Development, optimization and application of a Universal Fluorescence Multiplex PCR-based assay to detect BCOR genetic alterations in pediatric tumors

doi:10.21203/rs.3.rs-4873702/v1

Download PDF

Research Article

Development, optimization and application of a Universal Fluorescence Multiplex PCR-based assay to detect BCOR genetic alterations in pediatric tumors

https://doi.org/10.21203/rs.3.rs-4873702/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

A number of genetic aberrations are associated with the BCL6-correpresor gene (BCOR), including internal tandem duplications (ITDs) and fusions (BCOR-CCNB3 and BCOR-MAML3), as well as YWHAE-NUTM2, which are found in clear cell sarcoma of the kidney (CCSK), sarcoma with BCOR genetic alterations, primitive myxoid mesenchymal tumor of infancy, and high-grade neuroepithelial tumors in children. Detecting these gene aberrations is crucial for tumor diagnosis. ITDs can be identified by targeted Sanger sequencing or agarose gel electrophoresis. However, gene fusions are usually detected through reverse transcription-polymerase chain reaction (RT-PCR) or fluorescence in situ hybridization. Methods that monitor these variants simultaneously in a sensitive and convenient manner are lacking in clinical practice.

Methods

This study validated a Universal Fluorescence Multiplex PCR-based assay that assessed BCOR ITDs, BCOR-CCNB3, BCOR-MAML3 and YWHAE-NUTM2 fusions simultaneously.

Results

The assay achieved a detection threshold of 10 copies for fusion genes and 0.3 ng genomic DNA for BCOR ITDs. The performance of this assay was also tested in a cohort of 43 pediatric tumors (17 undifferentiated small round cell sarcomas, and 26 tumors with a histological diagnosis of CCSK). In total, 20 BCOR ITDs, 4 BCOR-CCNB3 and one YWHAE-NUTM2 were detected. When compared with the final diagnosis, the assay achieved 93% sensitivity and 100% specificity.

Conclusions

Accordingly, this assay provided an effective and convenient method for detecting BCOR- and YWHAE-related abnormalities in tumors.

BCOR

ITD

CCNB3

MAML3

YWHAE

assay

PCR

The BCL6-correpressor (BCOR) gene, located on chromosome Xp11.4, is a transcriptional repressor widely expressed[1]. It contains two major functional domains: a BCL6-binding domain that binds to the transcriptional repressor BCL6, and a polycomb-group RING finger homology PUFD domain that attaches to PCGF proteins forming repressive complexes that control histone epigenetics[2]. This transcription factor regulates a number of genes, including those involved in hematopoiesis, mesenchymal stem cell function, and early embryonic development.

BCOR is associated with two major types of genetic changes, including internal tandem duplications (ITDs) of the PUFD domain as well as gene fusions (BCOR-CCNB3 and BCOR-MAML3). These kinds of genetic changes are commonly observed in a number of pediatric tumors, such as clear cell sarcoma of the kidney (CCSK), sarcoma with BCOR genetic alterations, primitive myxoid mesenchymal tumor of infancy (PMMTI), and high-grade neuroepithelial tumors (HG-NETs)[2, 3]. Another genetic event commonly observed in these tumors is the YWHAE-NUTM2 fusion[4]. Despite different clinical manifestations, these tumors share overlapping morphological features, such as primitive round or spindle cells arranged in nests, sheets, or fascicles, within a variable myxoid matrix and delicate vessels. Tumor cells frequently express BCOR, SATB2 and Cyclin D1. However, none of the above characteristics are unique. The diagnosis relies on molecular testing.

In clinical practice, BCOR ITDs are usually detected by polymerase chain reaction (PCR) followed by agarose gel electrophoresis. BCOR and YWHAE rearrangements are usually examined by reverse transcription-PCR or fluorescence in situ hybridization (FISH). There are few integration strategies that can simultaneously detect these two types of abnormalities except next generation sequencing (NGS), which is too time-consuming and expensive. Clinical practice urgently needs sensitive, specific, fast, and inexpensive detection methods. Universal Fluorescence Multiplex PCR (UFMPCR) is a widely accepted approach for efficient examination of a variety of mutations in genotyping, microbial identification, prenatal diagnosis, etc[5–7]. Here, we developed a UFMPCR-based assay to detect BCOR genetic aberrations and the YWHAE-NUTM2 fusion simultaneously. The assay's sensitivity, specificity, and utility were demonstrated using plasmid standards and patient samples.

Clinical specimens and patient information

Screening was conducted on all patients diagnosed with tumors at the Beijing Children's Hospital pathology department from January 2019 to December 2023. A total of 43 formalin-fixed and paraffin-embedded (FFPE) tumor specimens were involved in this study. All H&E stained slides and immunohistochemistry slides were independently reviewed by 2 senior pathologists. All procedures were conducted in accordance with the hospital research ethics committee guidelines. Patients' demographic characteristics, including gender and age of onset, as well as clinical information, such as tumor location, pathological diagnosis, molecular genetic characteristics, clinical stage, grading, and treatment details, were collected. The BCOR ITDs were determined by PCR coupled by capillary electrophoresis while the EWSR1, CIC, BCOR, YWHAE, ETV6 rearrangements were detected by FISH through routine clinical practice. For cases lacking the above-mentioned genetic alterations, whole transcriptome sequencing was recommended. Genomic DNA (gDNA) or RNA was isolated from sections containing over 50% tumor cells. The RNA was reverse transcribed into complementary DNA (cDNA).

Immunohistochemistry

The immunohistochemical stains Ki-67, BCOR, CyclinD1, INI-1, Vimentin, BCL-2, CD34, CD56, CK, Catenin, CD99, FLI-1, NKX2.2, S100, SATB2, WT1, PAX-8, TLE1, Desmin, Myogenin, or TFE3 were evaluated by an automated staining device (BondMAX, Leica Biosystems, Wetzlar, Germany). The antibodies utilized in this study were all monoclonal and supplied by Zhongshan Golden Bridge Biotechnology Company (Beijing, China).

The immunoreactivity of BCOR was systematically assessed based on staining intensity (negative, weak, moderate, and strong) and the percentage of positive tumor cells. BCOR expression was considered positive only if more than 10% of tumor cells displayed moderate to intense nuclear staining[8].

FISH detection

Interphase FISH was conducted as described previously [9–11]. FFPE tissue blocks were cut into sections 3–5 mm thick. After dewaxing, water bath repair, and protease digestion, sections and their corresponding dual-color break-apart probes (LBP, Guangdong, China) were incubated at 85°C for five minutes, followed by 14 hours of hybridization at 37°C. Thereafter, the sections would be washed with sodium citrate buffer and counterstained with DAPI. Following the scanning of the entire section under a fluorescence microscope, 200 intact nuclei were randomly selected and counted. Generally, a sample was interpreted as positive if more than 15% of the tumor cells exhibited the classic red and green separation signal pattern. As internal controls, endothelial cells and lymphocytes were used to eliminate false positives.

Primer design

Primer Express (version 3.0.1, Applied Biosystems, USA) was used for primer design. In the case of fusion genes, the Tm was set at 60 ± 2 ℃, and the amplicon lengths were varied between 150 and 200 bp. The size difference between different amplification products should be at least 2 bp for discrimination. An analysis of specificity was conducted via the NCBI Primer-BLAST website (https://www.ncbi.nlm.nih.gov/tools/primer-blast/), and an analysis of compatibility was conducted using the Multiple Primer Analyzer program (https://www.thermofisher.cn/cn/zh/home/brands/thermo-scientific/molecular-biology/molecular-biology-learning-center/molecular-biology-resource-library/thermo-scientific-web-tools/multiple-primer-analyzer.html). The 5' end of each forward primer was modified to incorporate an M13F adapter sequence (5’-TGTAAAACGACGGCCAGT-3’) that enables the use of universal fluorescent primers for amplification. The primer sequences and amplicon sizes were summarized in Table 1.

Table 1

Primer sequences
Primers	Sequences (5’ − 3’)	Length	Target	Amplicon size (bp)	Actual size (bp)
BCOR-F	TGTAAAACGACGGCCAGTCTCTTGTTCTCTTGCTCCA	37 bp
BCOR-R	TGACACATATGCACAAGGAT	20 bp	BCOR ITD	233 (WT)	230 (WT)
CCNB3-R	CTACTACTGGTGTGACTTCC	20 bp	BCOR-CCNB3	199	196
MAML3-R	GCTCCTTCCAACTTCCTT	18 bp	BCOR-MAML3	197	194
YWHAE-F	TGTAAAACGACGGCCAGTTGGATACGCTGAGTGAAGA	37 bp	YWHAE-NUTM2	184	181
NUTM2-R	AGAGCCGTGAACACAGAC	18 bp	YWHAE-NUTM2	184	181
HPRT1-F	CCCTGGCGTCGTGATTAGTG	20 bp	HPRT1	208	205
HPRT1-R	CAGGAAACAGCTATGACCGAGCACACAGAGGGCTACAA	38 bp	HPRT1	208	205
M13F	FAM-TGTAAAACGACGGCCAGT	18 bp
M13R	VIC-CAGGAAACAGCTATGACC	18 bp

Universal Fluorescence Multiplex PCR

The PCR reactions were conducted using the MiniAmp thermal cycler (Applied Biosystems, USA). The 25 µl PCR reaction system consisted of 12.5 µl of 2X T5 Fast qPCR Mix (Tsingke Biotechnology, Beijing, China), 0.1 µl of each chimeric forward primer, 1 µL of each reverse primer, 1 µl of 5’-fluorescence labeled universal primer, 2 µl template, and added H₂O to the final volume. All primers were stored at 10 µM. After initial denaturation at 95°C for 7 min, amplification was carried out at 95°C for 45 s, 60°C for 45 s, and 72°C for 90 s for 40 cycles, followed by an extension step at 72°C for 10 minutes, and finally cooling to 4°C.

Product detection by capillary electrophoresis and Sanger sequencing

A mixture of 1 µl of PCR product, 10 µl of highly deionized-formamide, and 0.4 µl of Genescan 600 LIZ size standard (Applied Biosystems, USA) was prepared. After denaturing at 95°C for 5 min, the mixture was cooled to 4°C and then subjected to capillary electrophoresis using an Applied Biosystems 3500 DX Genetic Analyzer. The peak sizes and relative heights of the amplification products were determined using Genescan Analysis 6.0 (Applied Biosystems, USA). A difference might exist between the size annotated by the software and the actual length[12].

The PCR products were also directly sequenced with the M13F universal primer by the ABI 3500 Genetic Analyzer.

The BCOR-CCNB3, BCOR-MAML3 and YWHAE-NUTM2 fusion sequences were inserted into the pCMV plasmid to serve as standard templates. A series of 10-fold dilutions of the plasmids were generated to evaluate the specificity, sensitivity, and cross-reactivity of the optimized assay system.

Statistical analysis

Assay sensitivity, specificity, positive predictive value, and negative predictive value were calculated with 95% confidence intervals. The significance level was set at P < 0.05. The analysis was performed using Graphpad Prism (version 6.05, California, USA).

Development of a UFMPCR-based BCOR alteration detection assay

The UFMPCR-based BCOR alteration detection assay was composed of reagents and primers for BCOR ITD, BCOR-CCNB3, BCOR-MAML3, YWHAE-NUTM2 and an internal reference. The reaction process was illustrated in Fig. 1A. In brief, the M13F (M13R for the reference gene) adapter sequence was added to each forward primer at the 5' end. In the first cycles, the chimeric primers initiated PCR amplification. Then, the excess FAM-M13F (VIC-M13R for the reference gene) universal primer bound to the initial amplification products and maintained subsequent PCR cycles. The PCR products were diluted and electrophoretically separated with a 3500 genetic analyzer. Amplification targets were analyzed based on fragment size and fluorescence color (wavelength). To control RNA quality, the expression of HPRT1 gene was selected as an internal reference.

The assay performance was validated by template standards. Due to the difficulty in evaluating the exact expression level of fusion genes in tumor samples, fusion fragments were inserted into the pCMV vector to serve as template standards. As the ITDs occur in the last exon of BCOR gene, human gDNA from FFPE blocks was used as a template standard. Using the protocol described in the material and methods section, the assay could detect stable product peaks that differed by 3 bp from the theoretical value of the target amplicon size (Table 1, Fig. 1B). The above results indicated the successful establishment of a BCOR alteration detection assay based on UFMPCR.

Optimization of the ratio between forward-chimeric primers and universal primers

The ratio between universal primers and chimeric primers affects PCR amplification efficiency. To explore the optimal ratio, the universal primer was kept constant at 0.4 µM, while the forward chimeric primers were maintained at 0.4 µM, 0.2 µM, 0.08 µM, 0.04, and 0.02 µM (corresponding ratios of 1:1, 2:1, 5:1, 10:1, and 20:1). A variety of template standards were tested using different concentrations (100, 1000 and 10000 copies for BCOR-CCNB3, BCOR-MAML3 and YWHAE-NUTM2 fusions, or 1, 10 and 100 ng human gDNA for BCOR ITD) .

As shown in Fig. 2, the amplification products increased rapidly with the ratio, reaching a maximum at 10:1 for most targets. There would be no further increase or even decrease in amplification products if this proportion coefficient continued to grow. Therefore, the optimal concentration ratio between universal primers and upstream chimeric primers was 10:1.

Performance of the UFMPCR-based BCOR alteration detection assay

Firstly, the amplification efficiency of the newly developed BCOR alteration detection assay was evaluated. Using gradient diluted plasmid standard solutions (10¹, 10², 10³, 10⁴, 10⁵, 10⁶, and 10⁷ copies, respectively, for BCOR-CCNB3, BCOR-MAML3, and YWHAE-NUTM2) or human gDNA (0.32, 1.6, 8, 40, 200 ng, for BCOR ITD), single and multiplex fluorescence quantitative PCR amplification was conducted. Ct values were recorded to calculate the amplification efficiency for each primer pair. Within the given concentration range, all primers displayed excellent linear relationships (Fig. 3A, 3C, 3E, and 3G). Amplification efficiencies ranged from 95–106%, and Ct values were consistent between single and multiplex PCRs.

Then, the sensitivity and specificity of the assay were tested. The results indicated that the novel assay was capable of detecting at least 10 copies of fusion genes (Fig. 3D, 3F, and 3H) and 0.3 ng of gDNA for BCOR ITDs (Fig. 3B). Non-specific interference products were not observed.

Detection of BCOR alterations in tumor samples

Using the newly developed detection assay, BCOR gene variation tests were performed on 17 undifferentiated small round cell sarcoma (USRCS) samples. Among them, nine cases were initially diagnosed as Ewing sarcoma, five were sarcomas with BCOR-genetic alterations, two were CIC-rearranged sarcomas, one was an unclassified USRCS, and one was a Ewing-like sarcoma (B1 – B17, Table 2). As a result, BCOR-CCNB3 fusions were detected in three cases (B3, B11, and B12, Fig. 4A), and BCOR ITDs in two cases (B16 and B17, Fig. 4B). All positive cases were initially considered as or consistent with sarcoma with BCOR genetic alterations, except case B3, which was reclassified based on the definite molecular result. No BCOR alterations were detected in Ewing sarcomas or CIC-rearranged sarcomas. BCOR protein expression was consistent with the genetic results (Table 2, Fig. 5A and 5B). The assay's sensitivity and specificity reached 100% for sarcoma with BCOR genetic alterations.

Table 2

Clinicopathological characteristics of the patient cohort
Cases	Age (years) /Sex	Site	Initial historical diagnosis	Molecular tests	Final diagnosis	BCOR expression	Assay result
B1	7.6/M	Rib	USRCS, consistent with Ewing sarcoma	EWSR1-ERG¹	Ewing sarcoma	-	-
B2	12.0/M	Leg	USRCS	CIC rearrangement²	CIC-rearranged sarcoma	-	-
B3	3.1/M	Back	USRCS	BCOR rearrangement²	Sarcoma with BCOR genetic alterations	+	BCOR-CCNB3
B4	12.5/M	Leg	USRCS, consistent with CIC-rearranged sarcoma	CIC-DUX4¹	CIC-rearranged sarcoma	-	-
B5	10.0/M	Back	USRCS, consider Ewing-like sarcoma	CIC rearrangement²	CIC-rearranged sarcoma	-	-
B6	10.0/M	Mediastinum	Ewing sarcoma	EWSR1-ERG¹	Ewing sarcoma	-	-
B7	9.1/F	Mediastinum	USRCS, consistent with Ewing sarcoma	EWSR1 rearragement²	Ewing sarcoma	-	-
B8	8.1/M	Intracalvarium	USRCS, consistent with Ewing sarcoma	EWSR1 rearragement²	Ewing sarcoma	-	-
B9	14.2/M	Mediastinum	Ewing sarcoma	EWSR1 rearragement²	Ewing sarcoma	-	-
B10	5.6/M	Leg	Ewing sarcoma	EWSR1 rearragement²	Ewing sarcoma	-	-
B11	5.1/M	Leg	USRCS, consistent with sarcoma with BCOR genetic alterations	BCOR rearrangement²	Sarcoma with BCOR genetic alterations	+	BCOR-CCNB3
B12	13.9/F	Pelvis	USRCS, considered as sarcoma with BCOR genetic alterations	BCOR rearrangement²	Sarcoma with BCOR genetic alterations	+	BCOR-CCNB3
B13	5.7/M	Maxillofacial	USRCS, consistent with Ewing sarcoma	EWSR1 rearragement²	Ewing sarcoma	-	-
B14	7.2/F	Chest wall	USRCS, consistent with Ewing sarcoma	EWSR1 rearragement²	Ewing sarcoma	-	-
B15	11.4/M	Pelvis	USRCS, considered as Ewing sarcoma	EWSR1 rearragement²	Ewing sarcoma	-	-
B16	2.2/M	Bottom	USRCS, considered as sarcoma with BCOR genetic alterations	BCOR ITD³	Sarcoma with BCOR genetic alterations	+	BCOR ITD
B17	2.4/F	Pelvis	USRCS, considered as sarcoma with BCOR genetic alterations	BCOR ITD³	Sarcoma with BCOR genetic alterations	+	BCOR ITD
B18	1.2/M	Kidney	CCSK	-	CCSK	+	-
B19	12.4/F	Kidney	Consistent with CCSK	-	CCSK	+	-
B20	2.2/F	Kidney	CCSK	YWHAE rearrangemnt²	CCSK	-	YWHAE-NUTM2
B21	14.3/F	Kidney	Consistent with CCSK	BCOR rearrangement²	CCSK	+	BCOR-CCNB3
B22	1.3/F	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B23	3.7/M	Mandible	Consistent with CCSK metastasis	BCOR ITD³	CCSK metastasis	+	BCOR ITD
B24	3.7/M	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B25	10.0/M	Kidney	CCSK	SMARCB1 loss²	MRTK	-	-
B26	0.8/M	Kidney	CCSK	ETV6 rearrangement²	CMN	-	-
B27	1.6/M	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B28	5.8/M	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B29	3.1/M	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B30	4.9/F	Kidney	Consistent with CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B31	6.7/F	Kidney	CCSK	BCOR ITD³	CCSK	-	BCOR ITD
B32	1.3/F	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B33	15.8/M	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B34	4.3/F	Kidney	Consistent with CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B35	9.8F	Kidney	Consistent with CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B36	4.3/M	Kidney	Consistent with CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B37	0.3/M	Kidney	CCSK	ETV6 rearrangement²	CMN	-	-
B38	4.3/M	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B39	5.3/M	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B40	1.2/F	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
B41	0.6F	Kidney	CCSK	ETV6 rearrangement²	CMN	-	-
B42	4.3/M	Kidney	CCSK	BCOR ITD³	CCSK	-	BCOR ITD
B43	5.6/F	Kidney	CCSK	BCOR ITD³	CCSK	+	BCOR ITD
¹By transcriptome sequencing;
²By fluorescence in situ hybridization;
³By PCR followed with Sanger sequencing;
Abbreviations: CCSK, clear cell sarcoma of the kidney; CMN, congenital mesoblastic nephroma; MRTK, malignant rhabdoid tumor of the kidney; M, male; F, female; mo., months; DOD, dead of disease; NED, no evidence of disease; AWD, alive with disease; USRCS, undifferentiated small round cell sarcoma.

The performance of this assay was also evaluated using a cohort of 26 tumors morphologically diagnosed as CCSK (cases B18 – B43, Table 2). In total, BCOR ITDs were detected in 18 cases, BCOR-CCNB3 in one and YWHAE-NUTM2 in one (Fig. 4). The remaining six negative cases were further examined for ETV6 rearrangement or SMARCB1 deletion. As a result of molecular analysis, three tumors (B26, B37, and B41) were corrected as congenital mesoblastic nephromas (Fig. 5C), and one case was corrected as a malignant rhabdoid tumor of the kidney (B25, Fig. 5D). Expression of BCOR proteins did not always correlate with gene variation. Thus the assay achieved a sensitivity of 91% and a specificity of 100% for CCSK.

Validation of the detection results was also carried out using PCR coupled with Sanger sequencing (Fig. 4, Table 3). All patients had consistent results. Thus, the novel detection method achieved 100% specificity, sensitivity, and accuracy.

Table 3

*BCOR* aberration detection by UFMPCR based assay and Sanger sequencing
BCOR aberrations		PCR followed by Sanger sequencing		Total (n)
BCOR aberrations		BCOR alterations	Wild type	Total (n)
UFMPCR-based assay	BCOR alterations	25	0	25
UFMPCR-based assay	Wild type	0	18	18
Total (n)		25	18	43

It has been reported that BCOR alterations, including gene fusions, ITDs, and the YWHAE-NUTM2 fusion, are present in a variety of tumor types, including CCSK, PMMTI, USRCS, and HG-NETs in the central nervous system[2]. These molecular markers have significant diagnostic and prognostic value. Due to the requirement of custom bacterial artificial chromosome probes for FISH or PCR with agarose gel electrophoresis for molecular analysis of these alterations, neither is readily available for routine diagnostic purposes, so this study validated a UFMPCR-based assay for detecting all of these aberrations simultaneously. For gene fusions, the minimum threshold was 10 copies, and for BCOR ITDs, 0.3 ng of gDNA was required. Using clinical tumor samples, the assay demonstrated excellent performance with 100% sensitivity and specificity. This is particularly critical for differential diagnosis, for the morphologic features of tumors with BCOR genetic abnormalities are diverse and lack specificity. While immunohistochemistry such as BCOR, SATB2 and cyclin D1 can be helpful, their sensitivity and specificity are limited[8]. Using only histomorphological features and immunohistochemical expressions for diagnosis can be challenging even for experienced pathologists[13].

The most significant feature of this assay is the introduction of universal fluorescence primers. Multiplex PCR is an economical and convenient method for detecting multiple targets simultaneously, widely used in tumor genetic variation detection. The majority of current multiplex PCRs use fluorescent dyes or probes to label the PCR products, and they use fluorescence color (wavelength) or melting curves to identify the products[14, 15]. The former involves synthesizing multiple fluorescent probes, which can be expensive, while the latter is limited in resolution, limiting the system's detection flux. In order to resolve these technical limitations, a universal primer was introduced into the detection system. This method connects universal primer sequence to the specific primers at the 5’ end to form chimeric primers. PCR reactions are conducted with both chimeric and universal primers. Previously studies had attempted to apply the universal primer to fusion gene detection and achieved significant results in leukemia and non-small cell lung cancer[16, 17]. To further improve the performance of the method, we used a fluorescent labeled universal primer and constructed a UFMPCR-based assay. Combining this assay with high-resolution capillary electrophoresis (Genetic Analyzer), dozens of targets can be evaluated simultaneously with a minimum theoretical detection resolution of one base pair. Currently, this technology is widely used in fields such as gene typing, microbial identification, prenatal diagnosis, and clonal rearrangement[5, 6].

Additionally, this assay is suitable for FFPE tumor tissues. FFPE is the most common sample type in the clinic. Nucleic acids from FFPE sections, particularly RNA, are highly degraded, making fusion genes difficult to detect[18]. The PCR assays described in previous research primarily focused on fresh or frozen tissues, and the amplicons were too long for FFPE sections[17, 19]. To adapt to FFPE samples, all PCR amplicons of the fusion genes used in this assay were designed between 150 and 200 bps. Furthermore, this prevented non-specific dimers from interfering with the products.

The assay utilized the HPRT1 gene for quality control of RNA from samples. Compared with ACTB and GAPDH, HPRT1 has fewer pseudogenes, making it easier to design cDNA primers not affected by gDNA interference[20]. In this way, the quality of RNA in the sample can be accurately determined. This is particularly important for FFPE samples with highly degraded RNA, since inappropriate internal references may produce false negative results. Wild-type BCOR can be used as an internal reference when detecting BCOR ITDs using gDNA.

BCOR ITDs, BCOR-CCNB3, BCOR-MAML3 and YWHAE-NUTM2 are molecular features reported repeatedly in tumors with BCOR genetic aberrations in the pediatric population. In this research, we analyzed 17 USRCSs and 22 CCSKs, and found 20 BCOR ITDs, 5 BCOR-CCNB3 and 1 YWHAE-NUTM2. The sequences of these aberrations were consistent with previous reports[3, 4, 9, 21]. However, no BCOR-MAML3 fusion was observed. This might be due to the limited number of cases included.

In summary, the newly developed UFMPCR-based assay provided a sensitive, convenient and reliable method for detecting common BCOR genetic alterations in tumors. Due to the short amplicon length, it was well-suited for the detection of highly degraded nucleic acids in FFPE samples.

CCSK

clear cell sarcoma of the kidney

cDNA

complementary DNA

FFPE

formalin fixation and paraffin embedding

FISH

fluorescence in situ hybridization

gDNA

genomic DNA

HG-NET

high-grade neuroepithelial tumor

ITD

internal tandem duplication

NGS, next generation sequencing

PCGF

polycomb-group RING finger

PCR

polymerase chain reaction

PMMTI

primitive myxoid mesenchymal tumors of infancy

PUFD, polycomb-group RING finger homolog ubiquitin-like fold discriminator

UFMPCR

Universal Fluorescence Multiplex polymerase chain reaction

USRCS

undifferentiated small round cell sarcoma

Ethics approval and consent to participate

This study was conducted under the ethical rules of the Institution’s Research Ethics Board of Beijing Children’s Hospital. All specimens were obtained with written informed consent or formal waiver.

Consent for publication

Not applicable.

Competing interests

The authors declare they have no actual or potential competing financial interests.

Funding

This work was supported by the BCH Young Investigator Program (No. 3-1-014-01-37) and the Transformation Incubation Fund for Scientific and Technological Achievements of Beijing Children's Hospital, Capital Medical University (No. ZHFY3-1-015). The funders had no role in the study design, data collection, and analysis, decision to publish, or preparation of the manuscript.

Author Contribution

M.Z. and X.Y carried out most of the experiments, data visualization, and drafting of the manuscript; N.Z., Y.Y., C.J., and X.G. carried out part of experiments and statistical analyses; W.X. and X.N. performed data curation; Y.G. and L.H. provided conceptualization, funding and project administration.

Acknowledgements

We would like to thank all patients and guardians for their cooperation.

Data Availability

All data generated during this study are included in this published article.

Huynh KD, Fischle W, Verdin E, Bardwell VJ. BCoR, a novel corepressor involved in BCL-6 repression. Genes Dev. 2000;14:1810–23.
Astolfi A, Fiore M, Melchionda F, Indio V, Bertuccio SN, Pession A. BCOR involvement in cancer. Epigenomics. 2019;11:835–55.
Ueno-Yokohata H, Okita H, Nakasato K, Akimoto S, Hata J, Koshinaga T, Fukuzawa M, Kiyokawa N. Consistent in-frame internal tandem duplications of BCOR characterize clear cell sarcoma of the kidney. Nat Genet. 2015;47:861–3.
Kao YC, Sung YS, Zhang L, Huang SC, Argani P, Chung CT, Graf NS, Wright DC, Kellie SJ, Agaram NP, Ludwig K, Zin A, Alaggio R, Antonescu CR. Recurrent BCOR Internal Tandem Duplication and YWHAE-NUTM2B Fusions in Soft Tissue Undifferentiated Round Cell Sarcoma of Infancy: Overlapping Genetic Features With Clear Cell Sarcoma of Kidney. Am J Surg Pathol. 2016;40:1009–20.
Toth T, Csaba A, Bokor A, Acs N. Variable fragment length allele-specific polymerase chain reaction (VFLASP), a method for simple and reliable genotyping. Mol Cell Probes. 2023;69:101910.
Pan TY, Kou HS, Wu SM, Wang CC. Identifiable universal fluorescent multiplex PCR equipped with capillary electrophoresis for genotyping of exons 1 to 5 in human red and green pigment genes. Talanta. 2022;241:123199.
Wen D, Zhang C, Universal Multiplex PCR. a novel method of simultaneous amplification of multiple DNA fragments. Plant Methods. 2012;8:32.
Kao YC, Sung YS, Zhang L, Jungbluth AA, Huang SC, Argani P, Agaram NP, Zin A, Alaggio R, Antonescu CR. BCOR Overexpression Is a Highly Sensitive Marker in Round Cell Sarcomas With BCOR Genetic Abnormalities. Am J Surg Pathol. 2016;40:1670–8.
Zhang M, Yao X, Guan X, Jia C, Zhang R, Wang H, Guo Y, Ni X, Yu Y, He L. Clinical relevance of BCOR internal tandem duplication and TP53 aberration in clear cell sarcoma of the kidney. Hum Pathol. 2023;134:45–55.
Zhang M, Yang Y, Guan X, Yao X, Guo Y, He L. Primary cardiac CIC-rearranged undifferentiated sarcoma in an infant. Pediatr Investig. 2021;5:313–7.
Zhang M, Yu Y, Guan X, Yao X, Jia C, Hong E, Guo Y, He L. A group of sclerosing epithelioid fibrosarcomas with low-level amplified EWSR1-CREB3L1 fusion gene in children. Pathol Res Pract. 2022;230:153754.
Sutton JT, Robertson BC, Jamieson IG. Dye shift: a neglected source of genotyping error in molecular ecology. Mol Ecol Resour. 2011;11:514–20.
Sbaraglia M, Righi A, Gambarotti M, Dei Tos AP. Ewing sarcoma and Ewing-like tumors. Virchows Arch. 2020;476:109–19.
Nikiforov YE, Steward DL, Robinson-Smith TM, Haugen BR, Klopper JP, Zhu Z, Fagin JA, Falciglia M, Weber K, Nikiforova MN. Molecular testing for mutations in improving the fine-needle aspiration diagnosis of thyroid nodules. J Clin Endocrinol Metab. 2009;94:2092–8.
Rodriguez-Martin C, Alonso J. Molecular Approaches to Diagnosis in Ewing Sarcoma: RT-PCR. Methods Mol Biol. 2021;2226:85–103.
Li M, Lu S, Sun X. Rapid detection and genotyping of ALK fusion variants by adapter multiplex PCR and high-resolution melting analysis. Lab Invest. 2020;100:110–9.
Chen Q, Hu Z, Fang Y, Kang M, Zhang Q. Development and application of a rapid molecular method for detection of fusion genes in pediatric leukemia. Int J Clin Exp Pathol. 2018;11:1074–87.
Talebi A, Thiery JP, Kerachian MA. Fusion transcript discovery using RNA sequencing in formalin-fixed paraffin-embedded specimen. Crit Rev Oncol Hematol. 2021;160:103303.
Ueno-Yokohata H, Okita H, Nakasato K, Kiyotani C, Kato M, Matsumoto K, Kiyokawa N, Nakazawa A, Yoshioka T. Establishment of multiplex RT-PCR to detect fusion genes for the diagnosis of Ewing sarcoma. Diagn Pathol. 2021;16:102.
Sun Y, Li Y, Luo D, Liao DJ. Pseudogenes as weaknesses of ACTB (Actb) and GAPDH (Gapdh) used as reference genes in reverse transcription and polymerase chain reactions. PLoS ONE. 2012;7:e41659.
Wong MK, Ng CCY, Kuick CH, Aw SJ, Rajasegaran V, Lim JQ, Sudhanshi J, Loh E, Yin M, Ma J, Zhang Z, Iyer P, Loh AHP, Lian DWQ, Wang S, Goh SGH, Lim TH, Lim AST, Ng T, Goytain A, Loh AHL, Tan PH, Teh BT, Chang KTE. Clear cell sarcomas of the kidney are characterised by BCOR gene abnormalities, including exon 15 internal tandem duplications and BCOR-CCNB3 gene fusion. Histopathology. 2018;72:320–9.

No competing interests reported.

Download PDF

Reviewers agreed at journal
24 Nov, 2024
Reviewers invited by journal
22 Nov, 2024
Editor assigned by journal
13 Aug, 2024
Submission checks completed at journal
11 Aug, 2024
First submitted to journal
07 Aug, 2024

You are reading this latest preprint version

Development, optimization and application of a Universal Fluorescence Multiplex PCR-based assay to detect BCOR genetic alterations in pediatric tumors

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Background

Materials and Methods

Clinical specimens and patient information

Immunohistochemistry

FISH detection

Primer design

Universal Fluorescence Multiplex PCR

Product detection by capillary electrophoresis and Sanger sequencing

Statistical analysis

Results

Optimization of the ratio between forward-chimeric primers and universal primers

Detection of BCOR alterations in tumor samples

Discussion

Conclusions

Abbreviations

Declarations

Competing interests

Funding

Author Contribution

Acknowledgements

Data Availability

References

Additional Declarations

Status:

Version 1