TCP/collagen diminished once the formation of blood vessels from inclusion bodies occurred too early in the osteogenic process. In contrast, blood vessels formed in the middle and late stages not only had a stronger ability to promote osteogenesis, but this ability could persist for a long time. Therefore, we hypothesized that the timing of vascular emergence during bone remodeling affects the ability of autologous bone fusion and also suggested that β-TCP/collagen possess longer and stronger osteogenic capacity, making them more suitable for a wide range of clinical applications.

This study is reported in accordance with ARRIVE guidelines.

Author Contribution

All authors reviewed the manuscript.

Data Availability

The datasets used and/or analysed during the current study available from the first author on reasonable request.

Bolamperti S, Villa I, Rubinacci A(2022) Bone remodeling: an operational process ensuring survival and bone mechanical competence. Bone Res 18;10(1):48. doi: 10.1038/s41413-022-00219-8.
Bahia MT, Hecke MB, Mercuri EGF,Pinheiro MM(2020) A bone remodeling model governed by cellular micromechanics and physiologically based pharmacokinetics. J Mech Behav Biomed Mater 104:103657. doi:10.1016/j.jmbbm.2020.103657.
Barak MM(2020)Bone modeling or bone remodeling: That is the question. Am J Phys Anthropol 172:153–155. doi: 10.1002/ajpa.23966.
Diekwisch TGH(2019) Periodontal homeostasis: From Vienna to Texas-A century of periodontal research in the spirit of bernhard gottlieb. Stem Cells Dev. 28:961–2. doi: 10.1089/scd.2019.0126.
Byun H, Jang GN, Hong MH, Yeo J, Shin H, Kim WJ(2022) Biomimetic anti-inflammatory and osteogenic nanoparticles self-ssembled with mineral ions and tannic acid for tissue engineering. Nano Converg 9:47.
Eriksen AMH, Nielsen TK, Matthiesen H, Carøe C, Hansen LH, Gregory DJ(2020) Bone biodeterioration-The effect of marine and terrestrial depositional environments on early diagenesis and bone bacterial community. PLoS One 15:e0240512.doi: 10.1371/journal.pone.0240512.
Kim H, Lee K, Kim JM, Kim MY, Kim JR, Lee HW(2021) Selenoprotein W ensures physiological bone remodeling by preventing hyperactivity of osteoclasts. Nat Commun 15;12(1):2258.doi: 10.1038/s41467-021-22565-7.
Jorgen Slots(2000) Periodontitis: facts, fallacies and the future. Periodontol 75(1):7–23. doi: 10.1111/prd.12221.
Aghazadeh MR, Delfanian S, Aghakhani P, Homaeigohar S, Alipour A,Shahsavarani H(2022) Recent Advances in Development of Natural Cellulosic Non-Woven Scaffolds for Tissue Engineering. Polymers (Basel) 14(8):1531. doi: 10.3390/polym14081531.
Cheah CW, Al-Namnam NM, Lau MN, Lim GS, Raman R, Fairbairn P(2021) Synthetic Material for Bone, Periodontal, and Dental Tissue Regeneration: Where Are We Now, and Where Are We Heading Next. Materials (Basel) 14(20):6123. doi: 10.3390/ma14206123.
Kim SM, Yoo KH, Kim H, Kim YI, Yoon SY(2022) Simultaneous Substitution of Fe and Sr in Beta-Tricalcium Phosphate: Synthesis, Structural, Magnetic, Degradation, and Cell Adhesion Properties. Materials (Basel) Jul 15(13):4702. doi: 10.3390/ma15134702.
Micheletti C, Hurley A, Gourrier A, Palmquist A, Tang T, Shah FA(2022) Bone mineral organization at the mesoscale: A review of mineral ellipsoids in bone and at bone interfaces. Acta Biomater 142:1–13. doi:10.1016/j.actbio.2022.02.024.
Xiao D, Zhang J, Zhang C, Barbieri D, Yuan H, Moroni L(2020)The role of calcium phosphate surface structure in osteogenesis and the mechanisms involved. Acta Biomate 106:22–33.doi: 10.1016/j.actbio.2019.12.034.
Shu Y, Zhou Y, Ma P, Li C, Ge C,Wang Y(2019) Degradation in vitro and in vivo of β-TCP/MCPM-based premixed calcium phosphate cement. J Mech Behav Biomed Mater 90:86–95. doi: 10.1016/j.jmbbm.2018.10.001.
Xie Z, Yan D, Zhou Q, Wu Z, Weng S, Boodhun V(2019) The fast degradation of β-TCP ceramics facilitates healing of bone defects by the combination of BMP-2 and Teriparatide. Biomed Pharmacother 112:108578. doi: 10.1016/j.biopha.2019.01.039.
Cao H, Kuboyama N(2010) A biodegradable porous composite scaffold of PGA/beta-TCP for bone tissue engineering. Bone 46(2):386–395. doi: 10.1016/j.bone.
Meyer M(2019) Processing of collagen-based biomaterials and the resulting materials properties. Biomed Eng Online 18;18(1):24. doi: 10.1186/s12938-019-0647-0.
Goodarzi H, Hashemi-Najafabadi S, Baheiraei N, Bagheri F(2019) Preparation and Characterization of Nanocomposite Scaffolds (Collagen/β-TCP/SrO) for Bone Tissue Engineering. Tissue Eng Regen Med 16(3):237–251.doi: 10.1007/s13770-019-00184-0.
AVMA guidelines for responding to clients with special needs(1995). AVMA Committee on the Human-Animal Bond. J Am Vet Med Assoc.206(7):961–976.
Berli AS, Jud Schefer R, Steininger K, Schwarzwald CC(2015) The use of strain, strain rate, and displacement by 2D speckle tracking for assessment of systolic left ventricular function in goats: applicability and influence of general anesthesia. Cardiovasc Ultrasound 13:11. doi: 10.1186/s12947-015-0005-8.
Nie R, Sun Y, Lv H, Lu M, Huangfu H, Li Y(2022) 3D printing of MXene composite hydrogel scaffolds for photothermal antibacterial activity and bone regeneration in infected bone defect models. Nanoscale 14(22):8112–8129.doi: 10.1039/D2NR02176E.
Pedrero SG, Llamas-Sillero P, Serrano-López J(2021) A Multidisciplinary Journey towards Bone Tissue Engineering. Materials (Basel) 14(17):4896. doi:10.3390/MA14174896.
Li C, Hotz B, Ling S, Guo J, Haas DS, Marelli B, Omenetto F, Lin SJ, Kaplan DL(2016) Regenerated silk materials for functionalized silk orthopedic devices by mimicking natural processing. Biomaterials 110:24–33. doi: 10.1016/j.biomaterials.
Bohara S, Suthakorn J(2022) Surface coating of orthopedic implant to enhance the osseointegration and reduction of bacterial colonization: a review. Biomater Res 26(1):26. doi: 10.1186/s40824-022-00269-3.
Chen Z, Bachhuka A, Han S, Wei F, Lu S, Visalakshan RM(2017) Tuning Chemistry and Topography of Nanoengineered Surfaces to Manipulate Immune Response for Bone Regeneration Applications. ACS nano 11(5):4494–4506. doi: 10.1021/acsnano.6b07808.
O' Sullivan C, O' Neill L, O' Leary ND, O' Gara JP, Crean AM, Ryan KB(2021) Osteointegration, antimicrobial and antibiofilm activity of orthopaedic titanium surfaces coated with silver and strontium-doped hydroxyapatite using a novel blasting process. Drug Deliv Transl Res. 11(2):702–716. doi: 10.1007/s13346-021-00946-1.
Venkataiah VS, Yahata Y, Kitagawa A, Inagaki M, Kakiuchi Y, Nakano M(2021) Clinical Applications of Cell-Scaffold Constructs for Bone Regeneration Therapy. Cells 10(10):2687. doi: 10.3390/cells10102687.
Tampieri A, Sprio S, Sandri M, Valentini F(2011) Mimicking natural bio-mineralization processes: a new tool for osteochondral scaffold development. Trends Biotechnol 29(10):526–535. doi: 10.1016/j.tibtech.2011.04.011.
Rai R, Singh KB, Khanka S, Maurya R, Singh D(2022) Cladrin alleviates dexamethasone-induced apoptosis of osteoblasts and promotes bone formation through autophagy induction via AMPK/mTOR signaling. Free Radic Biol Med 190:339–350. doi: 10.1016/j.freeradbiomed.2022.08.028.
Mazur CM, Castro Andrade CD, Tokavanich N, Sato T,Bruce M, Brooks DJ(2022) Partial prevention of glucocorticoid-induced osteocyte deterioration in young male mice with osteocrin gene therapy. iScience 25(9):105019. doi: 10.1016/j.isci.2022.105019.
Liu T, Li B, Chen G, Ye X, Zhang Y(2022) Nano tantalum-coated 3D printed porous polylactic acid/beta-tricalcium phosphate scaffolds with enhanced biological properties for guided bone regeneration. Int J Biol Macromol 221:371–380. doi: 10.1016/j.ijbiomac.2022.09.003.
Dong J, Lin P, Putra NE, Tümer N, Leeflang MA, Huan Z,et al(2022) Extrusion-based additive manufacturing of Mg-Zn/bioceramic composite scaffolds. Acta Biomater 151. doi: 10.1016/j.actbio.2022.08.002.
Kamaraj M, Roopavath UK, Giri PS, Ponnusamy NK, Rath SN(2022) Modulation of 3D Printed Calcium-Deficient Apatite Constructs with Varying Mn Concentrations for Osteochondral Regeneration via Endochondral Differentiation. ACS Appl Mater Interfaces 14(20):23245–59. doi: 10.1021/acsami.2c05110.
Zhang Y, Xing Y, Li J, Zhang Z, Luan H, Chu Z(2018) Osteogenesis-Related Behavior of MC3T3-E1 Cells on Substrates with Tunable Stiffness. Biomed Res Int 2018:4025083. doi: 10.1155/2018/4025083.
Yang X, Mou D, Yu Q, Zhang J, Xiong YZhang Z(2022) Nerve growth factor promotes osteogenic differentiation of MC3T3-E1 cells via BMP-2/Smads pathway. Ann Anat 239. doi: 10.1016/j.aanat.2021.151819.
Kim EJ, Jung JI, Jeon YE, Lee HS(2021) Aqueous extract of Petasites japonicus leaves promotes osteoblast differentiation via up-regulation of Runx2 and Osterix in MC3T3-E1 cells. Nutr Res Pract 15(5):579–590. doi: 10.4162/nrp.2021.15.5.579.
Ye X, Zhang Y, Liu T, Chen Z, Chen W, Wu Z(2022) Beta-tricalcium phosphate enhanced mechanical and biological properties of 3D-printed polyhydroxyalkanoates scaffold for bone tissue engineering. Int J Biol Macromol 209:1553–1561. doi: 10.1016/j.ijbiomac.2022.04.056.
Mu X, Li Z, Yin D, Liang B, Ou Y, Wei J(2019) Biomechanical Effects of Fixation of Different Segments of Goat Lumbar Spine on Adjacent Segmental Motion and Intradiscal Pressure Change. Med Sci Monit 25:4885–4891. doi: 10.12659/MSM.915458.
Paldánius PM, Ivaska KK, Mäkitie O, Viljakainen H(2021) Serum and Urinary Osteocalcin in Hmealthy 7- to 19-Year-Old Finnish Children and Adolescents. Frontiers in pediatr 9:610227. doi: 10.3389/fped.2021.610227.
Wang H, Zhang N, Li L, Yang P, Ma Y(2021) Menaquinone 4 Reduces Bone Loss in Ovariectomized Mice through Dual Regulation of Bone Remodeling. Nutrients 13(8). doi: 10.3390/nu13082570.
Melo P, Montalbano G, Boggio E, Gigliotti CL, Dianzani C, Dianzani U, et al(2022) Electrospun Collagen Scaffold Bio-Functionalized with Recombinant ICOS-Fc: An Advanced Approach to Promote Bone Remodelling. Polymers (Basel) 14(18):3780. doi: 10.3390/polym14183780.
Bose S, Li S, Mele E, Silberschmidt VV(2022) Exploring the Mechanical Properties and Performance of Type-I Collagen at Various Length Scales: A Progress Report. Materials (Basel) 15(8):2753. doi: doi: 10.3390/ma15082753.
Ieronimakis N, Hays A, Prasad A, Janebodin K, Duffield JS, Reyes M(2016) PDGFRα signalling promotes fibrogenic responses in collagen-producing cells in Duchenne muscular dystrophy. J Pathol 240(4):410–424. doi: 10.1002/path.4801.
N Zhang, N Liu, Ch Sun, Jf Zhu, Jl Yan(2018) In vivo study of a novel micro-arcoxidation coated magnesium-zinc-calcium alloy scaffold/autologous bone particles repairing critical size bone defect in rabbit. Chinese journal of reparative and reconstructive surgery 32(3):298–305. doi: 10.7507/1002-1892.201710003.
Tratwal J, Bekri D, Boussema C, Sarkis R, Kunz N, Koliqi T(2020) MarrowQuant Across Aging and Aplasia: A Digital Pathology Workflow for Quantification of Bone Marrow Compartments in Histological Sections. Front Endocrinol (Lausanne). doi: 10.3389/fendo.2020.00480.
Peng Y, Wu S, Li Y, Crane JL(2020) Type H blood vessels in bone modeling and remodeling. Theranostics 10(1):426–436. doi: 10.7150/thno.34126.
Copes F, Pien N, Van Vlierberghe S, Boccafoschi F, Mantovani D(2019) Collagen-Based Tissue Engineering Strategies for Vascular Medicine. Front Bioeng Biotechnol 7:166. doi: 10.3389/fbioe.2019.00166.

No competing interests reported.

Download PDF

Reviews received at journal
04 Nov, 2024
Reviewers agreed at journal
16 Oct, 2024
Reviewers agreed at journal
05 Oct, 2024
Reviewers invited by journal
03 Oct, 2024
Editor assigned by journal
03 Oct, 2024
Editor invited by journal
09 Sep, 2024
Submission checks completed at journal
05 Sep, 2024
First submitted to journal
07 Aug, 2024

You are reading this latest preprint version

β-tcp/collagen composite scaffolds facilitate bone remodeling in vertebral plate fusion

Status:

Version 1

Abstract

Purpose

Methods

Results

Conclusions

Figures

1. Introduction

2. Materials and Methods

2.1 Cellular experiments

2.2 Experimental Animals

2.3 Statistical Analysis

3. Results

3.1 Surface morphology and cell adhesion analysis and effects on MC3T3-E1 cell proliferation of β-TCP/collagen

3.2 Effect of β-TCP/collagen on mineralization and osteogenic differentiation of MC3T3-E1 extracellular matrix

3.3 X-ray and micro-CT Results of β-TCP/collagen at Different Bone Implantation Times

3.4 Van Gieson Staining

4. Discussion

Declarations

Author Contribution

Data Availability

References

Additional Declarations

Status:

Version 1