IL-37 attenuated HPV induced inflammation of oral epithelial cells via inhibiting PI3K/AKT/mTOR

doi:10.21203/rs.3.rs-4876714/v1

Download PDF

Research Article

IL-37 attenuated HPV induced inflammation of oral epithelial cells via inhibiting PI3K/AKT/mTOR

https://doi.org/10.21203/rs.3.rs-4876714/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Human papillomavirus (HPV) is the most prevalent sexually transmitted infection globally, with significant implications for various anogenital cancers, such as vulval, vaginal, anal, penile, and head and neck cancers. HPV infections have been linked to the induction of inflammation. In contrast, Interleukin-37 (IL-37) is recognized as an anti-inflammatory cytokine. In this study, two distinct types of oral epithelial cells were employed to investigate the impact of HPV on inflammation. The results demonstrated a significant induction of inflammation by HPV in both types of oral epithelial cells. Interestingly, IL-37 exhibited a mitigating effect, attenuating the HPV-induced inflammation in oral epithelial cells. Further exploration into the molecular mechanisms involved revealed that knockdown (KD) of PI3K compromised the anti-inflammatory effects of IL-37 in response to HPV. Similarly, KD of AKT was found to compromise the regulatory effects of IL-37 on HPV-induced inflammation. Notably, KD of mTOR was identified as a key factor, compromising the anti-inflammatory effects of IL-37 in the context of HPV-induced inflammation. Additionally, the study uncovered that the mTOR inhibitor, rapamycin, could effectively compromise the effects of IL-37 on HPV-induced inflammation. These findings contribute valuable insights into the intricate pathogenesis of HPV-induced inflammation and may pave the way for the development of innovative treatments for this condition.

HPV

IL-37

inflammation

growth

oral epithelial cells

As a large family of small double-stranded DNA viruses, HPV is the most common sexually transmitted infection globally, with a prevalence in the United States and worldwide. The HPV genome comprises 8 kb of circular DNA containing 8 protein-coding genes (L1, L2, E1, E2, E4, E5, E6, and E7) involved in various cellular processes such as replication, transcription, and transformation. Additionally, a noncoding, regulatory long control region (LCR) is present. HPV can be categorized into low- and high-risk types, with over 200 identified types. These viruses are nonenveloped double-stranded DNA viruses that primarily infect basal epithelial cells. The infection is mediated through interactions with cell surface receptors like integrin α6, which is abundant in basal cells and epithelial stem cells. Importantly, the majority of the HPV genome remains in the episomal state in infected cells and premalignant lesions. This information sets the stage for a deeper understanding of HPV pathogenesis and its implications for the development of novel therapeutic strategies.

Infection with specific types of human papillomavirus (HPV) is a recognized contributor to various anogenital cancers, encompassing vulval, vaginal, anal, penile, and head and neck cancers (3). In addition to its association with cancer, HPV has been reported to elicit inflammatory responses in different tissues (1). Inflammation is an intricate biological reaction orchestrated by the body's tissues in response to various stimuli, such as pathogens, irritants, or injured cells. This protective response involves the coordinated action of blood vessels, immune cells, and molecular mediators (4). When the stimulus persists, acute inflammation can transition to a chronic state, and accumulating evidence suggests a strong association between chronic inflammation and cancer (4). Cervical cancer patients infected with HPV exhibit elevated expression levels of IFN-γ mRNA, indicating a potential link between HPV infection and heightened inflammatory responses (4). Persistent HPV infection has been reported to induce the production of interleukin-6 (IL-6), a cytokine associated with the progression of cervical cancer (4). Furthermore, IL-6 has been shown to stimulate the oncogene signal transducer and activator of transcription 3 (STAT3), contributing to the establishment of chronic inflammation in cervical cancer (4). Inflammatory markers, including IL-6 and IL-8, have been found to be increased in tumor tissues with HPV infection (5). Given the intricate relationship between HPV and inflammation, there is a compelling interest in developing therapies to address HPV-induced inflammation. Exploring strategies to modulate inflammatory responses could open new avenues for preventing and treating the inflammatory aspects associated with HPV infections.

Interleukin 37 (IL-37), also known as IL1 family member 7 (IL1F7), was originally identified by Kumar et al., and it comprises five isoforms: IL1F7a to IL1F7e (6). IL-37 demonstrates broad protective effects against inflammatory diseases, autoimmune conditions, and cancer (6). It is constitutively expressed in various human tissues and cells, contributing to the maintenance of immune homeostasis (7). Clinical studies have highlighted elevated IL-37 levels in the serum and skin tissue of atopic dermatitis patients compared to controls, suggesting its induction in response to skin barrier disruption (7). IL-37 has been reported to mitigate inflammation through the regulation of the intracellular AMP-activated protein kinase (AMPK)-mammalian target of rapamycin (mTOR) signaling mechanism, a crucial regulator of autophagy (7). This signaling pathway plays a key role in the cellular response to stress and nutrient availability, and its dysregulation has been implicated in various pathological conditions, including inflammatory diseases and cancer.

In this study, two types of oral epithelial cells were utilized to investigate the impact of human papillomavirus (HPV) on inflammation in these cells. The study also delved into the effects of interleukin 37 (IL-37) on HPV-induced inflammation in oral epithelial cells. Furthermore, the study sought to elucidate the involvement of the PI3K/AKT/mTOR signaling pathway in mediating the effects of IL-37 on inflammation induced by HPV in oral epithelial cells. These findings provide novel insights into the pathogenesis of HPV-induced inflammation and the anti-inflammatory actions of IL-37 on oral epithelial cells.

Cell culture

Two types of oral cells, including HOEC and IPM-H026, were obtained from the Bio-resource Center of the Affiliated Hospital of Hebei University. These cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM, catalog number: D6429-500ML, Sigma-Aldrich) supplemented with 10% Fetal Bovine Serum (FBS, catalog number: MFCD00132239, Sigma-Aldrich), 1% L-glutamine (Invitrogen cat#2 5030-081), and 1% penicillin-streptomycin solution (PS, catalog number: V900929-100ML, Sigma-Aldrich) at 37°C in a 5% CO2 incubator. Sub-culturing was performed when the cells reached 80–90% confluence. Regular testing for Mycoplasma using the MycoAlert Plus Kit (Lonza) was conducted to ensure that the cells were free from mycoplasma contamination.

Western Blotting

HOEC and IPM-H026 cells were lysed using RIPA Lysis Buffer (catalog number: P0013B, Beyotime Biotechnology, Shanghai, China). The samples were boiled at 95°C with SDS/PAGE sample buffer (50 mM Tris-HCl [pH 6.8], 2% SDS, 0.1% bromophenol blue, 10% glycerol, and 1 mM dithiothreitol) for 10 minutes and then separated on SDS-PAGE. After transferring to PVDF membranes (Beyotime Biotechnology), the membranes were blocked with 5% non-fat milk in TBST buffer. Subsequently, they were incubated with primary antibodies (1:1000 dilution), including anti-Phospho-mTOR (2971, CST) and anti-beta-actin antibody (mAbcam 8226, Abcam), at 4°C overnight. After incubation with horseradish-peroxidase-coupled secondary antibodies (1:5000 dilution, HRP-labeled goat anti-rabbit IgG [H + L, Catalog number: A0208, Beyotime Biotechnology]) at room temperature for 1 hour, the immunoblots were visualized using BeyoECL Plus (catalog number: P0018S, Beyotime Biotechnology).

Cytokines detected by enzyme-linked immunosorbent assay (ELISA)

The concentration of cytokines, including IL18, TNFɑ, and IL8, in cell supernatants was quantified using ELISA kits (Thermo Fisher, catalog number: IL18 - KHC0181, TNFɑ - KHC3011, IL8 - KHC0081). All assay procedures were performed following the manufacturer’s instructions. Absorbance values of standards and samples were measured at 450 nm with a VICTOR Nivo Multimode Microplate Reader (reference wavelength 540 nm).

RNA Isolation and Quantitative Real Time PCR (RT-qPCR)

TRIzol (Beyotime Biotechnology) was employed for total RNA isolation from both cell lines according to the manufacturer’s protocol. The BeyoRT™ First Strand cDNA Synthesis Kit (catalog number: D7166, Beyotime Biotechnology) was utilized for cDNA synthesis from the isolated total RNA. RT-qPCR was conducted using BeyoFast™ SYBR Green qPCR Mix (2X) (catalog number: D7260-25ml, Beyotime Biotechnology) on a 7500 Fast Real-time PCR System (Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an internal control. The primers used in the study are listed in Table 1.

Table 1

Primers of qRT-PCR used in the present study.
Gene	Primer	Sequence	Product length (nt)
IL18	Sense	CCGGGAACGAAAGAGAAGCTC	75
	Anti-sense	ACCGAAGGCGCTTGTGGAG
IL8	Sense	AGTAGGCGACACTGTTCGTG	173
	Anti-sense	GCCTCCCATTCAATTGCCAC
TNFɑ	Sense	GGCACCCAGTCTGAGAACAG	176
	Anti-sense	TGGCAACCCAGGTAACCCTTA
GAPDH	Sense	AATGGGCAGCCGTTAGGAAA	168
	Anti-sense	GCGCCCAATACGACCAAATC

Statistical analysis

The data are presented as mean ± SEM. Statistical analysis of continuous variables was conducted using one-way ANOVA and Tukey’s post hoc test, while categorical variables were analyzed using Fisher’s exact tests. Prism GraphPad software (GraphPad Prism 5.0) was employed for statistical analysis. A significance level of p < 0.05 was considered to indicate statistically significant differences.

HPV E6 significantly induces inflammation in oral epithelial cells

To assess the impact of HPV infections on inflammation in oral cells, HOEC cells were exposed to varying concentrations of HPV E6. The results revealed a significant dose-dependent increase in the expression of inflammation-related genes, including IL18 (Fig. 1A), IL8 (Fig. 1B), and TNFɑ (Fig. 1C) in HOEC cells. Similarly, HPV E6 treatment led to a dose-dependent upregulation of inflammation genes IL18 (Fig. 1D), IL8 (Fig. 1E), and TNFɑ (Fig. 1F) in IMP-H026 cells. In summary, these findings indicate that HPV E6 significantly induces inflammation in oral cells.

IL37 attenuated HPV E6 induced inflammation on oral epithelial cells

Considering the known anti-inflammatory effects of IL37, its impact on HPV-induced inflammation in oral epithelial cells was investigated. HOEC cells were co-treated with HPV E6 and different concentrations (10 and 50 ng/mL) of IL37. The results revealed that IL37 significantly mitigated the HPV E6-induced increase in mRNA expression of IL18 (Fig. 2A), IL8 (Fig. 2B), and TNFɑ (Fig. 2C) in HOEC cells. Similarly, IL37 demonstrated a significant attenuation of the HPV E6-induced upregulation of mRNA expression of IL18 (Fig. 2D), IL8 (Fig. 2E), and TNFɑ (Fig. 2F) in IMP-H026 cells. In summary, these findings provide evidence that IL37 can alleviate HPV E6-induced inflammation in oral epithelial cells.

PI3K is involved in that IL37 attenuated HPV induced inflammation on oral epithelial cells

Given the reported involvement of PI3K/AKT/mTOR signaling in the activity of IL37, we sought to investigate how PI3K is implicated in the effects of IL37 on HPV-induced inflammation in oral epithelial cells (8). IL37 was found to dose-dependently reduce the expression of PI3K in both HOEC cells (Fig. 3A) and IMP-H026 cells (Fig. 3B). Intriguingly, PI3K knockdown (KD) was observed to compromise the effects of IL37 on the increase in IL18 (Fig. 3C), IL8 (Fig. 3D), and TNFɑ (Fig. 3E) induced by HPV in the HOEC cell line. Similarly, PI3K KD compromised the effects of IL37 on the increase in IL18 (Fig. 3F), IL8 (Fig. 3G), and TNFɑ (Fig. 3H) induced by HPV in the IMP-H026 cell line. In summary, these findings suggest the involvement of PI3K in the ability of IL37 to attenuate HPV-induced inflammation in oral epithelial cells.

AKT is involved in that IL37 attenuated HPV induced inflammation on oral epithelial cells

To further investigate the effects of PI3K/AKT/mTOR signaling on the activity of IL37, we examined the impact of IL37 on the expression of AKT. IL37 was found to dose-dependently reduce the expression of AKT in both HOEC cells (Fig. 4A) and IMP-H026 cells (Fig. 4B). Notably, AKT knockdown (KD) compromised the effects of IL37 on the increase in IL18 (Fig. 4C), IL8 (Fig. 4D), and TNFɑ (Fig. 4E) induced by HPV in the HOEC cell line. Similarly, AKT KD compromised the effects of IL37 on the increase in IL18 (Fig. 4F), IL8 (Fig. 4G), and TNFɑ (Fig. 4H) induced by HPV in the IMP-H026 cell line. In summary, these findings suggest that AKT is involved in the ability of IL37 to attenuate HPV-induced inflammation in oral epithelial cells.

mTOR is involved in that IL37 attenuated HPV induced inflammation on oral epithelial cells

To further investigate the effects of PI3K/AKT/mTOR signaling on the activity of IL37, we examined the impact of IL37 on the expression of mTOR. IL37 was found to dose-dependently reduce the expression of mTOR in both HOEC cells (Fig. 5A) and IMP-H026 cells (Fig. 5B). Importantly, mTOR knockdown (KD) compromised the effects of IL37 on the increase in IL18 (Fig. 5C), IL8 (Fig. 5D), and TNFɑ (Fig. 5E) induced by HPV in the HOEC cell line. Similarly, mTOR KD compromised the effects of IL37 on the increase in IL18 (Fig. 5F), IL8 (Fig. 5G), and TNFɑ (Fig. 5H) induced by HPV in the IMP-H026 cell line. In summary, these findings suggest that mTOR is involved in the ability of IL37 to attenuate HPV-induced inflammation in oral epithelial cells.

mTOR inhibitor, Rapamycin compromises effects of IL37 on HPV induced inflammation on oral epithelial cells

To further investigate the effects of mTOR on the activity of IL37 in the context of HPV-induced inflammation in oral epithelial cells, we utilized a mTOR inhibitor, rapamycin. Treatment with rapamycin effectively inhibited the phosphorylation of mTOR in both HOEC cells (Fig. 6A) and IMP-H026 cells (Fig. 6B). Significantly, rapamycin compromised the ability of IL37 to attenuate the increase in IL18 (Fig. 6C) and TNFɑ (Fig. 6D) induced by HPV in the HOEC cell line. Similarly, rapamycin compromised the effects of IL37 on the increase in IL18 (Fig. 6E) and TNFɑ (Fig. 6F) induced by HPV in the IMP-H026 cell line. In summary, these results suggest that rapamycin compromises the effects of IL37 on HPV-induced inflammation in oral epithelial cells, further supporting the involvement of mTOR in this regulatory mechanism.

Human papillomavirus (HPV) stands out as the most prevalent viral infection affecting reproductive tracts, with the vast majority of sexually active individuals acquiring the virus at some point in their lives (9). Notably, HPV-associated oral diseases are on the rise, occurring in individuals with both intact and compromised immune systems (10). HPVs employ diverse strategies to target immune signaling pathways (10). In our study, we observed a potent induction of inflammation by HPV in oral epithelial cells. Importantly, IL37 demonstrated a significant ability to attenuate HPV-induced inflammation in oral epithelial cells. Mechanistically, our findings highlight the critical involvement of the PI3K/AKT/mTOR signaling pathway in mediating the effects of IL37 on HPV-induced inflammation in oral epithelial cells.

It has been documented that HPV 16 induces varying degrees of chronic inflammation, ranging from mild to severe inflammation in oropharyngeal squamous cell carcinoma (OPSCC) (10). HPV E5, E6, and E7 have been implicated in the onset of HPV-induced inflammation by upregulating the expression of cyclooxygenase (COX)-2 and prostaglandin (PG) E2, subsequently activating the COX-PG pathway (11). Studies have reported that HPVs can enhance inflammatory cell infiltration (macrophages and neutrophils), elevate cytokine levels (IL-6, TNF-α, and IL-1β), chemokine levels (MCP-1), and levels of cell adhesion molecules (ICAM-1 and VCAM-1) in the lung (12). Additionally, HPV oncogenes E5, E6, and E7 have been associated with the development of chronic inflammation through various mechanisms (13). Similarly, in our present study, we observed that HPV E6 significantly increased the expression of cytokines, including IL18, IL8, and TNFɑ, in two types of oral epithelial cells (Fig. 1). This suggests that HPV may contribute to cancer development by modulating inflammation.

Accumulating evidence indicates that IL-37 is a distinctive member of the IL-1 family of cytokines, acting as a natural suppressor of inflammatory and immune responses (14). Notably, IL-37 has been reported to suppress pro-inflammatory cytokines (IL-1 and IL-6) and lung inflammation induced by COVID-19 (15). Furthermore, IL-37 is recognized as a potent anti-inflammatory cytokine with anti-tumor activity against hepatocellular carcinoma (HCC) in patients infected with hepatitis B virus (HBV) (16). In our present study, we observed that IL37 significantly mitigated HPV-induced inflammation in oral epithelial cells (Fig. 2). This aligns with findings from Wang et al., who reported that IL-37 inhibited STAT3 expression at both mRNA and protein levels (17). Consequently, IL37 is likely to play a crucial role in the context of HPV-induced inflammation.

The phosphatidylinositol-3-kinase (PI3K)/Akt and mammalian target of rapamycin (mTOR) (PI3K/AKT/mTOR) signaling pathways play crucial roles in various cellular activities (18). Additionally, this signaling pathway has been implicated in inflammation (19). Li et al. reported that IL-37 induced autophagy in hepatocellular carcinoma cells by inhibiting the PI3K/AKT/mTOR pathway (8). Consistent with this, our study also revealed that IL-37 could inhibit the PI3K/AKT/mTOR pathway (Fig. 3, 4, 5, and 6). Furthermore, the PI3K/AKT/mTOR signaling pathway has been closely associated with HPV-driven head and neck carcinogenesis (20). It was also found to regulate the virus/host cell crosstalk in HPV-positive cervical cancer cells (21). Enhancing our understanding of how the PI3K/Akt/mTOR signaling pathway contributes to the immortalization and carcinogenesis of HPV-transduced cells is crucial for developing novel strategies to prevent and treat HPV-induced cancers (22). In our study, we demonstrated that knockdown (KD) of PI3K, AKT, or mTOR compromised the suppressive effect of IL37 on HPV-induced cytokine release (Fig. 3, 4, 5, and 6). Thus, our findings support the notion that IL37 suppresses HPV-induced inflammation by inhibiting the PI3K/Akt/mTOR signaling pathway.

In summary, our study revealed that HPV significantly induced inflammation in both oral epithelial cells. IL37 demonstrated an inhibitory effect on HPV-induced inflammation in oral epithelial cells. Knockdown (KD) of PI3K compromised the anti-inflammatory effects of IL37, and similar compromising effects were observed with KD of AKT and mTOR. Notably, the mTOR inhibitor rapamycin effectively compromised the effects of IL37 on HPV-induced inflammation. These findings contribute valuable insights into a deeper understanding of the pathogenesis of HPV-induced inflammation and may pave the way for the development of innovative treatments for this condition.

Ethics approval and consent to participate

Not applicable.

Conflict of interest

The authors declare no competing financial interests.

Funding

This study was supported by Medical Science Research Project of Hebei Provincial Healthcare Commission (20240897).

Author Contribution

YS., NL., YB., KL., CL., and YH. performed experiments; YS., NL., and YH. designed the research; HY. And YH. wrote the manuscript; and YH. supervised the project.

Acknowledgments

Not applicable.

Data Availability Statement

Raw data were generated at [Department of Stomatology,Affiliated Hospital of Hebei University]. Derived data supporting the findings of this study are available from the corresponding author [YH] on request.

Yang A, Farmer E, Wu TC, Hung CF. Perspectives for therapeutic HPV vaccine development. J Biomed Sci. 2016;23(1):75.
Mladenka A, Slama J. Vaccination against HPV and view of new possibilities. Ceska Gynekol. 2018;83(3):218–25.
Dunne EF, Park IU. HPV and HPV-associated diseases. Infect Dis Clin North Am. 2013;27(4):765–78.
Gupta S, Kumar P, Das BC. HPV: Molecular pathways and targets. Curr Probl Cancer. 2018;42(2):161–74.
Muzio LL, Ballini A, Cantore S, Bottalico L, Charitos IA, Ambrosino M, et al. Overview of Candida albicans and Human Papillomavirus (HPV) Infection Agents and their Biomolecular Mechanisms in Promoting Oral Cancer in Pediatric Patients. Biomed Res Int. 2021;2021:7312611.
Kumar S, McDonnell PC, Lehr R, Tierney L, Tzimas MN, Griswold DE, et al. Identification and initial characterization of four novel members of the interleukin-1 family. J Biol Chem. 2000;275(14):10308–14.
La Fleur L, Botling J, He F, Pelicano C, Zhou C, He C, et al. Targeting MARCO and IL37R on Immunosuppressive Macrophages in Lung Cancer Blocks Regulatory T Cells and Supports Cytotoxic Lymphocyte Function. Cancer Res. 2021;81(4):956–67.
Li TT, Zhu D, Mou T, Guo Z, Pu JL, Chen QS, et al. IL-37 induces autophagy in hepatocellular carcinoma cells by inhibiting the PI3K/AKT/mTOR pathway. Mol Immunol. 2017;87:132–40.
Kurten CHL, Kulkarni A, Cillo AR, Santos PM, Roble AK, Onkar S, et al. Investigating immune and non-immune cell interactions in head and neck tumors by single-cell RNA sequencing. Nat Commun. 2021;12(1):7338.
Li R, Xiao L, Gong T, Liu J, Li Y, Zhou X, et al. Role of oral microbiome in oral oncogenesis, tumor progression, and metastasis. Mol Oral Microbiol. 2023;38(1):9–22.
Hemmat N, Bannazadeh Baghi H. Association of human papillomavirus infection and inflammation in cervical cancer. Pathog Dis. 2019;77(5).
El Alam S, Pena E, Aguilera D, Siques P, Brito J. Inflammation in Pulmonary Hypertension and Edema Induced by Hypobaric Hypoxia Exposure. Int J Mol Sci. 2022;23(20).
Georgescu SR, Mitran CI, Mitran MI, Caruntu C, Sarbu MI, Matei C, et al. New Insights in the Pathogenesis of HPV Infection and the Associated Carcinogenic Processes: The Role of Chronic Inflammation and Oxidative Stress. J Immunol Res. 2018;2018:5315816.
Zhu H, Hu S, Li Y, Sun Y, Xiong X, Hu X, et al. Interleukins and Ischemic Stroke. Front Immunol. 2022;13:828447.
Conti P, Ronconi G, Caraffa A, Gallenga CE, Ross R, Frydas I, et al. Induction of pro-inflammatory cytokines (IL-1 and IL-6) and lung inflammation by Coronavirus-19 (COVI-19 or SARS-CoV-2): anti-inflammatory strategies. J Biol Regul Homeost Agents. 2020;34(2):327–31.
Cheng H, Sun F, Ouyang Y, Li C. Correlation analysis of IL-37 gene polymorphisms and susceptibility to chronic HBV infection among Han people in Central China. Int J Immunogenet. 2023;50(6):299–305.
Wang S, An W, Yao Y, Chen R, Zheng X, Yang W, et al. Interleukin 37 Expression Inhibits STAT3 to Suppress the Proliferation and Invasion of Human Cervical Cancer Cells. J Cancer. 2015;6(10):962–9.
Porta C, Paglino C, Mosca A. Targeting PI3K/Akt/mTOR Signaling in Cancer. Front Oncol. 2014;4:64.
Tang ZL, Zhang K, Lv SC, Xu GW, Zhang JF, Jia HY. LncRNA MEG3 suppresses PI3K/AKT/mTOR signalling pathway to enhance autophagy and inhibit inflammation in TNF-alpha-treated keratinocytes and psoriatic mice. Cytokine. 2021;148:155657.
Aguayo F, Perez-Dominguez F, Osorio JC, Oliva C, Calaf GM. PI3K/AKT/mTOR Signaling Pathway in HPV-Driven Head and Neck Carcinogenesis: Therapeutic Implications. Biology (Basel). 2023;12(5).
Bossler F, Hoppe-Seyler K, Hoppe-Seyler F. PI3K/AKT/mTOR Signaling Regulates the Virus/Host Cell Crosstalk in HPV-Positive Cervical Cancer Cells. Int J Mol Sci. 2019;20(9).
Adimonye A, Stankiewicz E, Kudahetti S, Trevisan G, Tinwell B, Corbishley C, et al. Analysis of the PI3K-AKT-mTOR pathway in penile cancer: evaluation of a therapeutically targetable pathway. Oncotarget. 2018;9(22):16074–86.

No competing interests reported.

Westernblot.pdf

Download PDF

Reviewers invited by journal
27 Aug, 2024
Editor assigned by journal
13 Aug, 2024
Submission checks completed at journal
13 Aug, 2024
First submitted to journal
07 Aug, 2024

You are reading this latest preprint version

IL-37 attenuated HPV induced inflammation of oral epithelial cells via inhibiting PI3K/AKT/mTOR

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Cell culture

Western Blotting

Cytokines detected by enzyme-linked immunosorbent assay (ELISA)

RNA Isolation and Quantitative Real Time PCR (RT-qPCR)

Statistical analysis

Results

HPV E6 significantly induces inflammation in oral epithelial cells

IL37 attenuated HPV E6 induced inflammation on oral epithelial cells

PI3K is involved in that IL37 attenuated HPV induced inflammation on oral epithelial cells

AKT is involved in that IL37 attenuated HPV induced inflammation on oral epithelial cells

mTOR is involved in that IL37 attenuated HPV induced inflammation on oral epithelial cells

mTOR inhibitor, Rapamycin compromises effects of IL37 on HPV induced inflammation on oral epithelial cells

Discussion

Declarations

Ethics approval and consent to participate

Conflict of interest

Funding

Author Contribution

Acknowledgments

Data Availability Statement

References

Additional Declarations

Supplementary Files

Status:

Version 1