MiRNA-122-5p is Upregulated in Diabetic Foot Ulcers and Decelerates the Transition from the Inflammatory to the Proliferative Stage

doi:10.21203/rs.3.rs-4877621/v1

Download PDF

Article

MiRNA-122-5p is Upregulated in Diabetic Foot Ulcers and Decelerates the Transition from the Inflammatory to the Proliferative Stage

https://doi.org/10.21203/rs.3.rs-4877621/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Transitioning from the inflammatory to the proliferative stage is critical in treating diabetic foot ulcers (DFUs), yet current treatment options are limited. MicroRNAs (miRNAs) hold significant potential in enhancing DFU healing. Previous studies have shown that miR-122-5p targets the regulation of diabetic metalloproteinases, impacting the extracellular matrix. We hypothesize that miR-122-5p plays a crucial role in the healing of DFU. MiR-122-5p levels in skin tissue samples from both patients with diabetic ulcers and diabetic mice were evaluated using quantitative real-time PCR (qRT-PCR). The streptozotocin-induced diabetes mouse model for diabetic wound healing was utilized. Animals were randomized to receive intradermal injections of either an AAVDJ empty vector (AAVDJ-EV, control) or AAVDJ-miR-122 upregulation vector. Mice were euthanized at different intervals (3, 7, and 14 days post-injury), and wound tissues were collected for gene marker analysis, histological evaluation, immunohistochemistry, and network analysis. The study focused on proteins involved in the transition from the inflammatory to the proliferative stage during DFU healing. Additionally, the role of miR-122-5p in mediating interactions between mouse macrophages and fibroblasts was analyzed. FISH and qRT-PCR results indicated that miR-122-5p levels were significantly upregulated in diabetic skin, both in individuals with DFU and diabetic mice, compared to controls. Western blot, IHC, and ELISA results indicated that in vitro, upregulation of miR-122-5p increased MMP9 expression and levels of inflammatory mediators such as TNF-α and HIF-1α, while concurrently decreasing expression levels of VEGF and markers associated with fibrosis such as FN1 and α-SMA.Our findings confirmed that miR-122-5p increases inflammatory cytokines and reduces fibrosis in fibroblasts cultured with macrophage-conditioned media.MiR-122-5p increased inflammation and reduce fibrosis during wound healing of diabetic mice, slowing the transition from the inflammatory to the proliferative stage. These findings open the door to understanding how miRNAs functionally contribute to human skin wound healing.

Health sciences/Endocrinology

Health sciences/Molecular medicine

miR-122-5p

diabetic foot ulcer

Adeno-associated virus

biomarker

Diabetic foot ulcers (DFUs) are chronic wounds affecting approximately 15%¹ of patients with diabetes and are a primary cause of amputations, leading to increased mortality rates^{2, 3}. DFUs are difficult to heal, prone to recurrence, and impose a significant economic burden on patients, severely affecting their quality of life⁴. Addressing DFUs remains challenging in clinical practice. However, current treatments for refractory DFUs are insufficient, and biomarkers that can diagnose and assess DFU prognosis are urgently needed.

Wound healing process consists of four dynamic, overlapping stages: hemostasis, inflammation, proliferation, and remodeling^5–7. Various cell types closely regulate this process, involving cell migration and proliferation, extracellular matrix (ECM) deposition, and tissue remodeling⁸. Additionally, the normal wound healing cascade is coordinated by immune cells, endothelial cells, fibroblasts, inflammatory cytokines, matrix metalloproteinases (MMPs), and growth factors⁹. Neutrophils direct macrophages to release inflammatory cytokines, such as HIF-1α, which play a key role in wound healing¹⁰. In DFUs, increased M1 inflammatory macrophages and decreased M2 anti-inflammatory macrophages prolong inflammation. This imbalance limits fibroblast proliferation and migration, significantly slowing granulation tissue growth and impeding the healing process¹¹.

The proliferative phase of wound healing involves three key processes: angiogenesis, wound contraction, and epithelialization¹². During this phase, fibroblasts and keratinocytes migrate to the wound bed, forming an ECM that acts as a scaffold for cell movement¹³. Angiogenesis is the development of new blood vessels within the granulation tissue of the wound bed¹⁴. The angiogenesis protein, VEGF, has a significantly reduced expression concentration in diabetic wounds, indicating that diabetic wounds were less likely to heal¹⁵. Keratinocytes and fibroblasts, which are structural components of connective tissue with significant immune functions, begin migrating and proliferating within hours after injury to fill the wound defect¹⁶. However, the precise molecular mechanisms preventing the timely transition from the inflammatory to the proliferative phase remain unclear.

In recent years, advancements in gene technology have led to a surge in studies on diabetes, its complications, and miRNAs^17–19. Moreover, miRNAs are crucial regulators of immune cell functions, and changes in their expression can affect various biological processes, which contribute to multiple human disorders^20–22. These miRNAs can be easily extracted from blood or pathological tissues. For example, miR-122-5p is highly enriched in the liver and has been consistently identified in serum and plasma samples of patients with hepatocellular carcinoma²³. It is located on human chromosome 18q21.31 and is closely associated with metabolism and linked to glycolysis, insulin secretion, and increased risk of diabetes²⁴. Despite extensive research on miRNAs in other contexts, few studies have explored their effects on diabetic foot ulcers (DFUs). Understanding miRNAs that regulate DFUs is crucial for identifying potential therapeutic agents to improve wound healing.

This study focused on miR-122-5p, a microRNA found to be upregulated in DFUs, which impedes the transition from the inflammatory stage to the proliferative stage of wound healing. We screened miRNAs in a diabetic ulcer mouse model to identify those associated with wound healing. Additionally, we explored the effects and mechanisms of the candidate miRNAs in this model.

Human tissue samples

Healthy donors and DFU patients were recruited at Shuguang Hospital Affiliated to Shanghai University of Traditional Chinese Medicine (SHUTCM, Shanghai, China). The healthy donor group included 3 individuals. Each healthy donor had an excisional wound created on their skin using a 3 mm punch, and the skin excised from these wounds was retained as an intact skin control. The DFU group comprised three patients. During sample collection, local anesthesia was administered with lidocaine injections. All donors provided written informed consent for the collection and use of their clinical samples. The study protocol was reviewed and approved by the Ethics Committee of SHUTCM (Approval No. 2024-1443-026-01) and was conducted in accordance with the principles outlined in the Declaration of Helsinki.

Animal Model for Diabetic Wound Healing

We obtained adult male C57BL/6 mice (21–25 g, 8–10 weeks) from Shanghai Model Organisms Center, Inc. They were housed in the Experimental Animal Center of Shanghai University of Traditional Chinese Medicine under specific pathogen-free conditions, with a 12-h light/dark cycle and unlimited access to food and water. The mice were randomly assigned to different groups (n = 20 per group): a control group receiving phosphate-buffered saline (PBS) and a diabetic ulcer (DU) group without or with AAVDJ-miR-122-5p upregulation. Additionally, three mice were injected with AAVDJ-EV as a control for AAVDJ-miR-122-5p upregulation. After 1 week of acclimatization, the DU groups were fed a high-fat diet (60% calories, FB-D12451, Wuxi Fan Bo Biotechnology Co., Ltd.) for 4 weeks and received daily intraperitoneal injections of STZ (40 mg/kg, Cat. No. 2196GR001, BioFRoxx) for 1 week²⁵. The mice were considered to have type 2 diabetes when fasting blood glucose levels were 11.1 mmol/L²⁶. Throughout the study, DU mice maintained blood glucose levels between 11.1 and 30 mmol/L, with those exceeding this range receiving appropriate insulin injections.

AAVDJ Vector Preparation and Characterization

Recombinant adeno-associated virus was constructed by GeneChem Co., Ltd. (Shanghai, China). Subsequently, the AAVDJ vector expressing miR-122-5p up (AAVDJ-miR-122-5p up) vector carrying mouse miR-122-5p up was generated, and the AAVDJ empty vector (AAVDJ-EV) was used as a negative control. The viral suspension was injected intradermally into the wound edges using a 1-cc syringe and 30-gauge needle. We administered five to seven injections of approximately 20 µl each (corresponding to ~ 10¹¹ vector particles) per wound were administered²⁷. After 21 days, three mice each from the AAVDJ-miR-122-5p up and AAVDJ-EV groups were euthanized to confirm successful model establishment by quantitative real-time PCR (qRT-PCR). Subsequently, full-thickness skin wounds (1 × 1 cm, with depth to the fascial layer) were surgically created on the back of mice by lifting the skin with forceps²⁸.

Therapies for Diabetic Wound Healing

The wounds were bandaged with 1 cm² gauze soaked in PBS, with daily wound dressing. The animals in each group were euthanized by cervical dislocation after being anesthetized with isoflurane (Cat. No. R510-22-10, RWD Life Science Co.,LTD) after 3, 7, and 14 days, and the wounds were divided into three segments (0.2-cm wide). The Animal Ethics Committee of Shanghai University of Traditional Chinese Medicine approved all animal experiments (Approval No. PZSHUTCM2212140011). All procedures conformed to the Declaration of Helsinki and the Guide for the Care and Use of Laboratory Animals.

Calculation of Wound Healing Rate

Photographs were taken on days 0, 3, 7, and 14 to assess wound healing on mouse backs using a digital camera (Nikon, Tokyo). The wound closure rate was quantified using ImageJ software (Bethesda, MD) and calculated as follows: t − t₀/t₀ × 100% (t, wound healing was assessed; t₀, initial wounding).

Bioinformatics

After 14 days, the mice were euthanized, and skin ulcer tissues were collected and submitted to OE Biotech (Shanghai, China). We analyzed miRNA expression using the Quantifier script from miRDeep2 software (version 0.1.2). Venn correlation and Principal Component (PCA) analyses were conducted to assess miRNA expression across different samples. Benjamini–Hochberg method. Predicted miRNA target genes were annotated using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database for functional insights. we used Gene Set Enrichment Analysis software (version 4.3.2) to explore potential biological processes regulated by miRNAs.

Cell Culture

We obtained RAW264.7 (mouse macrophage line) and NIH3T3 (mouse fibroblast line) cells from the American Type Culture Collection. Both cell lines were cultured in Dulbecco’s Modified Eagle Medium with 10% heat-inactivated fetal bovine serum (FBS), 100 U/ml penicillin, and 100 µg/ml streptomycin, maintained at 37 C, 5% CO2 conditions. M1 macrophages were induced using lipopolysaccharide (LPS; 100 ng/ml, Cat. No. L2630, Sigma Aldrich, United States). NIH3T3 cells were cultured with the supernatant from RAW264.7 cell cultures.

Cell Transfection

The cells were standardized to a concentration of 3 × 10⁴ cells/ml using basal medium and plated in six-well plates. Subsequently, NIH3T3 cells were transfected with miR-122-5p mimic or inhibitor, along with their respective negative controls (Ribobio Co., Guangzhou, China), at a 50-nM concentration. Transfection was performed using Lipofectamine 3000 (Invitrogen, Scientific, USA) based on the manufacturer’s protocol. Protein and supernatant samples were collected 72 h posttransfection, and RNA samples were collected 48 h posttransfection.

Scratch Wound Healing Assay

Cell suspensions in a six-well plate (5 × 10⁵ cells/ml) were cultured overnight in a medium containing 10% FBS. A 10-µl pipette tip was used to create a scratch. The cells were then cultured for 0, 24, and 36 h under either normoxic or hypoxic conditions. The results at each time point were observed and captured using an OLYMPUS BX53 microscope. Cell migration (%) was calculated using the formula: (scratch distance at 0 h − scratch distance at corresponding time point) / scratch distance at 0 h × 100%.

Histological Evaluation

The wound samples were fixed in 4% paraformaldehyde (PFA, Cat. No. P0099, Beyotime) for 48 h. After routine paraffin embedding and slicing, the samples were stained with hematoxylin and eosin (H&E, Cat. No. C01105M, Beyotime, China) and Masson stain (Cat. No. G1340, Solarbio Life Sciences, China). For histological assessment, a pathologist blindly evaluated all slides by using coded slides, viewed under a microscope at magnifications ranging from ×20 to ×100. We used a digital slide scanning system (Precipoint M8) for analyzing stained tissues.

Immunohistochemistry (IHC)

Ulcerated tissues from the three groups of mice were collected and fixed in 4% paraformaldehyde for 24 h. Subsequently, the tissues were embedded in paraffin and sectioned into 5-µm slices. IHC analyses were performed on these paraffin-embedded sections. The sections were incubated overnight at 4 C with the following antibodies: TNF-α (Cat. No. YT4689, Immunoway; 1:300), MMP9 (Cat. No. 10375-2-AP, Proteintech; 1:500), HIF-1α (Cat. No. 20960-1-AP, Proteintech; 1:500), FN1 (Cat. No. 15613-1-AP, Proteintech; 1:300), α-SMA (Cat. No. 55135-1-AP, Proteintech; 1:200), and VEGF (Cat. No. 19003-1-AP, Proteintech; 1:500). The slides designated for IHC staining were then incubated with the secondary antibody (Cat. No. GB23303, Servicebio, diluted 1:200). Visualization was achieved using DAB chromogen staining, followed by counterstaining with hematoxylin. The images were captured using an optical microscope (Olympus BX41, Shanghai, China).

Tissue immunofuorescence staining

For histological analysis, the dissected tissues were fixed in a solution containing 2% paraformaldehyde (PFA) and 20% sucrose for 24 h at room temperature, followed by embedding in Tissuetek O.C.T. compound (Electron Microscopy Sciences). The blocks were subsequently frozen in a dry ice and ethanol bath. For immunofluorescence staining, 6 µm cryosections of O.C.T.-embedded tissues were incubated with primary antibodies against F4/80 (CST, #30325, 1:800), ARG1 (CST, #93668S, 1:1000), and iNOS (CST, #13120S, 1:800). Secondary antibodies conjugated to Alexa Fluor® 488 (anti-rabbit IgG, CST, #4412, 1:2000) and Alexa Fluor® 594 (goat anti-rabbit IgG, CST, #8889, 1:2000) were used for detection. Nuclear counterstaining was performed with DAPI (4',6-diamidino-2-phenylindole). Immunofluorescence images were acquired using a TCS SP8 STED 3X ultra-high-resolution confocal microscope (Leica, Ernst-Leitz, Wetzlar, Germany).

Western Blot Analysis (WB)

Wound tissues and cells were lysed in RIPA lysis buffer (Cat. No. P0013C, Beyotime, China) containing protease and phosphatase inhibitor cocktails (Cat. Nos. P1005 and P1045, Beyotime, China). Equal amounts of protein (20 µg) from each group were loaded onto a 7.5% or 10% SDS-PAGE gel (Cat. Nos. PG111 and PG112, EpiZyme, China) along with standard molecular weight markers (Cat. Nos. 26619 and 26625, Thermo Fisher, United States). Subsequently, the proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane (Cat. No. IPVH00010, Millipore) and blocked with 5% BSA for 2 h. The membranes were incubated overnight at 4 C with the following primary antibodies: rabbit anti-TNF-α (Cat. No. YT4689, Immunoway; 1:2000), rabbit anti-MMP9 (Cat. No. 10375-2-AP, Proteintech; 1:1,500), rabbit anti-HIF-1α (Cat. No. 20960-1-AP, Proteintech; 1:1,000), rabbit anti-FN1 (Cat. No. 15613-1-AP, Proteintech; 1:2,000), rabbit anti-α-SMA (Cat. No. 55135-1-AP, Proteintech; 1:2,000) and VEGF (Cat. No. 19003-1-AP, Proteintech; 1:500), rabbit anti-β-actin antibody (Cat. NO. 20536-1-AP, Proteintech; 1:1,000).

qRT-PCR

We extracted total RNA using Cell/Tissue Total RNA Isolation Kit V2 to eliminate genomic DNA contamination and obtain RNA samples. RNA concentration was determined using NanoDrop ND-1000. Subsequently, III RT SuperMix was used for qRT-PCR to eliminate residual gDNA and perform reverse transcription. We performed qRT-PCR analysis on an ABI 7500 Instrument (Applied Biosystems, Foster City, CA, USA) using the SYBR Green method. Relative RNA expression levels were calculated using the 2^–∆∆Ct method. Table 1 shows the specific primers.

Enzyme-linked Immunosorbent Assay (ELISA)

We precisely weighed and homogenized wound tissues from diabetic mice into a paste. They were mixed with PBS at a 1:9 ratio (weight:volume) and homogenized at 2,500–3,000 rpm in an ice bath. Subsequently, the homogenate was centrifuged at 10% for 10 min, and the supernatant was used for ELISA to measure the levels of TNF-a, MMP9, HIF-1α, FN1, α-SMA, and VEGF. We also measured their expression in the supernatant from NIH3T3 cells by using an ELISA kit (MULTI SCIENCES, Hangzhou, China), following the manufacturer’s instructions. Each experiment was performed in triplicate by using an ELISA reader (ELX800, BioTek Instruments, USA).

Fluorescence In Situ Hybridization (FISH)

The paraffin sections of the ulcer tissue were first treated with a pre-hybridization solution, followed by overnight hybridization with the miR-122-5p probe (sequence: 5'-UGGAGUGUGACAAUGGUGUUUG-3', concentration: 500 nM) in G3045 solution. Subsequently, a preheated branch probe hybridization solution was applied, and the sections were washed with a preheated Saline-Sodium Citrate solution. Afterward, the appropriate signal probe was added, and the sections were sealed with 3% BSA. The sections were treated with the primary antibody clip3 (rabbit, dilution: 1:100), washed with PBS, and exposed to a fluorescein-labeled secondary antibody (488-labeled goat anti-rabbit). Finally, the nuclei were restained with DAPI, and the images were captured.

Statistical Analysis

We obtained the data for this experiment from at least three independent trials and analyzed them using GraphPad Prism (GraphPad, United States). Statistical analyses involved one-way and two-way analysis of variance to compare multiple groups, with pairwise comparisons within groups conducted using Student’s t-test. Statistical significance was defined as p < 0.05.

miRNA Expression Profiles in Patients With DFU and DU Mice

DU tissues comprise various elements, such as miRNAs, DNAs, and proteins. Particularly, miRNAs are essential for cellular communication via posttranscriptional regulation. We conducted miRNA sequencing and bioinformatics analysis to analyze the miRNA expression in DU. The analysis of miRNA expression between normal and DU mice skin tissues showed many differently expressed miRNAs, with miRNA-122-5p showing the most significant difference (Fig. 1A). We compared the miRNA expression levels in skin tissues from normal and DU mice. Using a twofold change and p < 0.05 as the threshold cutoff, 22 miRNAs were identified as differentially expressed in different types of skin tissues. The results showed that miR-31-5p, miR-154-5p, miR-122-5p, miR-206-3p, and miR-375-3p were the top five upregulated miRNAs and miR-142a-3p, miR-129-5p, miR-203b-3p, miR-335-3p, and miR-708-3p were the top five downregulated miRNAs in DU mice (Fig. 1B). The stacked bar chart of expression levels illustrated the distribution of the top 10 miRNAs in each group (Fig. 1C). To gain insight into the potential biological processes linked to miRNA differences in skin tissues from normal and DU mice, we conducted Gene Ontology (GO) and KEGG analyses using the DAVID 6.8 online bioinformatics tool. The GO database categorizes and annotates genes and their products based on biological processes, cellular components, and molecular functions²⁹. Among the biological process terms, the differentially expressed genes were predominantly enriched in regulating cellular component biogenesis, biological regulation, cell aggregation, and extracellular region (Fig. 1D). The KEGG database categorizes biological pathways into seven main areas: metabolism, genetic information processing, environmental information processing, cellular processes, organismal systems, human diseases, and drug development. KEGG annotation and enrichment analysis highlight the roles of miRNA target genes in processes, such as cell cycle, cell growth, and cell death, which aid in understanding biological processes and gene–genome relationships (Fig. 1E). We examined miR-122-5p expression levels in wound tissues from patients with DFU and STZ-induced diabetic mice to determine its association with poor wound healing, indicating a notable upregulation of miR-122-5p in the wound tissues of patients with DFU and diabetic mice (Fig. 1F).

AAVDJ-miR-122-5p Updecelerated Wound Healing in Diabetic Mice

More attention should be given to the impact of miR-122-5p on wound healing in diabetes. We assessed the extent of wound healing and gathered skin tissue samples at 3, 7, and 14 days following treatment (Fig. 2A). Macroscopically, wound areas gradually became smaller in all groups, On day 7, the wounds in the control and DU groups began to contract, whereas the AAVDJ-miR-122-5p group showed no significant changes (Fig. 2B and 2E). The healing speed of diabetic wounds injected with AAVDJ-miR-122-5p demonstrated significantly slower wound healing compared to both the DU group and the control group. The AAVDJ-miR-122-5p group achieved the lowest healing area of 2.87 ± 0.02 and 1.20 ± 0.12 cm² on days 7 and 14, which were superior to the control and DU groups. By contrast, the DU group obtained 2.01 ± 0.17 and 1.02 ± 0.14 cm2 (Fig. 2C and 2D). The harvested wound tissues were used for HE and Masson staining. Histologic analysis showed that the epidermis and dermis became thinner and had increased inflammatory cells (i.e., polymorphonuclear leukocytes and plasma cells) in the AAVDJ-miR-122-5p group wounds compared with the control group wounds within 14 days after the treatment (Fig. 2F). Furthermore, wounds injected with AAVDJ-miR-122-5p showed inferior granulation formation, collagen deposition, and denser alignment (Fig. 2G), indicating that miR-122-5p prevented diabetic wound healing by decreasing reepithelization.

MiR-122-5p Upregulated MMP9 to Target Inflammatory Factors During the Transition From the Inflammatory to the Proliferative Phase

We estimated the cured effect of three different skin tissue types. During the initial inflammation phase, which typically lasts 3 days in acute wounds, the control group had a pronounced acute inflammatory response characterized by neutrophil infiltration and elevated proinflammatory cytokine levels. In contrast, the AAVDJ-miR-122-5p group had a significantly reduced neutrophil and inflammatory cell infiltration. The immunohistochemistry results showed that the mice injected with AAVDJ-miR-122-5p had a positive expression of MMP9, TNF-α, and HIF-1α, whereas the control group showed a significant inhibition (Fig. 3A and 3B). Additionally, MMP9 and proinflammatory marker (TNF-α and HIF-1α) expression levels were quantified using qRT-PCR, showing findings consistent with anticipated outcomes (Fig. 3C). The WB results showed that MMP9, TNF-α, and HIF-1α expression levels significantly increased in diabetic mice, whereas those proteins were activated through miR-122-5p overexpression (Fig. 3D and 3E), which were consistent with the in vivo observations (Fig. 3F and 3G).

MiR-122-5p Reduced Vascular Endothelial Growth and Delayed Fibrosis During the Transition From the Inflammatory to the Proliferative Phase

After 14 days of repair, during the late proliferation phase, a hard film was formed on the wound surface with miR-122-5p overexpression, the wound had not fully healed, and hair follicles were absent. In contrast, the control group exhibited nearly complete re-epithelialization with distinct epidermal and dermal structures, and a few hair follicles were found. The immunohistochemistry results showed that mice injected with AAVDJ-miR-122-5p had negative expression levels of VEGF, FN1, and α-SMA, whereas the control group showed significant inhibition (Fig. 4A and 4B). Furthermore, we used qRT-PCR to quantify VEGF and fibrosis marker expression levels (FN1 and α-SMA), which were consistent with our expected outcomes (Fig. 4C). The WB results showed that VEGF, FN1, and α-SMA expression levels significantly decreased in diabetic mice, whereas these proteins were also activated through overexpression of miR-122-5p (Fig. 4D and 4E), which were consistent with the in vivo observations (Fig. 4F and 4G).

AAVDJ-miR-122-5p Updecelerated the Transition from the Inflammatory to the Proliferative Stage

We conducted an in situ hybridization using a miR-122-5p-specific locked oligonucleotide probe on sections from harvested skin wounds. In the skin of diabetic mice, miR-122-5p expression is increased compared with normal mice. Additionally, the signal corresponding to miR-122-5p was predominantly observed in epidermal keratinocytes and fibroblasts (Fig. 5A). Additionally, miR-122-5p increased diabetic-induced M1 macrophage infiltration and inhibited M2 macrophage polarization (Fig. 5B). The results from the cell scratch assay demonstrated that miR-122-5p attenuated the migratory ability of NIH3T3s (Fig. 5C). At 36 h, treatment with miR-122-5p inhibitors resulted in a scratch healing proportion of approximately 44.0%, compared with the 10.33% observed with miR-122-5p mimics (Fig. 5D). In wound tissues from DU and NIH3T3s, miR-122-5p overexpression led to increased TNF-α, MMP9, and HIF-1α levels (Fig. 5E), whereas FN1, VEGF, and α-SMA expression levels were decreased (Fig. 5F).

In this study, the impaired transition from the inflammatory to the proliferative phase is a critical factor that hinders DU healing. Increased M1 macrophages, decreased M2 anti-inflammatory macrophages, and their imbalanced ratio are important factors that contribute to prolonged inflammation³⁰. The transformation from M1 to M2 macrophages, a responsive process influenced by the local microenvironment, correlates with compromised wound healing, reduced angiogenesis, and diminished collagen formation³¹. This imbalance leads to restricted fibroblast proliferation and migration and constitutes a significant mechanism for delayed granulation tissue formation³². The precise molecular mechanisms preventing the timely transition from the inflammatory to the proliferative phase remain unclear. Numerous studies have confirmed that miRNAs regulate the transition from chronic inflammation in wounds to epithelialization. Recently, miR-185-5p, miR-155-5p, miR-195-5p, and miR-205-5p inhibitors or agonists have been identified^33–35, highlighting their significant role in regulating inflammatory responses, cellular proliferation, and wound remodeling in DUs. Although earlier research has established the efficacy of miRNAs in diabetic wound healing, only a few are undergoing clinical trials^{36, 37}. Hence, additional research is necessary to advance the therapeutic potential of miRNAs in improving healing outcomes for diabetic wounds. We investigated these concerns and identified that miR-122-5p was significantly associated with DFU, noting higher levels of miR-122-5p in STZ-induced type 2 diabetes mice compared with normal mice.

The miR-122-5p expression level was upregulated in wound tissue of diabetes. Our findings were supported by studies suggesting that elevated miR-122 levels play a significant role in initiating metabolic syndrome (MetS) in experimental mice. MetS manifests with high blood sugar, abnormal lipid levels, insulin resistance, and central obesity³⁸. MiR-122 has been widely investigated as a serum biomarker that indicates the severity of hepatocyte injury, leading to its release into the circulation. Elevated miR-122 levels have been detected even before the occurrence of drug-induced liver damage³⁹. Regmi et al. found dysregulated serum expression levels of miR-122 in patients with diabetic kidney disease, which was significantly related to clinical parameters, e.g., albuminuria, estimated glomerular filtration rate, blood glucose, and lipid profiles⁴⁰. Wang et al. found that miR-122-5p was upregulated in coronary heart disease, indicating its potential use as a non-invasive marker for diagnosing the extent of coronary atherosclerosis⁴¹. These studies collectively indicate that miR-122-5p could play a role in the onset and progression of diabetes and its complications.

As pivotal posttranscriptional regulators, miRNAs are involved in numerous physiological and pathological processes. A single miRNA can target multiple genes concurrently, thereby creating a network amplification effect⁴². MiRNAs are considered stable and suitable for clinical applications. Numerous studies have highlighted the significant roles of miRNAs in wound healing. For instance, miR-26a inhibition in diabetic wounds enhances the formation of granulation tissue and blood vessels. Blocking miR-29a enhances collagen content and restores the compromised biomechanical properties of diabetic skin. We examined the miRNA profiles in the skin tissues of DU mice and found that several miRNAs showed changes in expression levels, including miR-122-5p that was highly expressed in DU mice.

This study also investigates miR-122-5p function in diabetic wound tissue. MiR-122-5p hindered the progression of diabetic ulcers from the inflammatory to the proliferative phase by examining inflammatory factors (TNF-α, MMP9, and HIF-1α) and fibrosis markers (FN1, VEGF, and α-SMA) in diabetic wound tissue. In summary, miR-122-5p mimic therapy exacerbated inflammatory responses in diabetic wound tissue and hindered the epithelialization process.

To elucidate the internal mechanism of miR-122-5p in the wound healing of diabetes, we selected the pivotal cells involved in both the inflammatory and proliferative phases of wound healing: macrophages and fibroblasts. We investigated the expression of miR-122-5p, inflammatory factors, and fibrosis markers in NIH3T3 cells under LPS-induced RAW264.7 cell cultures. The results showed that the inflammatory factor expression levels (TNF-α and HIF-1α) were increased, and fibrosis markers (FN1 and α-SMA) were decreased, indicating that miRNA-122-5p may be associated with inflammation and epithelialization. In addition, adding miRNA-122-5p inhibitors could inhibit TNF-αand HIF-1α high expression. Besides, a significantly increased miR-122-5p expression in mice diabetic wound tissue was consistent with DFU skin. Based on the prediction of the effect of miR-122-5p mimic in vitro, we confirmed its effect on diabetic wound healing by decelerating wound healing after AAVDJ-miR-122-5p injection treatment in diabetic mice.

MiR-122-5p targets and regulates MMP-9. Studies have indicated that at the molecular level, LINC01296 acts as a sponge for miR-122, which targets MMP-9. This regulatory pathway, LINC01296/miR-122/MMP-9, may play a crucial role in modulating gastric cancer oncogenesis⁴³. The mechanism of our study may also be exerted by targeting MMP9. Evidence suggests the central role of TNF-α in the pathomechanism of DFU. MiR-122-5p inhibition reduced TNF-α production. Research showed that TNF-α levels in patients with type 2 diabetes and obesity are elevated in conjunction with increased miR-122-5p expression⁴⁴. Additionally, early studies have indicated an interplay between miR-122 and HIF-1α, with miR-122 being a fine-tuning factor in hypoxic responses⁴⁵. HIF-1α and miR-122 are proposed as candidate drivers of cancer metabolic reprogramming⁴⁶. Currently, research on the relationship between HIF-1α-dependent miR-122 regulation and DFU is lacking.

MiR-122 has shown promise as a non-invasive biomarker for liver fibrosis in hepatitis C virus (HCV)-related chronic liver disease⁴⁷. Miravirsen, the pioneering anti-miRNA agent to advance to clinical trials, specifically targets miR-122 to treat HCV infection. Moreover, In its phase II trial (NCT01200420), miravirsen demonstrated notable efficacy and safety in combating chronic HCV genotype 1 infection⁴⁸. This contrasts with the fibrosis level in ex vivo skin wounds. Our study showed that miR-122-5p overexpression reduces fibrosis marker levels, such as FN1 and α-SMA, which contribute to delayed wound healing. Although multiple cytokines, including fibroblast growth factor, placenta growth factor, platelet-derived growth factor, and transforming growth factor beta, contribute to angiogenesis, VEGF plays a central role in its initiation⁴⁹. MiR-122-5p is a potent pro-angiogenic factor that activates VEGF signaling, promoting angiogenesis in vivo and in vitro. Inhibition of circulating miR-122-5p or liver-specific knockdown significantly attenuated exercise-induced proangiogenic effects in skeletal muscles and improved muscle performance in mice⁵⁰.

In summary, we performed bioinformatics and experimental evaluations of miR-122-5p against DU. However, miRNA sequencing has inherent limitations. The data were sourced from public databases that undergo continuous updates. Additionally, targets and pathways identified through network analysis may introduce biases into the study. Therefore, further validation is required to confirm whether miR-122-5p targeting MMP9 affects the transition from the inflammatory to the proliferative phase in DFU.

MiR-122-5p decelerated wound healing in diabetic mice by hindering re-epithelialization, increasing inflammation during the healing process, and slowing the transition from the inflammatory to the proliferative stage.

Data Availability

The datasets analysed during the current study are available in theGEO ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE275847). These experimental raw data are available from the corresponding authors in accordance with the journal's specific guidelines for data sharing in scientific research.

Sources of funding

The study was funded by the National Natural Science Foundation of China (82274528); Shanghai Municipal Health Commission Scientific Research Programme Mission Statement (202240228); Training Program for High-caliber Talents of Clinical Research at Affiliated Hospitals of SHUTCM (2023LCRC06).

Conflicts of Interest

The authors report no conflicts of interest in this work.

Author contributions

MY and SJ conceived and coordinated the study. MY drafted the article. WF revised the manuscript. MY, HH, HS, XH, ZZ, YC designed, performed and analyzed the experiments. GL supervised the study and acquired funding for the work. All authors read and approved the published version of the manuscript.

Armstrong, D. G., Boulton, A. & Bus, S. A. Diabetic Foot Ulcers and Their Recurrence. N Engl. J. Med. 376, 2367–2375 (2017).
Falanga, V. et al. Chronic wounds. Nat. Rev. Dis. Primers. 8, 50 (2022).
Zhao, L. et al. Combined Transplantation of Mesenchymal Stem Cells and Endothelial Colony-Forming Cells Accelerates Refractory Diabetic Foot Ulcer Healing. Stem Cells Int. 2020, 8863649 (2020).
Hashempour, R. et al. Economic burden of diabetic foot ulcer: a case of Iran. BMC Health Serv. Res. 24, 363 (2024).
Zhang, S. et al. Polysaccharide-based hydrogel promotes skin wound repair and research progress on its repair mechanism. Int. J. Biol. Macromol. 248, 125949 (2023).
Yan, F. et al. High-throughput fluorescent screening of beta-lactamase inhibitors to improve antibiotic treatment strategies for tuberculosis. Biosens. Bioelectron. 216, 114606 (2022).
Cui, T. et al. Micro-Gel Ensembles for Accelerated Healing of Chronic Wound via pH Regulation. Adv. Sci. (Weinh). 9, e2201254 (2022).
Saraswathibhatla, A., Indana, D. & Chaudhuri, O. Cell-extracellular matrix mechanotransduction in 3D. Nat. Rev. Mol. Cell. Biol. 24, 495–516 (2023).
Cioce, A., Cavani, A., Cattani, C. & Scopelliti, F. Role of the Skin Immune System in Wound Healing. Cells 13, (2024).
Margraf, A., Lowell, C. A. & Zarbock, A. Neutrophils in acute inflammation: current concepts and translational implications. Blood. 139, 2130–2144 (2022).
Huang, C. & Ogawa, R. Role of Inflammasomes in Keloids and Hypertrophic Scars-Lessons Learned from Chronic Diabetic Wounds and Skin Fibrosis. Int. J. Mol. Sci. 23, (2022).
Saklani, M. et al. Laminin mimetic angiogenic and collagen peptide hydrogel for enhance dermal wound healing. Biomater. Adv. 158, 213761 (2024).
Diller, R. B. & Tabor, A. J. The Role of the Extracellular Matrix (ECM) in Wound Healing: A Review. Biomimetics (Basel) 7, (2022).
Shi, Z., Yao, C., Shui, Y., Li, S. & Yan, H. Research progress on the mechanism of angiogenesis in wound repair and regeneration. Front. Physiol. 14, 1284981 (2023).
Badr, G. et al. Cold atmospheric plasma induces the curing mechanism of diabetic wounds by regulating the oxidative stress mediators iNOS and NO, the pyroptotic mediators NLRP-3, Caspase-1 and IL-1beta and the angiogenesis mediators VEGF and Ang-1. Biomed. Pharmacother. 169, 115934 (2023).
Zhou, P., Feng, H., Qin, W. & Li, Q. KRT17 from skin cells with high glucose stimulation promotes keratinocytes proliferation and migration. Front. Endocrinol. (Lausanne). 14, 1237048 (2023).
Anuradha, U., Mehra, N. K. & Khatri, D. K. Understanding molecular mechanisms and miRNA-based targets in diabetes foot ulcers. Mol. Biol. Rep. 51, 82 (2024).
De Sousa, R. & Improta-Caria, A. C. Regulation of microRNAs in Alzheimer s disease, type 2 diabetes, and aerobic exercise training. Metab. Brain Dis. 37, 559–580 (2022).
Li, S. et al. Editorial: Clinical and genetic determinants of diabetes and complications. Front. Endocrinol. (Lausanne). 14, 1245837 (2023).
Heydarzadeh, S., Ranjbar, M., Karimi, F., Seif, F. & Alivand, M. R. Overview of host miRNA properties and their association with epigenetics, long non-coding RNAs, and Xeno-infectious factors. Cell. Biosci. 11, 43 (2021).
St-Denis-Bissonnette, F. et al. Applications of Extracellular Vesicles in Triple-Negative Breast Cancer. Cancers (Basel) 14, (2022).
Franczyk, B. et al. miRNA biomarkers in renal disease. Int. Urol. Nephrol. 54, 575–588 (2022).
Zenlander, R., Salter, H., Gilg, S., Eggertsen, G. & Stal, P. MicroRNAs as Plasma Biomarkers of Hepatocellular Carcinoma in Patients with Liver Cirrhosis-A Cross-Sectional Study. Int. J. Mol. Sci. 25, (2024).
Li, L. et al. Correlation between alterations of gut microbiota and miR-122-5p expression in patients with type 2 diabetes mellitus. Ann. Transl Med. 8, 1481 (2020).
Cheng, Y. et al. Prostaglandin F2alpha protects against pericyte apoptosis by inhibiting the PI3K/Akt/GSK3beta/beta-catenin signaling pathway. Ann. Transl Med. 9, 1021 (2021).
Shang, W. et al. Static Magnetic Field Accelerates Diabetic Wound Healing by Facilitating Resolution of Inflammation. J. Diabetes Res. 2019, 5641271 (2019).
Yan, S. et al. Mitigation of radiation-induced skin injury by AAV2-mediated MnSOD gene therapy. J. Gene Med. 10, 1012–1018 (2008).
Qiu, Y. et al. A Novel Multilayer Composite Membrane for Wound Healing in Mice Skin Defect Model. Polym. (Basel) 12, (2020).
Herzfeldt, A. K. et al. Complementary CRISPR screen highlights the contrasting role of membrane-bound and soluble ICAM-1 in regulating antigen-specific tumor cell killing by cytotoxic T cells. Elife 12, (2023).
Strizova, Z. et al. M1/M2 macrophages and their overlaps - myth or reality? Clin. Sci. (Lond). 137, 1067–1093 (2023).
Ganesh, G. V. & Ramkumar, K. M. Macrophage mediation in normal and diabetic wound healing responses. Inflamm. Res. 69, 347–363 (2020).
Younesi, F. S., Miller, A. E., Barker, T. H., Rossi, F. & Hinz, B. Fibroblast and myofibroblast activation in normal tissue repair and fibrosis. Nat. Rev. Mol. Cell. Biol., (2024).
Wang, K. X. et al. Accelerated Wound Healing in Diabetic Rat by miRNA-185-5p and Its Anti-Inflammatory Activity. Diabetes Metab. Syndr. Obes. 16, 1657–1667 (2023).
Liu, J. et al. MiR-195-5p and miR-205-5p in extracellular vesicles isolated from diabetic foot ulcer wound fluid decrease angiogenesis by inhibiting VEGFA expression. Aging (Albany NY). 13, 19805–19821 (2021).
Lou, R. et al. Exosomal miRNA-155-5p from M1-polarized macrophages suppresses angiogenesis by targeting GDF6 to interrupt diabetic wound healing. Mol. Ther. Nucleic Acids. 34, 102074 (2023).
Xu, M. et al. Increased Expression of miR-155 in Peripheral Blood and Wound Margin Tissue of Type 2 Diabetes Mellitus Patients Associated with Diabetic Foot Ulcer. Diabetes Metab. Syndr. Obes. 15, 3415–3428 (2022).
Li, X., Tang, Y., Jia, Z., Zhao, X. & Chen, M. Decreased expression of miR-24 in peripheral plasma of type 2 diabetes mellitus patients associated with diabetic foot ulcer. Wound Repair. Regen. 28, 728–738 (2020).
Castano, C., Kalko, S., Novials, A. & Parrizas, M. Obesity-associated exosomal miRNAs modulate glucose and lipid metabolism in mice. Proc. Natl. Acad. Sci. U S A. 115, 12158–12163 (2018).
Church, R. J. et al. Candidate biomarkers for the diagnosis and prognosis of drug-induced liver injury: An international collaborative effort. Hepatology. 69, 760–773 (2019).
Regmi, A. et al. Evaluation of Serum microRNAs in Patients with Diabetic Kidney Disease: A Nested Case-Controlled Study and Bioinformatics Analysis. Med. Sci. Monit. 25, 1699–1708 (2019).
Wang, Y. L. & Yu, W. Association of circulating microRNA-122 with presence and severity of atherosclerotic lesions. PeerJ. 6, e5218 (2018).
O'Brien, J., Hayder, H., Zayed, Y. & Peng, C. Overview of MicroRNA Biogenesis, Mechanisms of Actions, and Circulation. Front. Endocrinol. (Lausanne). 9, 402 (2018).
Qin, Q. H., Yin, Z. Q., Li, Y., Wang, B. G. & Zhang, M. F. Long intergenic noncoding RNA 01296 aggravates gastric cancer cells progress through miR-122/MMP-9. Biomed. Pharmacother. 97, 450–457 (2018).
Mohany, K. M., Al, R. O., Al-Wutayd, O. & Al-Nafeesah, A. Investigation of the levels of circulating miR-29a, miR-122, sestrin 2 and inflammatory markers in obese children with/without type 2 diabetes: a case control study. BMC Endocr. Disord. 21, 152 (2021).
Ambade, A., Satishchandran, A. & Szabo, G. Alcoholic hepatitis accelerates early hepatobiliary cancer by increasing stemness and miR-122-mediated HIF-1alpha activation. Sci. Rep. 6, 21340 (2016).
Pelizzaro, F. et al. Circulating MicroRNA-21 and MicroRNA-122 as Prognostic Biomarkers in Hepatocellular Carcinoma Patients Treated with Transarterial Chemoembolization. Biomedicines 9, (2021).
Ma, J. et al. microRNA-122 inhibits hepatic stellate cell proliferation and activation in vitro and represses carbon tetrachloride-induced liver cirrhosis in mice. Ann. Hepatol. 27, 100700 (2022).
Baek, J., Kang, S. & Min, H. MicroRNA-targeting therapeutics for hepatitis C. Arch. Pharm. Res. 37, 299–305 (2014).
Belvedere, R., Novizio, N., Morello, S. & Petrella, A. The combination of mesoglycan and VEGF promotes skin wound repair by enhancing the activation of endothelial cells and fibroblasts and their cross-talk. Sci. Rep. 12, 11041 (2022).
Lou, J. et al. Exercise promotes angiogenesis by enhancing endothelial cell fatty acid utilization via liver-derived extracellular vesicle miR-122-5p. J. Sport Health Sci. 11, 495–508 (2022).

Table 1

Primer sequence.
Primer	Forward	Reverse
TNF-a	ACTGAACTTCGGGGTGATTGGTCC	CAGCCTTGTCCCTTGAAGAGAACC
MMP9	CTGGACAGCCAGACACTAAAG	CTCGCGGCAAGTCTTCAGAG
HIF-1α	GCCTTAACCTGTCTGCCACTT	TTCGCTTCCTCTGAGCATTCTG
FN1	GTTCGGGAGGAGGTTGTTACC	GAGTCATCTGTAGGCTGGTTTAGG
α-SMA	GTCCCAGACATCAGGGAGTAA	TCGGATACTTCAGCGTCAGGA
VEGF	GAGGTCAAGGCTTTTGAAGGC	CTGTCCTGGTATTGAGGGTGG
GAPDH	CCACTCACGGCAAATTCAAC	CTCCACGACATACTCAGCAC

No competing interests reported.

Westernblots.pptx

Download PDF

Editorial decision: Revision requested
16 Oct, 2024
Reviews received at journal
15 Oct, 2024
Reviews received at journal
06 Oct, 2024
Reviews received at journal
04 Oct, 2024
Reviewers agreed at journal
29 Sep, 2024
Reviewers agreed at journal
27 Sep, 2024
Reviewers agreed at journal
23 Sep, 2024
Reviewers invited by journal
22 Sep, 2024
Editor assigned by journal
17 Sep, 2024
Editor invited by journal
06 Sep, 2024
Submission checks completed at journal
04 Sep, 2024
First submitted to journal
07 Aug, 2024

You are reading this latest preprint version

MiRNA-122-5p is Upregulated in Diabetic Foot Ulcers and Decelerates the Transition from the Inflammatory to the Proliferative Stage

Status:

Version 1

Abstract

Figures

Introduction

Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1