New molecular evidence of the rare genus Hydrurus (Chrysophyceae) and descriptions of Hydrurus foetidus (Villars) Trevisan on the basis of morphological and molecular phylogeny

doi:10.21203/rs.3.rs-4885289/v1

A new site with benthic freshwater alga Hydrurus foetidus (Villars) Trevisan has been discovered in the Fenhe River in Shanxi Province, China. The physical and chemical parameters of water were meticulously measured and documented. The H. foetidus thalli exhibited a unique structure, consisting of a firm central axis surrounded by peripheral branches, all encapsulated by a viscous gelatinous coating. Detailed morphological observations were conducted on the specimen, measuring of different cell categories. The SSU, LSU, ITS, and rbcL DNA sequence data of H. foetidus collected from Shanxi were determined. An extensive three-gene phylogenetic tree was constructed, revealing a strong relationship between the specimen in this study and H. foetidus specimen from Norway. Time-calibrated molecular phylogenetic analysis further indicated that the genus Hydrurus diverged approximately 125 million years ago (Early Cretaceous), while the two H. foetidus strains from Shanxi, China and Norway diverged approximately 6 million years ago (Neogene). The results of this study supplement new molecular evidence for H. foetidus and contribute significantly to our understanding of the geographical distribution and evolutionary history of the genus Hydrurus.

China

Chrysophyceae

Evolution

Hydrurus

Phylogeny

Taxonomy

Hydrurus C. Agardh, the only genus of Hydruraceae, was established in 1824 (Guiry and Guiry 2021, accessed on 20 June 2024). It contains only one species (Wei 2018). H. foetidus exhibits a macroscopic and benthic nature, which differs from other golden algae (Klaveness et al. 2011; Rott et al. 2006a). Hydrurus is widely distributed worldwide, especially in the northern hemisphere (Klaveness 2017, 2019; Kristiansen and Preisig 2011). As a typical cold-water species, H. foetidus can be found in cold mountain streams and lowland rivers during early spring and winter, as well as in rivers with consistently low temperatures throughout summer or autumn (Klaveness 2019, 2017; Kristiansen and Preisig 2011; Rott et al. 2006b; Ward 1994). A remarkable phenomenon occurs during winter when the alga gives rise to snow and ice tinted with color (Lutz et al. 2018; Remias et al. 2013). This phenomenon is unique and captivating.

H. foetidus typically attaches to stones and forms bushy thalli on riverbed materials (Kristiansen and Preisig 2011). Hydrurus is often sensitive to the environment, and temperature, light and carbon dioxide are key factors affecting its growth (Bursa 1934; Kawecka 2003; Nozaki et al. 2020). Notably, the optimal temperature range for the growth of Hydrurus has been reported to be 2–12 ℃ (Klaveness 2019). Although algae are multicellular, single cells within the thalli can slide in polysaccharide tubes or be released (Bråte et al. 2019; Klaveness et al. 2011). In addition, each cell typically possesses multiple contractive vacuoles (Klaveness 2019). Furthermore, Hydrurus holds immense potential as a rich food source for fungi, protists, and insect larvae, providing valuable nutrients such as polyunsaturated fatty acids and polysaccharides (Klaveness 2017; Milner et al. 2009, 2001; Zah et al. 2001).

Phylogenetic studies of the genus Hydrurus have been limited by a lack of molecular evidence. Only three sequences (one of 5S rRNA, one of 18S rRNA, and another of 28S rRNA) are available via the National Centre for Biotechnology Information (NCBI) GenBank database (Klaveness et al. 2011; Lim et al. 1986). Although Bråte et al. (2019) proposed an extensive next-generation sequencing data set, they did not delve into the analysis of genome sequences, thus, the analysis of genome sequences remains unexplored. Molecular clock analyses and specific molecular markers, such as ITS and rbcL, have been employed in early Chrysophyta studies (Čertnerová et al. 2019; Jo et al. 2013, 2016; Siver et al. 2015; Škaloud et al. 2020). However, these methods have yet to be widely applied in the genus Hydrurus. Additionally, the absence of molecular sequences and limited fossil records hinder a clear understanding of the position and evolutionary history of the genus Hydrurus within the Chrysophyceae. To accurately determine the phylogenetic position of Hydrurus, we urgently need more sequence data and explore additional molecular markers.

In this study, we conducted time-calibrated molecular phylogeny based on concatenated SSU, LSU, and rbcL rDNA sequences to investigate the classification and evolution of the genus Hydrurus. This study aimed to (1) describe H. foetidus collected from China based on morphological characteristics; (2) provide new molecular data for H. foetidus and infer the phylogenetic relationships among Chrysophyta species; (3) comprehend the species diversity and infer the divergence time of Hydrurus species (4) contribute to the geographical distribution of Hydrurus and enhance biodiversity records of freshwater Chrysophyta.

Sample collection

The materials were collected from the Shanxi Province of China in March 2023 (Fig. 1). The materials were directly picked up from stones using knives and tweezers and transferred to the laboratory subsequently. Water quality parameters, including Water temperature (WT), pH, salinity, Secchi depth (SD), dissolved oxygen (DO), electronic conductivity (EC), and total dissolved solids (TDS), were measured using handheld meters (YSI Professional Plus Multiparameter Water Quality Instrument 19E102487, YSI Incorporated, Brannum Lane Yellow Springs, Ohio, USA). COD, ammonium (NH4⁺), total nitrogen (TN), and total phosphorus (TP) were determined by dichromate method, Nessler’s reagent spectrophotometry, ultraviolet spectrophotometry, and ammonium molybdate spectrophotometric, respectively (State Environmental Protection Administration 2002). The samples were washed with sterile water several times to remove impurities. Voucher specimens were preserved in 4 % formaldehyde. Voucher specimens were deposited in the Herbarium of Shanxi University (SXU), Shanxi University, Taiyuan, Shanxi Province, China (Voucher number: SXU-SX230328).

Morphological observations

Morphological characters of the specimens were observed under an Olympus BX-51 microscope (Olympus, Tokyo, Japan) equipped with a digital camera for photographing (DP72 Olympus, Tokyo, Japan).

DNA extraction, amplification, and sequencing

Total DNA was extracted from the fresh thalli collected from Shanxi province using a plant DNA extraction kit (Sangon Biotech, Shanghai, China). The four genes (SSU, LSU, ITS, and rbcL) were amplified using the paired primers listed in Table 1. The polymerase chain reaction (PCR) amplifications were conducted in 50 μL volumes containing 37.75 μL ddH₂O, 5.0 μL 10 × buffer, 4.0 μL 2.5 mM dNTPs, 0.25 μL Taq DNA polymerase (Sangon Biotech, Shanghai, China), 1.0 μL of each primer (10 mM) and 1.0 μL of genomic DNA. The amplifications were performed using the following programs: 94 ℃ for 5 min, 35 cycles of 94 ℃ for 30–60 s, 46.5–59 ℃ for 30–60 s, and 72 ℃ for 2 min, and final 72 ℃ for 10 min. The reaction was undertaken in a MyCycler thermal cycler (Bio-Rad, Hercules, CA, USA). In each experiment, three replicates were used. The sequencing was performed on an ABI 3730XL sequencer. The DNA sequences generated in this study have been deposited in GenBank under accession numbers (OR230247, OR336050, OR284295, and PP025381).

Table 1 Primers for amplifying and sequencing of the nuclear SSU, LSU, and rbcL rDNA

Designation	Sequence (5’–3’)	Reference
SSU
16s	CCGAATTCGTCGACAACCTGGTTGATCCTGCCAGT	(Medlin et al., 1988)
16f	CCCGGGATCCAAGCTTGATCCTTCTGCAGGTTCACCTAC	(Medlin et al., 1988)
LSU
5.8SF	CGATGAAGAACGCAGCGAAATGCGAT	(Riisberg et al., 2009)
LSU 4256R	GGAWTATGACTGAACGCCTCTAAGTCAGA	(Riisberg et al., 2009)
28S_25F	ACCCGCTGAATTTAAGCATATA	(Jo et al., 2011)
28S_861R	GTTCGATTAGTCTTTCGCCCCT
28S_736F	CCCGAAAGATGGTGAACTC
28S_1440R	TGCTGTTCACATGGAACCTTTC
28S_1228F	CCTGAAAATGGATGGCGC
28S_2160R	CCGCGCTTGGTTGAATTC
28S_2038F	GACAAGGGGAATCCGACT
28S_2812R	GATAGGAAGAGCCGACATCGAA
rbcL
Chryso_rbcL_F4	TGGACDGAYTTATTAACDGC	(Pusztai and Škaloud, 2019)
Chryso_rbcL_R7	CCWCCACCRAAYTGTARWA	(Pusztai and Škaloud, 2019)
ITS
ITS4	TCCTCCGCTTATTGATATGC	(White et al., 1990)
KN1.1	CAAGGTTTCCGTAGGTGAACC	(Wee et al., 2001)

Sequence alignment and phylogenetic analysis

Newly obtained sequences in this study and downloaded sequence data from GenBank (listed in Table S1) were aligned using MAFFT version 7 (Katoh et al. 2019). The sequences of SSU, LSU, and rbcL were concatenated based on the methods of Zhang et al. (2020). Pairwise genetic P-distances of concatenated sequences were calculated in MEGA 5.0 (Tamura et al. 2011). Synchroma grande and Nannochloropsis limnetica were used as outgroups in the phylogenetic tree. The appropriate model was built using the software PartitionFinder 2, with all algorithm and AIC criterion (for BI: Subset (1)(2)(3) = GTR + I + G; for ML: Subset (1)(2)(3) = GTR + I + G) (Lanfear et al. 2017). IQ-TREE was used to construct maximum likelihood (ML) trees with 5000 ultrafast bootstraps repetitions (Nguyen et al. 2015). Bayesian inference (BI) phylogenies were inferred using MrBayes 3.2.6, and the BI analysis was run for 3,000,000 generations (Ronquist et al. 2012). The resulting phylogenetic trees were edited using Figtree 1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/). Adobe Illustrator CS5 (Adobe System, San Jose, CA, USA) was used to optimize the graphics of all trees.

Molecular clock analyses

We employed a Bayesian inference method with a relaxed clock model using Beast v2.6.6 (Bouckaert et al. 2014) to conduct phylogeny and simultaneously estimate branch divergence times. We used the uncorrelated lognormal model to estimate variation rates across all branches. We used fossil calibrations as probabilistic priors. The lognormal priors were used for spits between the species Mallomonas asmundiae and M. striata var. serrata, and between M. elevata and M. mangofera var. foveata. Both calibrations were based on an offset of 38 Ma, a mean of 0.5 Ma, and a standard deviation of 1.0, which represents a minimal age estimate for the majority of fossils of Mallomonas species from the Gtraffe Pipe locality (Creaser et al. 2004; Doria et al. 2011; Siver et al. 2015). A generalized time reversible (GTR) + gamma site model was applied to the three-gene concatenated data set and a Yule tree prior was used as a speciation model. The analysis was run for 50 million generations with the chain sampled every 1000 generations. Convergence of parameter estimates and estimation of burn-in was checked using the program Tracer version 1.7 (Rambaut et al. 2018). The initial 5,000,000 (10%) were removed, and the rest were retained to construct the final chronogram with 95% posterior probabilities (PP) and age estimates for all nodes. The resulting phylogenetic trees were edited using Figtree 1.4.2 (http://tree.bio.ed.ac.uk/software/figtree/) and optimized using Adobe Illustrator CS5 (Adobe System, San Jose, CA, USA).

ITS2 secondary structures.

The ITS2 sequences of the genera Mallomonas and Synura were downloaded from GenBank and aligned with the sequence of H. foetidus obtained in this study using MAFFT version 7 (Katoh et al. 2019). The ITS2 secondary structure of H. foetidus was constructed using the mfold computer program (Zuker 2003) and VARNA (Darty et al. 2009).

Physical and chemical parameters of water

The Fenhe River, renowned as the Mother River of Shanxi, is the second largest tributary of the Yellow River, flowing through six cities in Shanxi Province. H. foetidus was collected in the Xinzhou section of this river. The physical and chemical parameters of water at four sites along the Fenhe River were recorded in Table 2 and the results revealed the following: the sites where H. foetidus was found ranged in altitude from 1356.05 to 1869.2 meters, the water temperature ranged from 4.3 ℃ to 9.8 ℃, the pH ranged from 7.04 to 7.24. The lowest total dissolved solids content was 279.5 ppm, while the highest was 604.5 ppm. The dissolved oxygen concentration peaked at 15.22 mgL^-1, while the lowest was 12.27 mgL^-1. The electronic conductivity was lowest at 429.9 μScm^-1, with other sites exhibiting values around 900 μScm^-1. During our visit, the watercourse of the Fenhe River was observed to be between 70 and 200 cm deep. Notably, the Secchi depth of water at the source of the Fenhe River was 200 cm, significantly deeper than the 70–80 cm depths recorded at the other three sites. Total nitrogen levels ranged from 1.165 mgL^-1 to 2.225 mgL^-1, and total phosphorus levels were between 0.025 mgL^-1 and 0.055 mgL^-1. COD varied between 41 mgL^-1 and 50 mgL^-1, and ammonium levels ranged from 0.35 mgL^-1 to 0.47 mgL^-1.

Table 2 Specific information and physical and chemical properties of water on the localities of H. foetidus

Site	The source of the Fenhe River	Kuaitunguan	Matou Mountain Village	Jingle Wetland Park
Coordinate [E]	112.0831	112.1085	112.0191	111.9287
Coordinate [N]	38.8574	38.6605	38.5541	38.3588
Altitude [m]	1869.2	1506.89	1497.4	1356.05
WT [℃]	9.8	4.4	6.3	4.3
pH	7.24	7.1	7.24	7.04
Salinity[ppt]	0.43	0.46	0.43	0.43
DO [mgL^-1]	12.27	15.22	14.09	14.68
TDS [ppm]	279.5	604.5	572	572
EC [μScm^-1]	429.9	928	876	878
SD [cm]	200	80	80	70
TN [mgL^-1]	1.165	1.945	2.16	2.225
TP [mgL^-1]	0.025	0.05	0.055	0.05
COD [mgL^-1]	50	44	41	42
NH4+ [mgL^-1]	0.405	0.385	0.47	0.35

Morphology

Morphological characters of the specimen are shown in Figs. 2–3. The Hydrurus thalli, ranging from green to dark brown, were securely attached to the surface of stones, see Fig. 2 (A, C). The thalli collected in Shanxi were approximately 5 cm in length. The thalli partially fragmented due to river erosion. Each thallus consisted of a firm central axis and peripheral branches, encased in a viscous gelatinous coating. Macroscopic views of the specimen are depicted in Fig. 2(B, D), and microscopic details of specimens in Shanxi are shown in Fig. 3.

The dimensions of different cells of specimen in Shanxi were measured. The apical cells of branches, 6.00–17.14 μm × 4.52–13.57 μm, were half spheroid with flat or angular (Fig. 3C–E). The central axis cells were ellipsoid to ovoid and were 7.14–17.85 μm × 4.28–9.28 μm in size (Fig. 3J–K). The branch cells were 5.88–19.99 μm × 4.41–9.34 μm (Fig. 3F–I). The branch cells were further categorized into dense branching intercalary cells and loose branching free cells. The intercalary cells of the dense branches were ellipsoid with angular or compressed shapes, while the free cells of the loose branches were spherical to spheroid.

Phylogenetic analysis

The molecular phylogeny was conducted based on SSU, LSU, and rbcL rDNA to reveal the placement of Hydrurus within Chrysophyceae. Pairwise distances based on three genes are respectively listed in Supplementary S2–S4. The tree topologies based on both methods including Maximum likelihood and Bayesian inference were similar. Thus, only the BI trees containing all of the supporting values are shown in Fig. 4. In the phylogeny, two strains of the genus Hydrurus were grouped into a single clade, which was sister to Phaeoplaca thallosa with strong support (0.999/97). Within the monophyletic clade of Hydrurus, the specimen in this study clustered closely with H. foetidus collected from Norway supported by full values (1.00/100). Furthermore, the pairwise distance (0.0043) and base difference (21 bp) between the two H. foetidus strains underscored their genetic similarity. Additionally, phylogenetic relationships between Hydrurus and other genera of Chrysophyceae were also revealed. The clade of Paraphysomonadida diverged at the base of the phylogenetic tree (1.00/100). Within Synurales, the genus Neotessella was closely related to the genera Synura and Mallomonas (0.988/86). Lagynion was closely related to Chrysophaera and Chromophyton with a high supporting value (1.00/100). Apoikia was clustered together with the genus Apoikiospumella (1.00/100). Within Chromulinales, Chrysamoeba was closely related to Oikomonas and Chromulina (1.00/100). Chrysosphaerella brevispina and C. longispina formed a sister group supported by high values (1.00/100). The genera Cyclonexis and Chromulinospumella diverged at the base of the clade of Chromulinales (0.982/98). Naegeliella and Chrysonebula were closely related to Kremastochrysopsis and Hibberdia (1.00/99). Segregatospumella dracosaxi formed an independent clade supported by low values (-/59). Ochromonas was not monophyletic, Ochromonas perlata and O. sphaerocystis were closely related to the genera Chlorochromonas and Cornospumella (1.00/100), while O. triangulata was closely related to species of Pedospumella and Uroglenopsis (1.00/99). The genus Spumella was monophyletic with a high supporting value (1.00/100). Uropstipulosphaera was closely related to Acrispumella and Poteriospumella (0.998/97). The Dinobryon strains shared a close relationship with Kephyrion sp. and Melkoniana species. A high supporting value (1.00/99) indicated that Uroglena strains were strongly connected to Chrysonephele, Chrysolepidomonas, and Epipyxis.

Molecular clock analyses

Our estimates represent minimum ages primarily based on fossil remains from the Giraffe Pipe locality. Time-calibrated phylogenetic analysis estimated the origin of species within Chrysophyta (Fig. 5). Based on the Bayesian relaxed clock analyses, we estimated the origin of the genus Hydrurus to be in the Early Cretaceous, approximately 125 million years ago (Ma), with a likely range of 103.19 Ma to 148.86 Ma. The two H. foetidus strains, collected from China and Norway, diverged between 3.7 Ma and 9.7 Ma, most probably during the Neogene period. The clade of Ochromonadales diverged from Hibberdiales and Segregatales between the Early Jurassic and Late Triassic (174.94–220.8 Ma), most likely in the Early Jurassic. Apoikiida originated approximately 107.81 Ma, and Chrysosaccales originated around 148.93 Ma. The clade of Chromulinales originated between 167.93 Ma and 213.69 Ma, most likely in the Early Jurassic. The clade encompassing Mallomonas and Synura diverged from Neotessella between the Early Cretaceous and Late Jurassic (119.13–151.79 Ma). Mallomonas diverged from Synura between 88.92 Ma and 111.91 Ma. Paraphysomonadida originated approximately in the Late Triassic (214.59 Ma).

ITS2 secondary structures

The ITS1-5.8S rDNA-ITS2 region of H. foetidus was sequenced, and the ITS2 secondary structure was constructed (Fig. 7). The ITS1 sequence length was 308 bp, the 5.8S sequence was 154 bp and the ITS2 sequence was 270 bp. Within the species of H. foetidus, a “ring-pin” model structure with four extended stems was identified. The ITS2 stems are typically maintained by base-pairing interactions among the four canonical Watson-Crick base pairs. The base and pairing composition of ITS2 in H. foetidus is shown in Table 3. In each division of ITS2, the paired region predominates over the unpaired region, and the helix region is larger than the loop region. The bulge region, which was an unpaired portion of the helix region, occupies approximately a quarter of the total length (24.07%). Heterogeneity is presented in the base composition of ITS2. The base content reveals a hierarchy of A > U > C > G, with a high AU content accounting for 60.53% of the total bases, followed by GC content. A comparative analysis was conducted helix I has a relatively lower purine content, being 0.88 times that of pyrimidine. In contrast, helix II–IV are dominated by purine.

Table 3 Base and pairing composition of ITS2 in H. foetidus

	A (%)	U (%)	C (%)	G (%)	Purines/ pyrimidines	CG(GC) (%)	AU(UA) (%)	GU(UG) (%)
Total	37.41	27.04	18.19	16.67	1.18	31.58	60.53	7.89
Paired region	55.77	42.95	26.28	25.64	1.18	31.58	60.53	7.89
Helix Ⅰ	33.33	30.00	23.33	13.33	0.88	33.33	66.67	0
Helix Ⅱ	47.50	30.00	7.50	15.00	1.67	21.43	71.43	7.14
Helix Ⅲ	36.17	27.66	17.02	19.15	1.24	29.41	52.94	17.65
Helix Ⅳ	34.75	27.97	19.49	17.80	1.11	36.36	57.58	6.06

Early reports suggested that the genus Hydrurus was widely distributed in the Holarctic region, encompassing cold temperate inland localities (Ward 1994). A subsequent study by Klaveness (2019) narrowed down the distribution areas outside an approximate 40° N to 40° S belt around the equator. When studying the distributions of H. foetidus, we discovered confirmed occurrences in the Patagonian Andes of Challhuaco, South America, and the Enguri River in Georgia (Barinova and Kukhaleishvili 2017; Villanueva et al. 2010). However, due to the lack of observed sightings, the latitude range of the distribution of H. foetidus remains uncertain. Apparent exceptions to the distribution limits include a high-mountain location in east Turkey at 39°44′ N (Cevik et al. 2007), an outflow from the Lirung glacier in Nepal (Hirano 1969), a high mountain in Tibet, China (Raju and Suxena 1979), the Vakhsh River basin lakes (Barinova et al., 2015), and the Pamir aquatic habitats (Barinova and Niyatbekov 2018). In this study, H. foetidus thalli was collected from Shanxi Province, China, at about 38° N, which is an exception to the distribution boundary proposed by Klaveness (2019). In addition, the four sites of Hydrurus specimens collected in this study were all near the source of the Fenhe River, aligning with earlier reports indicating a preference for Hydrurus to inhabit the source of rivers (Klaveness 2019). Consequently, we suggest expanding the latitude range of the distribution of the genus Hydrurus and emphasizing the need to further explore the geographical diversity of this genus.

H. foetidus is an important indicator of clean water and good ecological status. The species preferentially inhabits fast-flowing waters with low temperatures, exhibiting both rheophilic and psychrophilic properties (Klaveness 2017, 2019). The ecological characteristics of the habitat of H. foetidus are rarely reported, limiting our understanding of the living conditions of Hydrurus. Several studies have revealed that the highest water temperature in the distributions of Hydrurus does not exceed 16 ℃, maintaining a pH range of 7.5–8.3 and an oxygen content range of 10.6–15.1 mgL^-1 (Bursa 1934; Krizmanić et al. 2008; Redžić 1988; Stanković and Leitner 2016). In our study, the water temperature ranged from 4.4 ℃ to 6.3 ℃, with a pH of 7.04–7.24, and oxygen of 14.09–15.22 mgL^-1. We find certain similarities in the ecological characteristics of various habitats, particularly regarding water temperature, pH, and oxygen levels. Our results support the reported ranges for water temperature and oxygen levels while expanding the pH range. Hydrurus is sensitive to temperature and other chemical properties. In addition, the growth of Hydrurus exhibits certain seasonality. Typically, H. foetidus survives primarily from autumn to the subsequent spring, disintegrates and disappears in summer, and reappears in early autumn. Our specimen was collected in early spring. However, we rarely discover the species in winter, possibly due to environmental factors beyond temperature.

Each thallus of H. foetidus is arbuscular, composed of central axes and branches. The length of thalli can reach or exceed 30 cm under favorable conditions (Bursa 1934). The detailed morphological characteristics of this species have been described, and previous studies have provided cell size of H. foetidus: 8–16 × 12–22 μm (Mack 1953); 7–20 μm (Joyon 1963); 5–15 μm (Vesk et al. 1984). Klaveness and Lindstrøm (2011) separated measurements of the different cell categories, including apical cells (9–16 × 12–19 μm), central axis cells (20–32 × 8–12 μm) and branch cells (9–17.5 × 10–18 μm). In this study, we measured the cell size of the wild Hydrurus thalli collected from Shanxi Province. The cell size in this study was smaller than those reported in 2011, possibly due to variations in growth conditions between wild and cultured algal strains. In addition, the species exhibits obvious phenotypic plasticity, and the taxonomic history of the genus Hydrurus is complex and uncertain, therefore, relying only on morphological characteristics to study the species diversity is not sufficiently accurate.

However, the molecular sequences of the genus Hydrurus are scarce. Previous studies only provided three sequences and conducted phylogenetic trees to safely confirm Hydrurus as a chrysophyte (Klaveness et al. 2011; Lim et al. 1986). The absence of additional sequences of the genus Hydrurus underscores the need for more comprehensive molecular information to further determine the phylogenetic placement of the genus Hydrurus lineage. In our study, only the molecular sequences from the Shanxi specimen were obtained. We provided the first rbcL and ITS sequences for H. foetidus and predicted the ITS2 secondary structure of H. foetidus. Furthermore, phylogenetic trees were conducted based on concatenated SSU, LSU, and rbcL sequences to clarify the taxonomic status of H. foetidus. The close relationship between Hydrurus species collected in Shanxi, China, and Norway was inferred. The results of this study complement molecular evidence for the genus Hydrurus and enhance our comprehension of the species diversity of Chrysophyta.

Molecular clock analysis is rarely employed in the genus Hydrurus. Until recently, in 2019, Čertnerová et al. briefly alluded to the origin of the genus Hydrurus in their evolutionary study of Mallomonas (Čertnerová et al. 2019). Based on our relaxed clock analysis, the genus Hydrurus originated in the Early Cretaceous (approximately 125 Ma). The estimate is closer to the 130 Ma origin deduced by Čertnerová et al. (2019). In addition, our estimated diversifications of Synurales are slightly younger compared to the analyses presented by Siver and Čertnerová et al. (Čertnerová et al. 2019; Jo et al. 2013; Siver et al. 2015). Our time-calibrated phylogenetic analysis offers a valuable reference for the evolutionary history of Chrysophyta. Of course, more fossil discoveries and their application to the study of the evolutionary history of chrysophyta are crucial for further advancements.

New geographical distribution of the genus Hydrurus was discovered in the Fenhe River, Shanxi, China. Both morphological characteristics and molecular phylogeny strongly supported the new record of H. foetidus in China. This species exhibits temperature sensitivity and displays distinct seasonal variations. The visible thallus is consisted of a firm central axis and peripheral branches, with varying cell shapes. The phylogenetic analysis revealed a close relationship between H. foetidus specimens collected from China and Norway. Furthermore, the time-calibrated phylogenetic analysis inferred the genus Hydrurus originated most likely in the Early Cretaceous. This study supplements new molecular evidence of H. foetidus, enriching our knowledge of the species diversity and evolutionary history of the genus Hydrurus.

Author contributions

Conceptualization, Junxue Hao and Jia Feng; methodology, Junxue Hao and Yalu An; software, Fangru Nan and Xudong Liu; formal analysis, Junxue Hao and Yalu An; investigation, Junxue Hao; resources, Junping Lv and Qi Liu; data curation, Junxue Hao; writing-original draft preparation, Junxue Hao; writing—review and editing, Jia Feng; visualization, Shulian Xie; funding acquisition, Jia Feng. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (No. 32270220 and U22A20445 to Jia Feng) and the Nature Science Foundation of Shanxi Province (No. 202203021211313).

Acknowledgments

The first author thanks Enhui Liu for physical assistance in the process of collecting samples and Professor John Patrick Kociolek (University of Colorado) for his guidance on this manuscript.

Availability of data and material

The DNA sequences have been deposited in GenBank under accession numbers (OR230247, OR336050, OR284295, and PP025381). The results of this manuscript are available and can be provided upon request by contacting the authors for access to the data.

Competing interests

We declare that we have no conflicts of interest.

Barinova S, Boboev M, Hisoriev H (2015) Freshwater algal diversity of the South-Tajik Depression in a high-mountainous extreme environment, Tajikistan. Turkish Journal of Botany 39(3): 535–546. https://doi.org/10.3906/bot-1406-45.
Barinova S, Kukhaleishvili L (2017) Diversity and ecology of algae and cyanobacteria in the Enguri River, Georgia. Elixir Bio Sciences 104: 45934–45947.
Barinova S, Niyatbekov T (2018) Alpha-biodiversity of nondiatom algae in the Pamir aquatic habitats, Tajikistan. Biodiversity International Journal 2(3): 210–237. https://doi.org/10.15406/bij.2018.02.00065.
Bouckaert R, Heled J, Kühnert D, Vaughan T, Wu CH, Xie D, Suchard MA, Rambaut A, Drummond AJ, Prlic A (2014) BEAST 2: a software platform for Bayesian evolutionary analysis. PLoS computational biology 10(4): e1003537. https://doi.org/10.1371/journal.pcbi.1003537.
Bråte J, Fuss J, Mehrotra S, Jakobsen KS, Klaveness D (2019) Draft genome assembly and transcriptome sequencing of the golden algae Hydrurus foetidus (Chrysophyceae). F1000Res 8: 401. https://doi.org/10.12688/f1000research.16734.2
Bursa A (1934) Hydrurus foetidus Kirch. w Polskich Tatrach. - Hydrurus foetidus Kirch. in der Polnischen Tatra. I. Oekologie, Morphologie. II. Phenologie. Bull. Int. Acad. Pol. Sci. Lett. Cl. Sci. Math. Nat. Sér. B Sci. Nat. I: 69–84.
Čertnerová D, Čertner M Škaloud P (2019) Molecular phylogeny and evolution of phenotype in silica‐scaled chrysophyte genus Mallomonas. Journal of phycology 55(4): 912–923. https://doi.org/10.1111/jpy.12882.
Cevik F, Whitton B, ÖZTÜRK O (2007) A new genus record for the freshwater algal flora of Turkey. Turkish Journal of Botany 31(2): 149–152.
Creaser RA, Grütter H, Carlson J, Crawford B (2004) Macrocrystal phlogopite Rb-Sr dates for the Ekati property kimberlites, Slave Province, Canada: evidence for multiple intrusive episodes in the Paleocene and Eocene. Lithos 76(1–4): 399–414. https://doi.org/10.1016/j.lithos.2004.03.039.
Darty K, Denise A, Ponty Y (2009) VARNA: Interactive drawing and editing of the RNA secondary structure. Bioinformatics 25(15): 1974–1975. https://doi.org/10.1093/bioinformatics/btp250.
Doria G, Royer DL, Wolfe AP (2011) Declining atmospheric CO₂ during the late Middle Eocene climate transition. American Journal of Science 311(1): 63–75. https://doi.org/10.2475/01.2011.03.
Guiry MD, Guiry GM (2021) AlgaeBase. World-wide electronic publication, National University of Ireland, Galway. https://www.algaebase.org; accessed 20 June 2024.
Hirano M (1969) Freshwater algae from Rangtang Himal, Nepal Himalaya. Contributions from the Biological Laboratory, Kyoto University, 22: 1–42.
Jo BY, Kim JI, Škaloud P, Siver PA, Shin W (2016) Multigene phylogeny of Synura (Synurophyceae) and descriptions of four new species based on morphological and DNA evidence. Journal of Phycology 51(4): 413–430. https://doi.org/10.1080/09670262.2016.1201700.
Jo BY, Shin W, Boo SM, Kim HS, Siver PA (2011) Studies on ultrastructure and three-gene phylogeny of the genus Mallomonas (Synurophyceae). Journal of Phycology 47(2): 415–425. https://doi.org/10.1111/j.1529-8817.2010.00953.x.
Jo BY, Shin W, Kim HS, Siver PA, Andersen RA (2013) Phylogeny of the genus Mallomonas (Synurophyceae) and descriptions of five new species on the basis of morphological evidence. Phycologia 52(3): 266–278. https://doi.org/10.2216/12-107.1.
Joyon L (1963) Contribution a l’etude cytologique de quelques protozoaires flagelle´s. Ann. Fac. Sci. Univ. Clermont, 22: Biologie Animale (1), 1–96 + Pl. I-XXXVII.
Katoh K, Rozewicki J, Yamada KD (2019) MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics 20(4): 1160–1166. https://doi.org/10.1093/bib/bbx108.
Kawecka B (2003) Effect of different light conditions on cyanobacteria and algal communities in Tatra Mts stream (Pland). Oceanological and Hydrobiological Studies 2: 3–13.
Klaveness D (2017) Hydrurus foetidus (Chrysophyceae)—an inland macroalga with potential. Journal of Applied Phycology 29(3): 1485–1491. https://doi.org/10.1007/s10811-016-1047-5.
Klaveness D (2019) Hydrurus foetidus (Chrysophyceae): an update and request for observations. Algae 34(1): 1–5. https://doi.org/10.4490/algae.2019.34.1.15.
Klaveness D, Bråte J, Patil V, Shalchian-Tabrizi K, Kluge R, Gislerød HR, Jakobsen KS (2011) The 18S and 28S rDNA identity and phylogeny of the common lotic chrysophyte Hydrurus foetidus. European Journal of Phycology 46(3): 282–291. https://doi.org/10.1080/09670262.2011.598950.
Klaveness D, Lindstrøm EA (2011) Hydrurus foetidus (Chromista, Chrysophyceae): A large freshwater chromophyte alga in laboratory culture. Phycological Research 59(2): 105–112. https://doi.org/10.1111/j.1440-1835.2010.00606.x.
Kristiansen J, Preisig HR (2011). Order Hydrurales. In: John DM, Whitton BA, Brook AJ eds. The Freshwater Algal Flora of the British Isles - An Identification Guide to Freshwater and Terrestrial Algae. 2nd ed. Cambridge: Cambridge University Press, pp. 308–310.
Krizmanić J, Subakov-Simić G, Karadžić V (2008) Supplementary notes on the distribution of Hydrurus foetidus (Vill.) Trevisan (Chrysophyta) in Serbia. Archives of Biological Sciences 60(2): 13–14. https://doi.org/10.2298/ABS0802001K.
Lanfear R, Frandsen PB, Wright AM, Senfeld T, Calcott B (2017) PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 34(3): 772–773. https://doi.org/10.1093/molbev/msw260.
Lim BL, Kawai H, Hori H, Osawa S (1986) Molecular evolution of 5S ribosomal RNA from red and brown algae. The Japanese Journal of Genetics 61(2): 169–176. https://doi.org/10.1266/jjg.61.169.
Lutz S, McCutcheon J, McQuaid JB (2018) The diversity of ice algal communities on the Greenland Ice Sheet as revealed by oligotyping. Microbial Genomics 4(3): 1–10. https://doi.org/10.1099/mgen.0.000159.
Mack B (1953) Untersuchungen an Chrysophyceen IV. Zur Kenntnis von Hydrurus foetidus. Österreichische Botanische Zeitschrift, 100: 579–582. https://doi.org/10.1007/BF01815063.
Medlin L, Elwood HJ, Stickel S, Sogin ML (1988) The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 71(2): 491–499. https://doi.org/10.1016/0378-1119(88)90066-2.
Milner AM, Brittain JE, Castella E, Petts GE (2001) Trends of macroinvertebrate community structure in glacier-fed rivers in relation to environmental conditions: a synthesis. Freshwater Biology 46(12): 1833–1847. https://doi.org/10.1046/j.1365-2427.2001.00861.x.
Milner AM, Brown LE, Hannah DM (2009). Hydroecological response of river systems to shrinking glaciers. Hydrological Processes 23(1): 62–77. https://doi.org/10.1002/hyp.7197.
Nguyen LT, Schmidt HA, von Haeseler A, Minh BQ (2015) IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular biology and evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300.
Nozaki K, Matsumoto Y. Tashiro T (2020) Accumulation of Hydrurus foetidus (Chrysophyceae) in sand ripples of a volcanic inorganic acidified river in the southern part of Mount Ontake, central Japan. Rikunomizu (Limnology in Tokai Region of Japan), Volume 87: 53–58.
Pusztai M, Škaloud P (2019) Elucidating the evolution and diversity of Uroglena-like colonial flagellates (Chrysophyceae): polyphyletic origin of the morphotype. European Journal of Phycology 54(3): 404–416. https://doi.org/10.1080/09670262.2019.1574030.
Raju NS, Suxena MR (1979) Algae and Testacea of the Cho Oyu (Himalayas) expedition-II; Gyanophyta, Chlorophyta, Euglenophyta, Chrysophyta and Testacea. Hydrobiologia 67: 141–160. https://doi.org/10.1007/BF00126714.
Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA (2018) Posterior Summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology 67: 901–904.
Redžić A (1988) Fitobentos rijeke Neretve kao pokazatelj kvaliteta voda. Godišnjak Biološkog Instituta Univerziteta u Sarajevu 41: 49–62.
Remias D, Jost S, Boenigk J (2013) Hydrurus-related golden algae (Chrysophyceae) cause yellow snow in polar summer snowfields. Phycological Research 61(4): 277–285. https://doi.org/10.1111/pre.12025.
Riisberg I, Orr RJS, Kluge R, Shalchian-Tabrizi K, Bowers HA, Patil V, Edvardsen B, Jakobsen KS (2009) Seven gene phylogeny of heterokonts. Protist 160(2): 191–204. https://doi.org/10.1016/j.protis.2008.11.004.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling L, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: efficient bayesian phylogenetic inference and model choice across a large model space. Systematic biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029.
Rott E, Cantonati M, Füreder L, Pfister P (2006a) Benthic algae in high altitude streams of the alps – a neglected component of the aquatic biota. Hydrobiologia 562: 195–216. https://doi.org/10.1007/s10750-005-1811-z.
Rott E, Füreder L, Schütz C, Sonntag B, Wille A (2006b) A conceptual model for niche differentiation of biota within an extreme stream microhabitat. Verh. Internationale Vereinigung für theoretische und angewandte Limnologie: Verhandlungen 29: 2321–2323. https://doi.org/10.1080/03680770.2006.11903108.
Siver PA, Jo BY, Kim JI, Shin W, Lott AM, Wolfe AP (2015) Assessing the evolutionary history of the class Synurophyceae (Heterokonta) using molecular, morphometric, and paleobiological approaches. American Journal of Botany 102(6): 921–941. https://doi.org/10.3732/ajb.1500004.
Škaloud P, Škaloudová M, Jadrná I, Bestová H, Pusztai M, Kapustin D, Siver PA (2020) Comparing morphological and molecular estimates of species diversity in the freshwater genus Synura (Stramenopiles): a model for understanding diversity of eukaryotic microorganisms. Journal of phycology 56: 574–591. https://doi.org/10.1111/jpy.12978.
Stanković I, Leitner P (2016) The first record of Hydrurus foetidus (Villars) Trevisan (Ochrophyta: Chrysophyceae) in Croatia with ecological notes. Natura Croatica : Periodicum Musei Historiae Naturalis Croatici 25: 223–231. https://doi.org/10.20302/NC.2016.25.18.
State Environmental Protection Administration (2002) Monitoring Method of Water and Wastewater, fourth ed. China Environmental Science Press, Beijing.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular biology and evolution 28(10): 2731–2739. https://doi.org/10.1093/molbev/msr121.
Vesk M, Hoffman LR, Pickett-Heaps JD (1984) Mitosis and cell division in Hydrurus foetidus (chrysophyceae). Journal of Phycology 20(4): 461–470. https://doi.org/10.1111/j.0022-3646.1984.00461.x.
Villanueva VD, Buria L, Albariño R (2010) Primary consumers and resources: Annual variation in two contrasting reaches of a Patagonian mountain stream. Annales de Limnologie - International Journal of Limnology 46(1): 21–28. https://doi.org/10.1051/limn/2010003.
Ward JV (1994) Ecology of alpine streams. Freshwater biology 32(2): 277–294. https://doi.org/10.1111/j.1365-2427.1994.tb01126.x.
Wee JL, Fasone LD, Sattler A, Starks WW, Hurley DL (2001) ITS/5.8S DNA sequence variation in 15 isolates of Synura petersenii Korshikov (Synurophyceae). Nova Hedwigia Beiheft 122: 245–258.
Wei YX (2018) Chrysophyta. In: Wei, Y X, ed. Flora Algarum Sinicarum Aquae Dulcis, Tomus XXI. Beijing, China: Beijing Science Press, pp. 142–143. (in Chinese)
White TJ, Bruns T, Lee S, Taylor JW (1990) Amplificationand direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR Protocols: A Guide to Methods and Applications. New York: Academic Press, pp. 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1.
Zah R, Burgherr P, Bernasconi S, Uehlinger U (2001) Stable isotope analysis of macroinvertebrates and their food sources in a glacier stream. Freshwater Biology 46(7): 871–882.
Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular ecology resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096.
Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Nucleic Acids Research 31(13): 3406–3415. http://dx.doi.org/10.1093/nar/gkg595.

No competing interests reported.

tables.zip
Tables S1-S4

New molecular evidence of the rare genus Hydrurus (Chrysophyceae) and descriptions of Hydrurus foetidus (Villars) Trevisan on the basis of morphological and molecular phylogeny

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1