Anti-Inflammatory Effects of 1,8-cineol(Eucalyptol) via NF-κB/COX-2 pathway in BEAS-2B cells and alleviates bronchoconstriction and airway hyperreactivity in ovalbumin sensitized mice

doi:10.21203/rs.3.rs-4880907/v1

Download PDF

Research Article

Anti-Inflammatory Effects of 1,8-cineol(Eucalyptol) via NF-κB/COX-2 pathway in BEAS-2B cells and alleviates bronchoconstriction and airway hyperreactivity in ovalbumin sensitized mice

https://doi.org/10.21203/rs.3.rs-4880907/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Objective and Design: Asthma is becoming an inflammatory disease of the airways involving a variety of inflammatory cells and cell components.In this study,we attempted to investigate the protective effect and underlying mechanism potential of a plant derived natural compound,1,8-cineol.Transforming growth factor-beta TGF-β1-induced epithelial-mesenchymal transition (EMT) in bronchial epithelial cells contributes to airway wall remodeling in asthma. Epithelial-mesenchymal transition (EMT) represents an important source of myofibroblasts, contributing to airway remodelling. This study aims to explore the detailed mechanism in TGF-β1-stimulated BEAS-2B cells by which 1,8-cineol might exert effects on the development of asthma. Here, we investigated the role of 1,8-cineol,an active ingredient in Eucalyptus globulus Labill,in TGF-β1-induced EMT in bronchial epithelial cells and to elucidate the possible mechanisms underlying its biological effects.

Material: We used a murine model of airway hyperreactivity, which mimicked some of the characteristic features of asthma. Male BALB/c mice (6–8 weeks) were used for this study. BEAS-2B cells were used to assess the effect of 1,8-cineol on EMT and its interaction with TGF-β1 signalling. To assess the role of 1,8-cineol in vivo and its impact on lung function.

Methods: OVA-induced asthma and PSA model were used to evaluate the effect of 1,8-cineol in vivo.Lung tissues were collected for H&E and PAS staining. ELISA was used to determine level of IgE and chemokines (IL-4, IL-13, and IL-17). Nuclear factor-κB (NF-κB) and cyclooxygenase-2 (COX-2) signaling pathway were assessed. Human bronchial epithelial cells (BEAS-2B) were treated with different concentrations (1,10,and 100 mg/L,30 min) of 1,8-cineol to select its suitable concentration. A human bronchial epithelial cell line were incubated with transforming growth factor-beta (TGF-β) to induce EMT, whose phenotype of cells were evaluated by the expressions of EMT markers [alpha-smooth muscle actin (α-SMA), E-cadherin, and N-cadherin] and cell migration capacity.

Results:In asthmatic model mice, 1,8-cineol treatment relieved airway wall remodeling and decreased expressions of EMT markers (α-SMA and N-cadherin). In TGF-β-treated bronchial epithelial cells, 1,8-cineol treatment decreased the mRNA and protein levels of EMT markers (α-SMA and N-cadherin) without impairing cell viability.Our results showed that OVA induction resulted in a significant increase in R_L, accompanied by a significant decrease in C_dyn.Various inflammatory cells such as eosinophils and lymphocytes were infiltrated and aggregated around the airway of mice in OVA group.1,8-cineol and BAY-11-7083 can improve the pathological changes of airway smooth muscle spasm and lumen stenosis. Compared with Control group, OVA specific antibody IgE content in serum in other groups was up-regulated. The levels of interleukin- IL-4, IL-13,OVA-specific IgE in BALF, and the percentage of IL-17 in the lungs were markedly increased.Furthermore,the expression of NF-κB p-P65,NF-κB P65 and COX-2 in airways were significantly upregulated.Protein expression of N-cadherin,COX-2,NF-κB p-P65/NF-κB P65 was up-regulated in TGF-β1 group compared with Control group.

Conclusion:Our study showed that 1,8-cineol inhibited TGF-β1-induced EMT in bronchial epithelial cells and found that the anti-EMT activity of 1,8-cineol might be related to its regulatory effect on NF-κB/COX-2 pathway.

Ovalbumin-induced acute asthma

NF-κB/COX-2 pathway

8-cineol

airway inflammation

Th2 cytokine

airway remodeling

Asthma is a heterogeneous chronic inflammatory disease affecting airways in the lung, which is closely associated with airway inflammation and airway remodeling, and characterized by the airway hyperresponsiveness (AHR)[1].The risk of developing asthma has increased due to increased air pollution, stress and lack of nutrient synthesis due to increased internal activity.To study the occurrence, development and pathological characteristics of airway inflammation and airway remodeling in asthma is of great significance for finding more effective methods to treat asthma [2]. According to the 2015 Global Burden of Disease Report, asthma affects an estimated 300 million people worldwide[3].Chronic inflammation is often accompanied by airway remodeling in asthma. Although the pathogenesis of airway remodeling remains elusive, the chronic inflammatory response in the airway is a major force driving the remodeling process. Invasive inflammatory cells, primarily eosinophils and mast cells, release overactive enzymes such as major basic proteins (MBP),neurotoxins, peroxidase, and cationic proteins that cause lung tissue damage in asthmatic patients, triggering abnormalities the usual repair route[4].Therefore, for recurrent chronic asthma, treatment options should focus on how to effectively slow airway remodeling. The combination of inhaled corticosteroids (ICS) and long acting beta-agonists (LABA) can relieve asthma symptoms and reduce the frequency of wheezing attacks. But for those with asthma who fail to gain control through ICS and LABA, treatment options are limited. There is usually no additional benefit associated with an increased dose of ICS, but there is an increased risk of side effects.

In the pathogenesis of severe asthma, not only eosinophils but also mast cells or neutrophils play important roles. Airway wall remodeling has been described as changes to the composition, thickness, and volume of the airway wall [8]. Epithelial-mesenchymal transition (EMT) is a critical pathophysiological process in which epithelial cells transform towards differentiated mesenchymal cells by losing epithelial cell polarity and the epithelial cell marker E-cadherin, as well as acquiring migration ability and the mesenchymal cell marker Vimentin. The occurrence of EMT is recognized to drive airway remodeling in asthma[9,10]. As reported, The EMT process can induce organ fibrosis, tissue repair and cancer metastasis. Suppression of EMT is demonstrated to alleviate airway hyperresponsiveness and fibrosis. TGF-β1 is a wellknown cytokine that contributes to EMT and collagen deposition which can exacerbate the development of asthma. [11].

Also, bone marrow-derived mesenchymal stem cells reduce EMT in the airway epithelium, thereby alleviating allergic inflammation in the airways and decreasing airway wall remodeling in asthmatic rats [13]. Thus, EMT has been proposed as a promising target for the treatment of asthma.

Amygdalin is a main active ingredient in Chinese raw bitter almonds and has a wide range of pharmacological properties, such as being anti-oxidative and anti-inflammatory [14].Recently, emerging evidence has indicated a regulatory effect of amygdalin on EMT progression. Wang et al. reported that amygdalin strikingly decreased vimentin and alpha-smooth muscle actin (α-SMA)-two mesenchymal cell markers-contents while increasing E-cadherin-a core protein of the epithelial adherens junction—content in the renal tissue of diabetic nephropathy rats [15]. Wang et al. revealed the protective effect of amygdalin on EMT in a mouse model of chronic obstructive pulmonary disease [16]. Mahuang decoction (MHD) is a Chinese prescription that has been used for asthma relief [17]. Among its seven main active ingredients, amygdalin has been confirmed to play the most prominent role in regulating asthma-involved cytokine contents in asthmatic rats [18]. However, it remains unclear whether amygdalin exhibits a therapeutic effect on asthma by suppressing EMT.

The main pathological changes of airway remodeling were epithelial injury and plasticity,fibroblast/myofibroblast increase,airway smooth muscle hyperplasia/hypertrophy,basement membrane thickening and angiogenesis.

Airway remodeling is often associated with a severe phenotype of the disease. Chronic allergic inflammation is the initiation time of remodeling as well as the above pathological changes. The study concluded that inflammation was obtained in transgenic mice that overexpressed IL-4 and IL-5 in the lungs. In other words, the airway of mice with overexpression of IL-4, IL-5 and IL-13 showed obvious goblet cell proliferation, mucus thrombin formation, airway basement membrane thickening, and airway hyperreactivity[4]. IL-4 was found in BALF and serum of asthmatic patients,IL-4 was overexpressed in bronchial tissue biopsy. IL-4 receptor a(IL-4Ra) and Stat6, the most important signaling pathways of IL-4, were also overexpressed in patients with asthma. In vitro experiments, stimulating mononuclear cells with allergen in asthmatic patients can induce IL-4 secretion.[5].IL-4 can induce B cells to synthesize lgE, participate in mast cell recruitment, and up-regulate mast cell high-affinity IgE receptors [24]. IL-5 is mainly involved in regulating the recruitment, activation and differentiation of eosinophils. A large number of data in animal experiments and in vitro experiments show that anti-IL-5 treatment can effectively alleviate the attack and symptoms of asthma, especially severe asthma T lymphocytes in lung tissue.Cells are the main source of IL-5 but do not express IL-5Ra. IL-5R can be expressed on the surface of eosinophils and basophils, and there is a feedback regulatory mechanism for IL-5 production [25]. Numerous experimental evidences show that the level of IL-5 mRNA found in bronchial biopsy of asthma is higher than that in healthy control group, and the level of IL-5 is correlated with the severity of asthma. Inhalation of recombinant human IL-5 induced a large increase in eosinophils in sputum. These data confirm the increased expression of IL-5 in patients with asthma, which has also become a new target for asthma treatment. [6].In addition, IL-4 and IL-13 are also very crucial in airway dysfunction and reconstruction following chronic exposure to allergen [7].

NF-kappa B is closely associated with rheumatoid arthritis, atherosclerosis, multiple sclerosis, chronic inflammatory demyelinating poly radiculoneuritis, inflammatory bowel disease and asthma [8]. NF-kappa B is a nuclear transcription factor with extensive biological activity. It is involved in the regulation of almost all genes that regulate the expression of asthma-related inflammatory factors [9]. It plays a role in inflammatory reactions through the expression of inflammatory media, adhesion molecules, and enzymes [10]. Inhibition of NF-kappa B expression may reduce airway inflammation and airway modification [11]. Bay-11-7082 is currently widely used as an anti-inflammatory agent and is also marketed as an inhibitor of transcription factor NF-kappa B activation [12]. In the ground state, NF-kappa B binds to a regulatory protein called inhibitors of κB and remains inactive in the cell brush. In response to inflammatory cytokines or cellular stresses, IκB is phosphorylated by IκB kinase (IKK) along with IκB ubiquitination and proteolysis degradation of IκB, leading to kapa B activation and nuclear transfer [13,14]. Bay-11-7082 has been reported to inhibit IKK activity and to maintain the inactive complex of NF-κB with IκB [14].

NF-κB signaling pathway also plays a key role in regulating inflammatory response through COX transcription [15, 16]. iNOS and COX-2 induced by nuclear transcription factor κB are important mediators in the occurrence of pulmonary inflammation. In addition, the expression of iNOS and the activation of NF-κB by COX-2 increased [17, 18]. iNOS and COX-2 themselves, on the other hand, are involved in the activation of NF-κB, which can subsequently induce other inflammatory mediators and cells. [19] In addition, studies have shown that IL-4 can modify the activation of nuclear factor κB and other factor-induced NF-κB[20], and NF-κB also plays an important role in the pathogenesis of IL-13-induced asthma tissue damage [21, 22]. Activation of NF-κB is critical in inflammatory responses by inducing transcription of pro-inflammatory genes and has been associated with airway inflammatory diseases such as asthma [13]. As the downstream of NF-κB, COX-2 has long been considered a protein that plays a major role in airway inflammation in asthma and is highly induced by a variety of stimuli such as cytokines and oxidative stress [23], and its expression has been shown to be significantly elevated in asthmatic patients and mice compared to normal subjects [24]. The protective effect of natural products in asthma models by modulating the expression of iNOS and COX-2 is well established. The increase of COX-2 expression can lead to the increase of prostaglandin E2 (PGE2), the main COX-2-induced product, leading to airway smooth muscle contraction [14]. Studies have shown that NF-κB-induced COX-2 is an important mediator of pulmonary inflammation, and the activation of NF-κB can also promote the expression of COX-2. On the other hand, COX-2 itself is also involved in the activation process of NF-κB, leading to induction of other inflammatory mediators and cells [18].

Ethical Approval

of the Study Protocol

The study protocol was approved by the Animal Care and Use Committee of Zhejiang University of Traditional Chinese Medicine

Chemicals and Reagents

1,8-Cineol was used from Soledum® capsules (Klosterfrau Healthcare Group, Cassellamed GmbH & Co. KG, Cologne, Germany). Native extract (0.6 mg/µl, 600 mg/ml, 1,8-Cineol) was stored at 4°C, while stock solution was prepared by solving native extract in ethanol (100mg/ml) followed by final diluting with DMEM High Glucose (Biochrom, Berlin, Germany; 1mg/ml).

To identify BAY-11-7082 dose, we carried out preliminary experiments with different doses (5, 10 and 20 mg/kg) of the compound, titrated against the histological damage. The dose of 20 mg/kg was the most effective and therefore we used this dosage in the study to keep to the minimum, for ethical issues, the number of experimental animals. This dose was similar to that used in a previously published paper investigating the effects of BAY-11-7082 on depressed wound healing in diabetic animals[5]. Since asthma is a systemic disease we chose the intraperitoneal route of administration.

Animals

Specific pathogen-free female BALB/c mice (6 weeks old) were purchased from the Experimental Animals Center of Zhejiang University of Traditional Chinese Medicine. Before experimentation, all mice were maintained under standard conditions, and survived on distilled water and standard chow adlibitum, for 7 days. Animal procedures were approved by the ZheJiang University Animal Care and Use Committee and performed in accordance with established animal care, use, and experimental guidelines.

Asthma Model Establishment

Thirty Mice were randomly allocated into groups of six mice each: normal control group(Control,n = 6);OVA-induced asthma model group(OVA,n = 6),asthma model combined with 1,8-cineol treatment group[OVA + 1,8-cineol(50 mg/kg),n = 6], OVA + BAY-11-7082(20mg/kg) and OVA + BAY-11-7082(20mg/kg) + 1,8-cineol(50 mg/kg),n = 6 in each group. To establish a model of allergic asthma, mice were sensitized and challenged with ovalbumin (OVA) by intraperitoneal injection and atomization inhalation as mentioned previously[6]. An OVA-induced mice model of allergic asthma was established by intraperitoneally injection of 20 µg OVA (Grade V; Sigma-Aldrich, St. Louis, MO) and 2 mg aluminum hydroxide (Thermo Scientific) at day 0, 7, 14 and 21 (Sensitization stage). Non-OVA-challenged mice were sensitized and challenged with 0.9% saline alone. From day 22 (Challenge stage), mice were given 2% OVA ultrasonic atomization inhalation for 30 min once a day for consecutive 7 days. Each time of challenge, mice in the 1,8-cineol and BAY-11-7082 groups were gavaged with 50 mg/kg and 20 mg/kg [7, 8].

Bronchoalveolar Lavage Fluid Collection

BALF was collected by lavage of the lung twice with 0.5 ml of cold physiologic saline via a tracheal catheter. BALF was centrifuged immediately (2,000 g, 5 min, 4°C). The supernatant was used for cytokine measurements. The cell pellet was resuspended in 0.5 ml of phosphate-buffered saline (PBS) and used for total and differential cell counts, which were measured by H&E-stained cytocentrifuges.

Measurement of Cytokine Levels in BALF and Cell Supernatants

Concentrations of IL-4、IL-13 and IL-17 in BALF were measured by ELISAs according to manufacturer (R&D Systems) instructions.

Real-Time Reverse

Transcription-Quantitative PCR

Total RNA was isolated from lung tissues by TRIzol® Reagent according to manufacturer(Invitrogen,Carlsbad,CA,United States)instructions. Reverse transcription was carried out with the PrimeScript® RT Reagent Kit (TaKaRa Biotechnology, Shiga, Japan). Next, RT-qPCR was done with the SYBR® Green Premix Ex Taq kit (TaKaRa Biotechnology) on a LightCycler® 480 system (Roche, Basel, Switzerland). mRNA expression of target genes was normalized to GAPDH expression in the same sample. The primers we used (forward and reverse,respectively)were: 5′-TGTGGGCATCAATGGATTTGG-3′ and 5′-ACACCATGTATTCCGGGTCAAT-3′ for GAPDH(mouse);5′-GAACCTGCAGTTTGCTGTGG-3′ and 5′- AGAAGCGTTTGCGGTACTCA − 3′ for COX-2 (mouse);

Lung Histopathology

Lung tissues were fixed with 10% neutral formalin after mice had been sacrificed. Fixed sections were embedded in paraffin, sectioned and stained with H&E to examine infiltration of inflammatory cells. Staining [Alcian blue and periodic acid- Schiff (AB-PAS), Masson] was used to evaluate mucin-positive goblet cells (GCs).

Measurement of airway hyper-responsiveness

Within 24h of the last OVA challenge, AHR was assessed using whole-body plethysmography (Buxco 150 Electronics, Troy, NY, USA). Mice were anesthetized by i.p. injection of pentobarbital sodium at a dose of 50 mg/kg body weight (catalog no. 57-33-0, Sigma-Aldrich, St Louis, MO, USA). Mice underwent a tracheotomy and tracheal tubes were inserted. Then the mouse was put into the body plethysmograph chamber and the inserted tracheal tubes were connected to a ventilator. Airway resistance (R_L) and lung dynamic compliance (C_dyn) were recorded in response to increasing doses of methacholine (0, 3.125, 6.25, and 12.5mg/mL; Sigma- Aldrich, St. Louis, MO, USA).

Analysis of Immunoglobulin E (IgE) OVA-Specific IgE in Serum

The animals were sacrificed 24 h after calculating AHR, and blood was gathered from the postcaval vein. The serum-containing supernatant was obtained after centrifugation at 800× g for 20 min. The serum levels of IgE were evaluated using an enzyme-linked immunosorbent assay (ELISA) kit (BioLegend, San Diego, CA, USA) according to the supplier’s instructions. Absorbance was detected at 450 nm using a plate reader of ELISA (Bio-Rad Laboratories, Hercules, CA, USA).

Analysis of Bronchoalveolar Lavage Fluid (BALF)

Following blood collection, BALF was collected from the mice and processed as previously described [9]. Briefly, after the tracheotomy, an endotracheal syringe was intubated into the trachea. After ice-cold PBS (0.7 mL) was injected into the lungs and recovering it twice (1.4 mL of total volume), BALF was centrifuged at 800×g for 10 min, and the supernatant was stored at -80 ◦C for analysis of type 2 cytokines. To distinguish cell types, the pellet was resuspended and the suspended cells were attached to the slide using cytospin (Hanil Science Industrial, Seoul, Republic of Korea) (200× g at 4 ◦C for 10 min). Cells on dried slides were fixed and stained with Diff-Quik® reagent (Sysmex Co., Kobe, Japan). The levels of the type 2 cytokines interleukin-4, -13, and − 17 were determined via a commercial enzyme-linked immunosorbent assay (ELISA, RayBiothech Life, Incorporation, Georgia Norcross) and detected at 450 nm using a plate reader of ELISA (Bio-Rad Laboratories).

Measurement of the thickness of smooth muscle and the airway wall

We examined isolated intact small bronchioles by light microscopy to measure the thickness of the airway wall and smooth muscle layer. Image-Pro Plus version 6.0 was used to determine the internal smooth muscle area (Wam1), external smooth muscle area (Wam2), bronchial luminal area (Wat1), total bronchial wall area (Wat2), and basement membrane perimeter (Pbm) in the bronchioles. The thicknesses of the smooth muscle layer (Wat) and airway wall (Wan) were calculated as follows:

Wan =(Wat1 –Wat2)/Pbm

Wat =(Wam1 –Wam2)/Pbm

Histopathological Analysis of the Lung Tissue

At 48 h after the last OVA challenge, mice were sacrificed for histological examination. Lung tissue was removed and fixed in 10%(v/v) neutral-buffered formalin then dehydrated, embedded in paraffin, and cut into 4 µm sections that were deparaffinized with xylene and then stained with hematoxylin and eosin (H&E) and periodic acid Schiff (PAS) (both from Sigma-Aldrich). Stained sections were analyzed under a light microscope (Axio Imager M1; Carl Zeiss, Oberkochen, Germany). The degree of lung inflammation and goblet cell hyperplasia was scored on a subjective scale of 0 to 4 as previously described [10]. Briefly, to score the inflammatory cell infiltration in the intraluminal,alveolar,peribronchial,and perivascular regions,cell counts were performed blind based on five point grading system for the following features: 0: normal, 1: few cells, 2: a ring of inflammatory cells 1 cell layer deep; 3: a ring of inflammatory cells 2–4 cells deep, 4: a ring of inflammatory cells of > 4 cells deep. For the quantification of goblet cells in the bronchi and bronchioles, five point grading system was used, 0: < 0.5% PAS positive cells, 1: < 25%, 2: 25–50%, 3: 50–75% and 4: > 75%. Five fields were counted for each slide and mean score was calculated from five animals. Quantification of the PAS-positive goblet cells was expressed as the number of PAS-positive cells per mm of basement membrane to correct for airway size [19].

Culture of Cells

The peritoneal macrophage cell line Beas-2B was obtained from Shanghai Institutes for Biological Sciences (Shanghai, China). Cells were cultured in Dulbecco’s modified Eagle’s medium (Hyclone, Julich, Germany) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, United States). All cells were grown at 37°C in humidified air in an atmosphere of 5% CO₂.Cells were treated with the indicated concentration of 1,8-cineol according to experimental requirements; the same volume of DMEM was used as the solvent control.

CCK-8 Assay

Take logarithmic growth phase cells, digest and make a single cell suspension and count, inoculate Beas-2B cells in a 96-well plate according to the cell density of 5000/well, and add PBS to the edge wells for liquid sealing. When the fusion rate of the cells rises to 70–90%, the original medium is discarded and changed to a serum-free medium, and the cells are starved for 24h to promote cell synchronization. After adding 10 µL CCK8 reagent to each well and reacting in a 37°C incubator for 4h, the microplate reader (Thermo, MA, USA) was used to detect the OD value of cells in each well at 450 nm. Relative cell activity =(treatment group OD value-blank group OD value)/(control group OD value-Oxidative Medicine and Cellular Longevity blank group OD value) and expressed as a percentage. Each experiment was repeated three times.

Migration Assay

Cells were placed into the upper chamber of Transwell^™ inserts (Corning, Corning, NY, United States) with culture medium to detect cell migration. Culture medium was also added to the lower chamber. After 48 h of incubation at 37°C, cells migrated through the membrane were fixed with 4% formaldehyde for 30 min and stained with 0.1% crystal violet. Stained cells were imaged and counted under a microscope (Nikon).

Western blotting

Lung tissues were minced and homogenized by RIPA lysate containing protease and phosphatase inhibitor (Sangong Biotech,C500019-0001),followed by 12,000g centrifugation for 10 min at 4°C, and the supernatants of each group were collected. The concentration of total protein was quantified by Pierce BCA Protein Assay Kit (Thermo Scientific). Electrophoresis separation was performed by 10% SDS-PAGE and transferred with 0.25 µm PVDF membranes. The membranes were blocked with 5% milk at room temperature for 1 h, then incubated with primary antibodies (NF-κB p-P65、NF-κB P65、COX-2、Cell Signaling Technology, Dilution: 1:1000) at 4°C over- night, followed by HRP-conjugated secondary antibody (Dilution: 1:1000 or 1:10000) incubation at room temperature for 1 h. Images were obtained by ultimate exposure using LAS-4000 mini visualizer (Fujifilm Corporation, Tokyo, Jap).

Statistical Analysis

SPSS20.0 was used for statistical analysis. Data were expressed as mean SD. The statistical significance of differences between more than two groups was calculated using one-way analysis of variance (ANOVA). Data were analyzed and graphs were prepared using GraphPad Prism 9 software (GraphPad Software, San Diego, CA, USA). P < 0.05 was accepted as statistically significant.

The effects of different concentrations of 1,8-cineol on the viability of Beas-2B cells were detected by CCK8 kit

In this study, CCK8 kit was used to detect the activity of Beas-2B cells treated with different concentrations of 1,8-cineol. The results showed that when the concentration of 1,8-cineol was 1µM, 5µM and 10µM, the vitality level of Beas-2B cells in the three groups was not different from that in the Control group for 24h. When 1,8-cineol concentration of 20µM was applied to Beas-2B cells for 24h, the viability of Beas-2B cells was significantly decreased compared with Control group (P < 0.01)

Effect of 1,8-cineol on OVA-induced airway hyper-responsiveness

Allergic asthma is characterized by AHR, which is evidenced by airway resistance increase (R_L) and lung dynamic compliance decrease (C_dyn) [11]. In present study, we observed these two indicators in each group (Fig. 2) .Compared with the control group, an increase in airway resistance accompanied by a decrease in C_dyn were observed in the asthma groups by the increase of methacholine concentration, suggesting airways were hyper-responsive. At the concentration of 6.25 mg/mL and 12.5 mg/mL methacholine,The airway resistance in the 1,8-cineol and BAY-11-7082 group were significantly reduced.Cydn was significantly increased in the 1,8-cineol and BAY-11-7082 group at 6.25 mg/mL and 12.5 mg/mL.

1,8-cineol reduces the thickness of smooth muscle and the airway wall

Isolated intact small bronchioles of 1,8-cineol-treated and untreated asthmatic mice are shown in Fig. 3. Thickness of the airway wall and smooth muscle layer was enhanced in the lung tissue of asthma group than control group of mice. However, treatment with 1,8-cineol significantly (p < 0.01) reduces the thickness of both (airway wall and smooth muscle) in the lung tissue of asthmatic mice.

Pathological Changes in the Lungs of Mice

HE staining results are shown in the Fig. 4A. In the Control group, the bronchial and lung tissue structure was normal, there were no inflammatory cells in the bronchial tube lumen, and the tube wall thickness and results were normal. In OVA group, various inflammatory cells such as eosinophils and lymphocytes were infiltrated and aggregated around the airway. Pathological changes such as bronchial smooth muscle spasm, lumen stenosis and tube wall thickening were observed. The airway of OVA + eucalyptol and OVA + BAY-11-7082 mice had a small amount of inflammatory cells infiltrating and slightly thickened, but to a lesser extent than that of OVA + eucalyptol and OVA + BAY-11-7082. Inflammatory cells were still infiltrated around the airway of OVA + eucalyptol + BAY-11-7082 mice,but significantly reduced compared to OVA + eucalyptol + Bay-11-7082. The pathological changes such as tracheal smooth muscle spasm and lumen stenosis were improved to varying degrees. The general trend of damage degree of HE staining was: Control< “OVA + eucalyptol + BAY-11-7082”< OVA + Eucalyptus, OVA + BAY-11-7082 < OVA.

The results of PAS staining are shown in the Fig. 4B. In the Control group, there were very few goblet cells in the trachea and bronchus, and only a small amount of purplish red was expressed around the bronchus. In the OVA group, a large number of goblet cell hyperplasia was observed in the airway of mice, and the purplish red area around the bronchus was significantly increased. In “OVA + eucalyptol” and “OVA + BAY-11-7082” group, the cell hyperplasia was reduced, and the positive area around the bronchus was reduced to varying degrees. In “OVA + eucalyptol + BAY-11-7082” group, the cell proliferation was further alleviated and the positive area around the bronchus was further reduced. The general trend of PAS stained goblet cell proliferation was Control < OVA + eucalyptol + BAY-11-7082 < OVA + eucalyptol, OVA + BAY-11-7082 < OVA.

Effects of 1,8-cineol on the levels of IgE in Serum from OVA-induced Asthmatic Mice.

The OVA specific antibody IgE content in serum was detected by ELISA, and the results were shown in the Fig. 4C. Compared with the Control group, the serum levels of OVA specific antibody IgE in the other groups were up-regulated. Serum levels of OVA specific antibody IgE in “OVA + eucalyptol + BAY-11-7082”, “OVA + eucalyptol”, “OVA + BAY-11-7082” were down-regulated but still higher than those in Control group. There was no statistical difference in serum OVA specific antibody IgE content between “OVA + eucalyptol” and “OVA + BAY-11-7082” groups. The general trend of serum OVA specific antibody IgE content detected by ELISA was: Control<“OVA + eucalyptol + BAY-11-7082”<“OVA + eucalyptol”, “OVA + BAY-11-7082”<OVA.

Effects of 1,8-cineol on Inflammatory Cell Counts in BALF from Asthmatic Mice

Alveolar lavage fluid (BALF) was collected and analyzed, and the results were shown in the Fig. 5. Compared with the Control group, the number of total cells, white blood cells, eosinophils, neutrophils, lymphocytes and macrophages in the other groups were up-regulated. Compared with the OVA group, Total cells, white blood cells, eosinophils, neutrophils, lymphocytes, and macrophages in “OVA + eucalyptol + BAY-11-7082”, “OVA + eucalyptol” and “OVA + BAY-11-7082” were downregulated but remained higher than those in Control group. There was no statistically significant difference in the number of total cells, white blood cells, eosinophils, neutrophils, lymphocytes, and macrophages on “OVA + eucalyptol” and “OVA + BAY-11-7082”. The number of white blood cells,eosinophils,neutrophils,lymphocytes and macrophages was as follows: Control$\:<\text{“}$OVA + eucalyptol + BAY-11-7082”$\:<$“OVA + eucalyptol”, “OVA + BAY-11-7082”$\:<$OVA.

Figure (5A).1,8-cineol (eucalyptol)reduced the inflammatory cell count in bronchoalveolar lavage fluid. (5B).1,8-cineol reduced the levels of interleukin(IL)-4,IL-13 and IL-17 in the bronchoalveolar lavage fluid. Control:mice treated with phosphate-buffered saline only;ovalbumin(OVA): mice sensitized and challenged with OVA.OVA + eucalyptol: asthma model combined with 1,8-cineol treatment group.OVA + BAY-11-7082: asthma model combined with BAY-11-7082 treatment group.OVA + eucalyptol + BAY-11-7082:asthma model combined with BAY-11-7082 and 1,8-cineol.Values are presented as means ± SD (n = 6). p**:p < 0.01 vs Control,p^##:p < 0.01 vs OVA, p^$$:p < 0.01 vs OVA + eucalyptol,p^@@:p < 0.01 vs “OVA + BAY-11-7082”.

Effects of 1,8-cineol on the Activity and Expression of NF-κB p-P65、NF-κB P65、COX-2 in Lung Tissue from OVA-Induced Asthmatic Mice.

The gene expression of COX-2 in lung tissue was detected by qPCR, and the results were shown in the Fig. 6A.Compared with the Control group,COX-2 gene expression in the other groups was upregulated, and compared with the OVA group, COX-2 gene expression in BALF of “OVA + eucalyptol + BAY-11-7082”, “OVA + eucalyptol”, “OVA + BAY-11-7082” was down-regulated but still higher than that of control group.There was no statistically significant difference in COX-2 gene expression between “OVA + eucalyptol” and “OVA + BAY-11-7082”. The general trend of COX-2 gene expression detected by qPCR was: Control<“OVA + eucalyptol + BAY-11-7082”<“OVA + eucalyptol”,“ OVA + BAY-11-7082” <OVA.

The protein expression of NF-κB p-P65, NF-κB P65 and COX-2 in lung tissue was detected by WB, and the results were shown in the figure(6B/6C). Compared with the Control group, the expression of NF-κB p-P65/NF-κB P65 and COX-2 protein in the other groups was up-regulated. Protein expressions of NF-κB p-P65/NF-κB P65 and COX-2 in “OVA + eucalyptol + BAY-11-7082”, “OVA + eucalyptol”, “OVA + BAY-11-7082” were down-regulated but still higher than those in Control group. There was no statistically significant difference in the expression of NF-κB p-P65/NF-κB P65, COX-2 on “OVA + eucalyptol” and “OVA + BAY-11-7082”. The general trend of protein expression of COX-2, NF-κB p-P65/NF-κB P65 in lung tissue detected by WB was Control<“OVA + eucalyptol + BAY-11-7082” <“OVA + eucalyptol”, “OVA + BAY-11-7082”<OVA.

Effects of 1,8-cineol on the Activity and Expression of N-cadherin、NF-κB p-P65/NF-κB P65、COX-2 in cell groups.

The expression of N-cadherin, NF-κB p-P65/NF-κB P65 and COX-2 in cells of each group was detected by WB, and the results were shown in the Fig. 7A.Protein expression of N-cadherin, COX-2, NF-κB p-P65/NF-κB P65 was up-regulated in TGF-β1 group compared with Control group. The general trend of protein expression of N-cadherin, COX-2, NF-κB p-P65/NF-κB P65 detected by WB was Control < TGF-β1.

The protein expression of N-cadherin, COX-2, NF-κB p-P65/NF-κB P65 in cells of each group was detected by WB, and the results were shown in the Fig. 7B. Protein expressions of N-cadherin, COX-2, NF-κB p-P65/NF-κB P65 in the other groups were up-regulated compared with those in the Control group. N-cadherin, COX-2, NF-κB in “TGF-β1 + Low-dose-eucalyptol”group, “TGF-β1 + mid-dose-eucalyptol” group, “TGF-β1 + High-dose-eucalyptol” group. The protein expression of p-P65/NF-κB P65 was down-regulated in a dose-dependent manner.The expression trend of N-cadherin, COX-2, NF-κB p-P65/NF-κB P65 in cells of all groups was TGF-β1>“TGF-β1 + Low-dose-eucalyptol”> “TGF-β1 + mid-dose-eucalyptol”;“TGF-β1 + High-dose eucalyptol” > Control.

Effects of 1,8-cineol on the Activity and Expression of E-cadherin、α-SMA、N-cadherin、NF-κB p-P65/NF-κB P65、COX-2 in cell groups.

The expression of E-cadherin,α-SMA,N-cadherin,NF-κB p-P65/NF-κB P65 and COX-2 in cells of each group was detected by WB, and the results were shown in the Fig. 7C. Compared with the Control group, the expression of E-cadherin protein in the other groups was down-regulated, and compared with TGF-β1 group,The expression of E-cadherin protein in “TGF-β1 + BAY-11-7082”, “TGF-β1 + eucalyptol”, and “TGF-β1 + eucalyptol + BAY-11-7082” groups was up-regulated but still lower than that in Control group.There was no statistically significant difference in the expression of E-cadherin on “TGF-β1 + eucalyptol” and “TGF-β1 + BAY-11-7082” on eucalyptol. The general trend of E-cadherin expression in cells detected by WB was as follows: TGF-β1<“TGF-β1 + eucalyptol”, “TGF-β1 + BAY-11-7082”<“TGF-β1 + eucalyptol + BAY-11-7082”<Control;

The protein expression of α-SMA, N-cadherin, COX-2, NF-κB p-P65/NF-κB P65 in the other groups were up-regulated compared with those in the Control group. The protein expressions of α-SMA, N-cadherin, COX-2, NF-κB p-P65/NF-κB in group “TGF-β1 + BAY-11-7082”,“TGF-β1 + eucalyptol” and “TGF-β1 + eucalyptol + BAY-11-7082”were down-regulated compared with those in the group of TGF-β1 and up-regulated compared with those in the control group. There was no significant difference in the protein expression of α-SMA, N-cadherin, COX-2, NF-κB p-P65/NF-κB P65 on “TGF-β1 + eucalyptol” and “TGF-β1 + BAY-11-7082”. The expression trend of α-SMA,N-cadherin,COX-2,NF-κB p-P65/NF-κB P65 detected by WB was TGF-β1>“TGF-β1 + eucalyptol”, “TGF-β1 + BAY-11-7082”>“TGF-β1 + eucalyptol + BAY-11-7082”> Control.

Allergic asthma is associated with T helper (Th) 2 cell-biased immune responses and characterized by the airway hyperresponsiveness (AHR)[11]. Bronchial inflammation, smooth muscle spasm, and mucus production in allergic asthma are triggered by IL-4, IL-5,and IL-13, which are released by Th2 cells. IL-13 plays the main role in the excessive secretion of mucus and AHR. IL-5 participates in the activation and migration of eosinophils to airways triggering bronchial inflammation. IL-4 induces IgE isotype switching in B cells and upregulates high-affinity IgE receptor (FcεRI) on the surface of target cells. Mast cells are activated upon allergen- induced cross-linking of FcεRI-bound IgE on their plasma membrane surface. Subsequently, mast cells release histamine and other mediators that lead to allergic symptoms. The levels of IL-4, IL-5, and IL-13 are increased in the bronchoalveolar lavage (BAL) of asthmatic patients[12]. The purpose of the present study was to elucidate,using an OVA-induced asthmatic mice model,the anti-asthmatic efficacy of 1,8-cineol,the major constituent of eucalyptus species,is well known for its anti-inflammatory,antioxidant, bronchodilatory, antiviral and antimicrobial effects[13]. The monoterpene 1,8-cineole (eucalyptol) is chemically a terpenoid oxide that is well known as the major constituent (77–84%) of various eucalyptus species and also the component of other essential oils with a relevant meaning for clinical effect. Eucalyptus oil is well known for its biological activities, including anti-inflammatory, antioxidant, free radical scavenging, mucolytic/secretolytic, bronchodilatory, antiviral and antimicrobial effects, as reviewed elsewhere[14].The present 1,8-cineol treatment effectively decreased airway hyper-responsiveness (AHR) with a reduction in the migration of inflammatory cells and type 2 pro-inflammatory cytokine levels in BALF and IgE levels in serum, which had been elevated by OVA sensitization.These changes were consistent with the results of decreased inflammatory cell migration and decreased hyper mucinogenesis in the lung tissues of 1,8-cineol-treated mice.Additionally,1,8-cineol notably reduced the expression of COX-2,α-SMA,N-cadherin and NF-κB phosphorylation followed by reduced E-cadherin expression levels elevated by OVA exposure.

The reason why allergic asthma exhibits symptoms of asthma is due to its pathological BHR, increased inflammatory cells, and increased mucus. The pathophysiology of type II asthma is an increase in the concentration of IL-4, IL-5, and IL-13, which leads to the accumulation of type 2 related cells (such as mast cells and eosinophils) in lung tissue and increases the production of mucus. From mild allergic early-onset asthma to severe delayed onset asthma with high and ultra-high Th2, there are four different degrees of asthma phenotypes. Other inflammatory cytokines, chemokines, and growth factors are also easily induced by these events, leading to high production and collectively contributing to representative symptoms of asthma. The pathogenesis of type 2 low internal asthma is more complex, and no clear biomarkers are associated with its onset. Currently, all asthma patients without type 2 high inflammation are classified as type 2 low asthma. In this study, compared to the experimental data of the OVA group, the 1,8-cineol group showed a decrease in the degree of AHR, as well as a significant reduction in airway inflammation and lung tissue mucus production. The migration of inflammatory cells, production of type 2 cytokines in BALF, and increased serum IgE content were observed in the 1,8-cineol group. In BALF, the 1,8-cineol group showed greater inhibition of the migration of inflammatory cells, especially eosinophils, while the OVA group exhibited a dose-response relationship. In addition, the 1,8-cineol group exhibited low production of IL-4, IL-5, and IL-13, as well as low production of serum total IgE and OVA-specific IgE. Based on the above data, we infer that the protective effect of 1,8-cineol on asthma response is mainly achieved by reducing the level of type 2 cytokines.

As a common transcription factor, NF-kB plays a role in the pathogenesis of inflammation by regulating gene expression of iNOS, COX-2, and various cytokines [35]. Asthma is a disease characterized by chronic inflammation of the airways. NF-kB has the activity of promoting asthma inflammation in human and animal lung tissues, and its role in the pathogenesis of asthma has been fully demonstrated in many clinical trials and various animal experiments [36–37].In addition, there are studies involving NF-B-involved cascades, confirming that iNOS and COX-2 are present in NF- kB phosphorylation downstream plays a role [38]COX-2 is a protein that plays a major role in the inflammatory response, and an increase in its level can induce the production of prostaglandins, leading to the inflammatory response [39]. The protective effect of natural products on asthma models by regulating the expression of COX-2 has been fully confirmed. In conclusion, our results suggested that 1,8-cineol can effectively improve lung function, alleviate airway inflammation, reduce airway mucus secretion and collagen deposition in allergic asthmatic mice.Furthermore,1,8-cineol inhibited the level of autophagy in the lung tissues of asthmatic mice, and the mechanism involves inhibiting the NF-κB p-P65/COX-2 signaling pathway while activating the E-cadherin protein complex. This reduction was due to suppression of Th2 response in airway mucosal system. Finally, these results suggest potential role of 1,8-cineol in future for the treatment of allergic asthma.

We demonstrated that 1,8-cineol inhibited airway inflammation and macrophage activation in a mouse model of OVA-induced asthma. 1,8-cineol could suppress TGF-β1-induced macrophage activation, including cell proliferation, cell migration. The inhibitive effects of 1,8-cineol in an experimental model of asthma may be mediated by the NF-κB/ p-P65 signaling pathway (Fig. 8). Our findings support the potential application of 1,8-cineol as a therapeutic drug against allergic asthma.

AHR

Airway hyperresponsiveness

BALF

Bronchoalveolar lavage fluid

H&E

Hematoxylin and eosin

IgE

Immunoglobulin E

Interleukin

OVA

Ovalbumin

PAS

Periodic acid Schiff

Th2

T helper 2

Acknowledgements

Not applicable.

Authors’ contributions
QPX,NR conducted experiments, performed analysis, and wrote the manuscript. W-YH,Yibei Yang editored the manuscript. P-JJ interpreted data and edited the manuscript.FT, JQQ, Xu Zhang and Lanqi Ren contributed to the study conception and design. All authors collected the data and performed the data analysis. All authors contributed to the interpretation of the data and the completion of figures and tables.All authors contributed to the drafting of the article and final approval of the submitted version. All authors read and approved the final manuscript.

Funding

This study was funded by Key Medical Discipline of Hangzhou City (2021-21); Key Medical Discipline of Zhejiang Province (2018– 2–3); Key Laboratory of Clinical Cancer Pharmacology and Toxicology Research of Zhejiang Province (2020E10021); General project of Hangzhou Health Technology Plan in 2020(A20200838);Zhejiang Province Medical and Health Science and Technology Program (2023KY933); Zhejiang Traditional Chinese Medicine Science and Technology Project (2023ZL565).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

Experimental animals were handled under a protocol approved by the Institutional Animal Care and Use Committee of chinese Institute of Toxicology (no. 1907–0244).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Kim CY, Kim JW, Kim JH, Jeong JS, Lim JO, Ko JW, Kim TW: Inner Shell of the Chestnut (Castanea crenatta) Suppresses Inflammatory Responses in Ovalbumin-Induced Allergic Asthma Mouse Model. Nutrients 2022, 14.
Kwah JH, Peters AT: Asthma in adults: Principles of treatment. Allergy Asthma Proc 2019, 40:396-402.
Bousquet J, Mantzouranis E, Cruz AA, Ait-Khaled N, Baena-Cagnani CE, Bleecker ER, Brightling CE, Burney P, Bush A, Busse WW, et al: Uniform definition of asthma severity, control, and exacerbations: document presented for the World Health Organization Consultation on Severe Asthma. J Allergy Clin Immunol 2010, 126:926-938.
Sun Z, Ji N, Ma Q, Zhu R, Chen Z, Wang Z, Qian Y, Wu C, Hu F, Huang M, Zhang M: Epithelial-Mesenchymal Transition in Asthma Airway Remodeling Is Regulated by the IL-33/CD146 Axis. Front Immunol 2020, 11:1598.
Bitto A, Altavilla D, Pizzino G, Irrera N, Pallio G, Colonna MR, Squadrito F: Inhibition of inflammasome activation improves the impaired pattern of healing in genetically diabetic mice. Br J Pharmacol 2014, 171:2300-2307.
Cui J, Dong M, Yi L, Wei Y, Tang W, Zhu X, Dong J, Wang W: Acupuncture inhibited airway inflammation and group 2 innate lymphoid cells in the lung in an ovalbumin-induced murine asthma model. Acupunct Med 2021, 39:217-225.
Kim SH, Saba E, Kim BK, Yang WK, Park YC, Shin HJ, Han CK, Lee YC, Rhee MH: Luteolin attenuates airway inflammation by inducing the transition of CD4(+)CD25(-) to CD4(+)CD25(+) regulatory T cells. Eur J Pharmacol 2018, 820:53-64.
Liang KL, Yu SJ, Huang WC, Yen HR: Luteolin Attenuates Allergic Nasal Inflammation via Inhibition of Interleukin-4 in an Allergic Rhinitis Mouse Model and Peripheral Blood From Human Subjects With Allergic Rhinitis. Front Pharmacol 2020, 11:291.
Lertnimitphun P, Zhang W, Fu W, Yang B, Zheng C, Yuan M, Zhou H, Zhang X, Pei W, Lu Y, Xu H: Safranal Alleviated OVA-Induced Asthma Model and Inhibits Mast Cell Activation. Front Immunol 2021, 12:585595.
Wang S, Wuniqiemu T, Tang W, Teng F, Bian Q, Yi L, Qin J, Zhu X, Wei Y, Dong J: Luteolin inhibits autophagy in allergic asthma by activating PI3K/Akt/mTOR signaling and inhibiting Beclin-1-PI3KC3 complex. Int Immunopharmacol 2021, 94:107460.
Teng F, Ma X, Cui J, Zhu X, Tang W, Wang W, Wuniqiemu T, Qin J, Yi L, Zong Y, et al: Acupoint Catgut-Embedding Therapy Inhibits NF-kappaB/COX-2 Pathway in an Ovalbumin-Induced Mouse Model of Allergic Asthma. Biomed Res Int 2022, 2022:1764104.
Athari SS: Targeting cell signaling in allergic asthma. Signal Transduct Target Ther 2019, 4:45.
Juergens LJ, Worth H, Juergens UR: New Perspectives for Mucolytic, Anti-inflammatory and Adjunctive Therapy with 1,8-Cineole in COPD and Asthma: Review on the New Therapeutic Approach. Adv Ther 2020, 37:1737-1753.
Dhakad AK, Pandey VV, Beg S, Rawat JM, Singh A: Biological, medicinal and toxicological significance of Eucalyptus leaf essential oil: a review. J Sci Food Agric 2018, 98:833-848.

No competing interests reported.

Download PDF

Editorial decision: Revision requested
30 Sep, 2024
Reviews received at journal
10 Sep, 2024
Reviewers agreed at journal
08 Sep, 2024
Reviewers agreed at journal
05 Sep, 2024
Reviewers invited by journal
02 Sep, 2024
Editor assigned by journal
12 Aug, 2024
Submission checks completed at journal
12 Aug, 2024
First submitted to journal
08 Aug, 2024

You are reading this latest preprint version

Anti-Inflammatory Effects of 1,8-cineol(Eucalyptol) via NF-κB/COX-2 pathway in BEAS-2B cells and alleviates bronchoconstriction and airway hyperreactivity in ovalbumin sensitized mice

Status:

Version 1

Abstract

Figures

Introduction

Materials and Methods

Chemicals and Reagents

Animals

Asthma Model Establishment

Bronchoalveolar Lavage Fluid Collection

Measurement of Cytokine Levels in BALF and Cell Supernatants

Real-Time Reverse

Transcription-Quantitative PCR

Lung Histopathology

Measurement of airway hyper-responsiveness

Analysis of Immunoglobulin E (IgE) OVA-Specific IgE in Serum

Analysis of Bronchoalveolar Lavage Fluid (BALF)

Measurement of the thickness of smooth muscle and the airway wall

Histopathological Analysis of the Lung Tissue

Culture of Cells

CCK-8 Assay

Migration Assay

Western blotting

Statistical Analysis

Results

Effect of 1,8-cineol on OVA-induced airway hyper-responsiveness

1,8-cineol reduces the thickness of smooth muscle and the airway wall

Pathological Changes in the Lungs of Mice

Effects of 1,8-cineol on Inflammatory Cell Counts in BALF from Asthmatic Mice

DISCUSSION

CONCLUSION

Abbreviations

Declarations

References

Additional Declarations

Status:

Version 1