Lactobacillus paracasei ZJUZ2-3 suppresses gastric tumorigenesis by inhibiting NF-κB pathway via metabolite 3-IAA

doi:10.21203/rs.3.rs-4886623/v1

Download PDF

Research Article

Lactobacillus paracasei ZJUZ2-3 suppresses gastric tumorigenesis by inhibiting NF-κB pathway via metabolite 3-IAA

https://doi.org/10.21203/rs.3.rs-4886623/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

BACKGROUND & AIMS: Lactobacillus paracasei is known to confer health benefits to human and has been found depleted in gastric tumor tissues. Here, we aimed to investigate the potential role of this bacterium as a prophylactic for gastric cancer (GC).

METHODS: Isolation of L. paracasei from normal gastric tissues followed by whole genome sequencing was conducted. Antitumor effects of a L. paracasei isolate and its tumor-suppressive metabolite were assessed with gastric cancer cell lines and cell line-derived xenograft models.

RESULTS: We validated that L. paracasei was depleted in GC tumor tissues in a cohort of 90 patients. A L. paracasei strain ZJUZ2-3 was then isolated. Intratumoral injection of ZJUZ2-3 suppressed GC tumourigenesis in nude mice. Coincubation with ZJUZ2-3 or its conditioned medium inhibited the proliferation of GC cells. But heat-killed ZJUZ2-3 lost the tumor-suppressive effect. Indole-3-acetic acid (IAA) was identified as a ZJUZ2-3-derieved metabolite mediating the antitumor effect. IAA inhibited proliferation and colony formation of GC cells as well as subcutaneous tumor growth in nude mice. Mechanically, as an aryl hydrocarbon receptor (AHR) ligand, IAA activated AHR, which could competitively bind MTDH to inhibit its phosphorylation, thus inhibiting nuclear factor kB (NF-kB) signaling pathway in GC cells. Consistently, inhibition or knockdown of AHR abolished the antitumor effect of IAA.

CONCLUSION: L. paracasei ZJUZ2-3 inhibit GC proliferation and may be used as adjuvant therapy for gastric cancer. The tumor-suppressive effect is mediated by its metabolite IAA.

gastric cancer

L. paracasei

indole-3-acetic acid

aryl hydrocarbon receptor

Gastric cancer (GC) is the fifth most common cancer and a leading cause of cancer-related mortality worldwide[1]. Although Helicobacter pylori is broadly recognized as a major risk factor for GC[2], emerging evidence indicates the presence of a large number of non-H. pylori microbes residing in the gastric tissue, and their dysbiosis may also play a role in gastric carcinogenesis[3][4]. Nevertheless, non-H. pylori bacteria associated with gastric carcinogenesis remain largely unexplored. Notably, it has been proven locally isolated Lactobacillus plantarum possessed anti-cancer effects by regulating immunological cell signaling pathways, suggesting supplementation of probiotics could be considered as a treatment strategy for gastric cancer[5].

The potential cancer-therapy effects of probiotics have been reported in experimental studies and clinical trials[6][7]. We have demonstrated that Lactobacillus paracasei is depleted in GC patients tumor tissues compared with normal tissues[8]. This organism has been shown not only to benefit the digestive system of the human body by regulating gut microbiota and intestinal homeostasis and enhancing immunity, but also tolerate acid and bile salt[9]. Studies have proven that a L. paracasei stain PS23 is a safe and effective probiotic[10]. However, the function of L. paracasei in gastric cancer and the relevant mechanisms of action remain unclear. The gut microbiota generate various metabolites, including secondary bile acids, short-chain fatty acids (SCFAs), indole and amino acid metabolites[11]. Our previous study has revealed a positive correlation between the indole-3-acetic (IAA) levels and L. paracasei abundance in gastric tissues [12]. IAA is an intermediate product of tryptophan (Trp) metabolism, which can activate the aryl hydrocarbon receptor (AHR). AHR was reported to interact with the nuclear factor kB (NF-kB) signaling pathway.

In this study, we isolated and characterized a novel strain of L. paracasei, which inhibited gastric tumorigenesis in vitro and in vivo. Furthermore, we discovered that the antitumor effect could be attributed to is metabolite IAA. Mechanically, IAA activates AHR, which inhibits MTDH phosphorylation, thereby suppressing the NF-KB pathway and inhibiting the development of gastric cancer. Hence, our study isolated a L. paracasei strain with anti-gastric cancer properties and uncovered the underlying mechanism.

L. paracasei abundance was decreased in tumor tissue samples of GC patients

Our previous study based on 16s rRNA gene sequencing showed that the abundance of Lactobacillus in gastric cancer tumor tissues is significantly lower than that in normal tissues[8]. Here we validated the enrichment of Lactobacillus in normal gastric tissues with qPCR in paired tumor and adjacent normal tissues of 90 patients (Figure S1A). Then qPCR detection of major Lactobacillus species was also conducted, which revealed that L. paracasei, but not L. johnsonii or L. reuteri, had significantly higher relative abundance of this species in normal tissues than in tumor tissues (Fig. 1A,1B, S1B & S1C). Interestingly, L. paracasei is a known probiotics with reported antitumor capability[13][14]. The colonization of this species in the stomach was confirmed by fluorescence in situ hybridization (FISH) and PCR detection of bacterial DNA (Fig. 1C and Figure S1D). These findings suggest the potential protective role of L.paracasei in GC progression.

A novel Lactobacillus paracasei ZJUZ2-3 was isolated from normal gastric tissue

We isolated a strain of L. paracasei (designated ZJUZ2-3) from the normal tissue of a gastric cancer patient (Fig. 1D), and performed whole genome sequencing of the isolate. The complete genome of strain ZJUZ2-3 was determined and found to contain a circular chromosome with a size of 3080235 bp and a GC content of 46%. It contains 2850 protein coding genes, 77 non-coding genes. Genomic testing revealed that the strain contains two plasmids with sizes of 9535 bp and 10797 bp, respectively (Fig. 1E). After software analysis, the whole genome ANIb value of the relative Lactobacillus paracasei strain (NCBI genome registration number: GCA_029625355.1) was 99.6656, and the whole genome ANIb value of the relative Lactobacillus paracasei strain (NCBI genome registration number: GCA_030480425.1) was 99.6618. ANIb, Average nucleotide identity using BLAST, also known as average nucleotide identity using BLAST, is an indicator for evaluating the phylogenetic relationship of strains. It is generally believed that ≥ 95 indicates belonging to the same species. The genome of the above-mentioned strain ZJUZ2-3 is not completely consistent with the genome of Lactobacillus paracasei in the NCBI database. The species evolution tree showed that ZJUZ2-3 was a subspecies of Lactobacillus paracasei (Fig. 1F). Notably, it possessed a tryptophan metabolism pathway. We found the enzyme tryptophan decarboxylase (TrpD) which can decompose tryptophan into indole derivatives (Fig. 1G).

Figure1L. paracasei ZJUZ2-3 was isolated from a GC patient normal tissue

The abundance of Lactobacillus in patients with GC (N = 49)

The relative abundance of L. paracasei in tumor tissues and normal tissues of GC patients. *p < 0.05, ** p < 0.01, ***p < 0.001, **** p < 0.0001.

Representative FISH images of gastric tissue sections from GC patients (blue: nuclear, green: L.paracasei probe); scale bars, 100 µm.

Isolation of a novel L.paracasei strain from a GC patient’ normal tissue.

The whole genome map of L.paracasei ZJUZ2-3. The circle chart displays GC content, sequencing depth, gene element display, and COG function display from the outside to the inside.

Phylogenetic tree of L.paracasei ZJUZ2-3. A phylogenetic tree based on core single copy genes constructed using Neighbour joining clustering.

Functional annotation of L.paracasei ZJUZ2-3 genome using KEGG metabolic pathway.

L. paracasei ZJUZ2-3 and its conditioned medium inhibited the viability of gastric cancer cells

We next determined whether L. paracasei ZJUZ2-3 had anti-tumor effect in vitro. Gastric cancer cell lines AGS and HGC27 were cocultured with L. paracasei ZJUZ2-3 (1×10⁷ CFU/ml) for 4 hours, while PBS was used as blank control. L. paracasei coculture significantly decreased GC cell viability (Fig. 2A). This growth-inhibitory effect was further confirmed by colony formation assay (Fig. 2B). Live L. paracasei ZJUZ2-3 was heat-killed by autoclaving and subsequently exposed to gastric cancer cells. The E. coli strain DH5ɑ was used as bacteria control. In contrast, neither heat-killed L. paracasei ZJUZ2-3 nor E. coli DH5ɑ induced the reduction of gastric cancer cell viability (Fig. 2C and D).

We next explored whether such function was attributed to L. paracasei ZJUZ2-3 itself or its metabolites. L. paracasei culture was centrifuged and the supernatant was then filtered through a 0.22 µm membrane to obtain a conditional culture medium (CM), which was used to treat AGS and HGC27 cells at the concentration of 1% (v/v) for 4 days. PBS and LBM were used as negative controls. Interestingly, the CM significantly inhibited AGS and HGC27 growth (Figure S2E and 2F). To further distinguish the type of molecules responsible for such effect, the L. paracasei conditional medium (Lp.CM) was pretreated with or without protease K (PK, 1 mg/mL). The inhibitory effect remained unchanged after PK treatment, indicating that the antitumor effect was dependent on non-protein metabolites in the Lp.CM.

Figure2 Living L. paracasei ZJUZ2-3 and its metabolites could inhibit GC cell growth.

(A)L.paracasei ZJUZ2-3 (MOI = 100) inhibits the cell viability of gastric cancer cells AGS and HGC27 as determined by CCK8 assays. (Lp: L. paracasei ZJUZ2-3)

(B)Colony formation of GC cells under the treatment of L.paracasei ZJUZ2-3.

(C, D) Cell viability (C) and colony formation (D)of GC cells under the treatment of L. paracasei ZJUZ2-3, heat-killed L. paracasei ZJUZ2-3 and E.coli DH5ɑ

(E, F) (E)Cell viability at OD450nm and (F)colony formation of human GC cells (AGS and HGC27) treated with PBS, Lp conditional medium (Lp.CM), Lp conditional medium with digestion by protease K (PK-Lp.CM) and lactobcillus broth medium (LBM).

L. paracasei ZJUZ2-3 exerted antitumor effects in GC xenograft mice

Mouse experiments were further conducted to assess the potential protective effect of L. paracasei ZJUZ2-3 against GC (Fig. 3A). Four-week-old nude mice were subcutaneously injected with HGC27 cells (3×10⁶ cells). After seven days, L. paracasei ZJUZ2-3 (1×10⁸ CFU/50 µl) or PBS with an equivalent volume (blank control) was intratumorally injected once in two days (Fig. 3B). L. paracasei ZJUZ2-3-treated mice had an obvious reduction in tumor size and weight compared to those injected with PBS (Fig. 3B, E and F). HE results indicated L. paracasei ZJUZ2-3 treated mice had a lower percentage of low-grade dysplasia as compared with control (Fig. 3G). L. paracasei ZJUZ2-3 treatment markedly reduced the number of Ki-67-positive cells in tumor tissues (Fig. 3H). Successful intratumor colonization of L. paracasei ZJUZ2-3 was confirmed by FISH (Fig. 3C) and PCR with customized primers (Supplementary Fig. 1E). In addition, L. paracasei ZJUZ2-3 injection did not alter mouse body weight (Fig. 3D).

We then assessed the efficacy of L. paracasei ZJUZ2-3 in an orthotopic mouse model of GC (Fig. 3I). Nude mice bearing orthotopic HGC27 tumors were oral gavaged with PBS or L. paracasei ZJUZ2-3 at a dose of 1×10⁸CFU/100µl, for 10days. As shown in Fig. 3J, mice gavaged with L. paracasei ZJUZ2-3 significantly had a decreased growth of orthotopic tumor. HE and Ki-67 staining results confirmed L. paracasei ZJUZ2-3 inhibited the orthotopic tumor growth (Fig. 3K). Those results confirmed the protective effect of L. paracasei ZJUZ2-3 against gastric tumorigenesis.

Figure3L. paracasei ZJUZ2-3 inhibited tumor growth in the GC xenograft mice.

Schematic diagram shows the experimental design, time line and treatment of the GC xenograft mice (Lp: L. paracasei ZJUZ2-3).

The representative tumor morphologies.

L. paracasei ZJUZ2-3 colonization was confirmed by FISH.

(D-F) (D)The mouse body weight curve; (E)Tumor growth curve, and (F) tumor weight compared between L. paracasei ZJUZ2-3- or PBS-treated groups. Data are shown as mean ± SEM. ****p < 0.0001.

(G)Representative H&E image of tumor tissues from mice administrated with PBS, IAA and L. paracasei ZJUZ2-3. scale bars, 100 µm.

(H) Ki-67 staining showed decreased numbers of Ki-67⁺ cells in the tumor tissues of IAA and L. paracasei ZJUZ2-3 treated groups.scale bars, 100 µm

(I) Schematic diagram shows the experimental design, time line and treatment of orthotopic mouse model of GC.

(J) The representative stomach of mice.

(K) Representative H&E and Ki-67 staining images of stomach tumor tissues from mice oral gavaged with PBS and L. paracasei ZJUZ2-3. scale bars, 100 µm.

Protective effect of L.paracasei ZJUZ2-3 is associated with the production of indole-3-acetic acid (IAA)

L. paracasei has been shown to release metabolites, including the indole-derivative indole-3-acetic acid (IAA) to interact with the host [15]. Based on our previous untargeted metabolome analysis, we found that discriminative metabolites in tumor tissue and normal tissues of gastric cancer patients were enriched in the tryptophan pathway (Fig. 4A)[8]. The tryptophan metabolite IAA was the most significantly enriched in normal tissues (Fig. 4B). Correlation analysis revealed that Lactobacillus abundance was positively correlated with IAA, suggesting that IAA might play a role in the inhibitory tumor progression of L.paracasei ZJUZ2-3 (Fig. 4C). We then treated GC cells with L. paracasei ZJUZ2-3 and found IAA increased in the supernatant compared with PBS (Fig. 4D). Taken together, these data demonstrate that the antitumor effect of L. paracasei ZJUZ2-3 was likely mediated by IAA.

IAA inhibit GC development in vitro and in vivo

Upon establishing the involvement of IAA in L. paracasei-mediated tumor suppression, we assessed whether IAA alone is sufficient to induce an antitumor response. Remarkably, IAA significantly inhibited the viability of AGS (p < 0.01) and HGC27 (p < 0.01) cells in a concentration-dependent manner (Fig. 4E). IAA treatment also markedly restrained the colony formation of GC cells, compared with control (p < 0.01; Fig. 4F). Subsequently, we verified the impact of IAA on the nude mouse xenograft model (Fig. 3A). Consistently, IAA demonstrated significant inhibitory effects on mouse tumors. Compared to the PBS control, the IAA intratumoral injection group showed a significant reduction in tumor growth (Fig. 3B). HE and Ki-67 staining results indicated that IAA could suppress tumor growth in the GC xenograft model (Fig. 3G and 3H). The tumor size (p<0.001) and weight (p<0.001) in the IAA treatment group were significantly reduced compared to the control group (Fig. 3D and 3F). We then assessed the efficacy of IAA and L. paracasei ZJUZ2-3 in an orthotopic mouse model of GC (Fig. 4G). Nude mice bearing orthotopic HGC27 tumors were oral gavaged with PBS, IAA or L. paracasei ZJUZ2-3 at a dose of 100µM/100µl and 1×10⁸CFU/100µl, for 10days. As shown in Fig. 4H, mice gavaged with IAA and L. paracasei ZJUZ2-3 significantly had a decreased growth of orthotopic tumor. HE and Ki-67 staining results confirmed IAA and L. paracasei ZJUZ2-3 inhibited the orthotopic tumor growth (Fig. 4I). These results confirmed that the GC-suppressive effect of L. paracasei ZJUZ2-3 was mediated by the tryptophan metabolite IAA.

Figure4 IAA inhibited tumor cell growth in vitro and in vivo.

KEGG pathway enrichment analysis of DEGs from RNA sequencing dataset of GC patients. Size of circles represents the ratio of DEGs in pathways. Red: upregulated, blue: downregulated.

The abundance of IAA in GC patients.

Correlation analysis between bacteria and indole derivatives.

The concentration of IAA in GC cells supernatant co-cultured with L. paracasei ZJUZ2-3 were detected by ELISA.

Cell viability at OD450nm of human GC cells (AGS, HGC27) treated with PBS or IAA.

Colony formation of GC cells under treatment of PBS or IAA (50 µM).

Schematic diagram shows the experimental design, time line and treatment of the GC xenograft mice.

The representative stomach morphologies of mouse.

Representative HE and Ki-67 staining images of tumor tissues from mice administrated with PBS, L. paracasei ZJUZ2-3 and IAA.

IAA mediates antitumor effects via activation of the aryl hydrocarbon receptor (AHR)

To investigate the mechanism triggered by IAA for GC inhibition, RNA sequencing was performed to profile gene expression alterations in GC cell treated with IAA, by which 100 deregulated genes were identified. Of note, the aryl hydrocarbon receptor (AHR) was significantly upregulated (Fig. 5A). AHR, a DNA binding protein existing in the cytoplasm as an inactive state AHR signal, is highly expressed in GC cells, so AHR is effective only activated by its ligand[16]. We further confirmed IAA treatment increased the protein levels and the activity of AHR in both GC cell lines (Fig. 5B, D and F). Accordingly, treatment with L. paracasei ZJUZ2-3 had the similar effect (Fig. 5C and E).

To investigate the direct link between the AHR pathway and the tumor-suppressive effect of L. paracasei ZJUZ2-3 and IAA, we used an AHR antagonist, CH223191, to block AHR activity. We observed that CH223191 treatment inhibit the antitumor effect of IAA via the CCK8 assay and colony formation test (Fig. 5G and H). Consistently, intratumoral injection of CH223191 abolished IAA-induced tumor suppression in vivo (Fig. 6A, B, D and E), these treatments did not impact the body weight of mouse (Figure S1F), and the ratio of Ki-67-positive cells was restored (Fig. 6F and G). Successful colonization of L. paracasei in tumor tissues of nude mice was also confirmed by FISH and PCR (Fig. 6C and Figure S1E). Meanwhile, knockdown of AHR in GC cells also abrogated the protective function of IAA in vitro (Figure S2A-C). These findings demonstrated a critical role of AHR in IAA-mediated the antitumor effect in GC.

Figure5L. paracasei ZJUZ2-3 and IAA could upregulate AHR, and AHR antagonists could abolish the antitumor effect of IAA.

Wiki pathway enrichment analysis of DEGs from RNA sequencing dataset of HGC27 cells treated with IAA. Size of circles represents the ratio of DEGs in pathways. Red: upregulated, blue: downregulated.

(B, C) Western blot analysis of the activation of AHR in (B) IAA- and (C) L. paracasei ZJUZ2-3- treated GC cells.

(D, E) The concentration of AHR in GC cells supernatant co-cultured with (D)IAA (50 µM) and (E) L. paracasei ZJUZ2-3.

The mRNA levels of AHR in GC cells treated with IAA (50µM).

(G,H) (G)Cell viability at OD450nm and (H)colony formation of human GC cells (AGS and HGC27) with PBS, IAA, CH223191(10µM), CH223191 + IAA.

IAA inhibits the activation of NF-κB signaling pathway

Numerous studies reported that the activation of AHR could inhibit the NF-κB signaling pathway, decrease the transcription of proinflammatory factors, including TNF-α and IL-6, and promote the release of anti-inflammatory factor IL-10, to prevent the proinflammatory process[17]. Pathway enrichment analysis identified that several oncogenic pathways including NF-κB, IL-17, and IL-22 pathway were downregulated in IAA-treated HGC27 (Fig. 5A). Enrichment score showed that NF-κB signaling was significantly inhibited by IAA (Fig. 6I). Indeed, protein expression level of pNF-κB and pIKB-ɑ were decreased in L. paracasei ZJUZ2-3-infected and IAA treated GC cells as shown by western blot (Fig. 6H). Our results collectively indicated that IAA can downregulate NF-κB signaling pathway, which in turn contributes to its antitumor effect in GC.

Figure6 IAA inhibites NF-kB signaling pathway through AHR

The representative tumor and mice morphologies.

Schematic diagram shows the experimental design, time line and treatment of the GC xenograft mice.

Representative FISH images of tumor tissues from PBS- and Lp-injected mice. (blue: nuclear, green: FITC, red: L. paracasei probe); scale bars, 100 µm.

Tumor growth curve of mice from mice injected PBS, IAA, CH223191 and CH223191 + IAA.

Tumor weight of HGC27 xenograft. Tumor weight was shown as mean ± SEM. ****p < 0.0001.

Representative images of H&E staining of tumor tissues of HGC27 xenograft injected PBS, IAA, CH223191 and CH223191 + IAA.

Ki-67 staining showed decreased proliferation rates in L. paracasei and IAA injected mice compaired with PBS, CH223191 and CH223191 + IAA. scale bars, 100µm. Lp, L. paracasei.

Western blot analysis of the inhibition of NF-kB of AGS and HGC27 treated with Lp and IAA.

Gene set enrichment analysis (GSEA) showing the enrichment of NF-kB signaling pathways.

IAA suppressed NF-κB signaling pathway through inhibiting IKB-mediated MTDH phosphorylation

To explore whether and how AHR suppresses NF-kB activation in GC cells, AHR-associated proteins were isolated from HGC27 cells (Fig. 7A) by Co-immunoprecipitation (Co-IP) assays and analyzed by liquid chromatography and high-throughput mass spectrometry (LC-MS/MS) (Fig. 7C). Over 10 candidates along with the known AHR-binding proteins HSPA7 and VIM were identified, but none of them were NF-kB subunits (Table S1), suggesting that AHR did not directly interact with NF-kB[18][19]. However, the oncoprotein Metadherin (MTDH), which binds to IKK-B to promote NF-kB activity in chemical HCC[20], was identified as a putative NF-kB-associated protein among the candidates (Fig. 7B). Immunofluorescence results showed the co-localization of AHR and MTDH in GC cells, further proving the interaction between AHR and MTDH (Fig. 7D).

The interaction between MTDH and IKK-B promotes NF-kB nuclear translocation induced by the tumor necrosis factor α (TNF-α)[21]. MTDH can be phosphorylated by IKK at Ser297 (murine) or Ser298 (human), and only phosphorylated MTDH acts as a co-activator for NF-kB on some of its target gene promoters[21] [22]. Therefore, we speculated that IAA could activate AHR, and then inhibit IKK-mediated MTDH phosphorylation to suppress NF-κB signaling pathway. We thus determined whether AHR affected the interaction between MTDH and IKB-ɑ in GC cells. MTDH phosphorylation (pMTDH) and IKB-ɑ phosphorylation (pIKB-ɑ) was increased in GC cells treated with siAHR or CH223191 (Fig. 7E). Conversely, IAA-treated groups alleviated the phosphorylation of MTDH and IKB-ɑ. Thus, AHR could inhibit IKB-mediated MTDH phosphorylation, thereby suppressing GC cells NF-kB activation.

To explore the direct binding between AHR and MTDH, HDock was employed to predict protein-protein interaction molecular docking. (Fig. 7F). The analysis of protein-protein interaction surfaces based on PDBePISA indicated that GLY237 and GLY240 were putative binding sites for AHR and MTDH (Figure S3A, B and C). Collectively, AHR inhibits MTDH phosphorylation by IKB and the inhibitory of AHR relieves this inhibition, thereby preventing MTDH to promote GC cells NF-kB activation.

Overall, these results suggested that IAA promotes the transcriptional expression of AHR, which may bind to MTDH to inhibit its phosphorylation, thereby suppressing the activation of the NF-κB signaling pathway.

Figure7 AHR complete with IKB-ɑ binding MTDH to suppress NF-kB activation

Co-immunoprecipitation (Co-IP) assays showed the protein binding with AHR.

Mass spectrometry analysis demonstrated the protein MTDH.

Immunoprecipitation of AHR and MTDH HGC27 cells lysates also showed positive binding between AHR and MTDH.

Immunofluorescence (IF) used to confirm the binding of AHR and MTDH.

Western blot analysis of the inhibition of NF-kB signaling pathway through suppressing the phosphorylation of MTDH.

(F, G)The protein-ligand interaction complex was generated by HDock. (F)ChimeraX was used to visualize the AHR-MTDH complex and (G)binding sites were displayed.

In this study, we investigated the protective role of L. paracasei against gastric tumorigenesis. We confirmed the depletion of L. paracasei in tumor tissues with an in-house cohort, which was consistent with our published results based on16s rRNA gene sequencing[8], and led to uncovering a suppressive role of L. paracasei against GC.

By using FISH, qPCR and PCR, we confirmed the existence and enrichment of L. paracasei in normal tissues of GC patients and a strain (ZJUZ2-3) of L. paracasei was successfully isolated. We further showed that the tissue-borne L. paracasei significantly reduced tumor weight and size in nude mice. Moreover, GC cells viability was suppressed by this bacterium. Previous studies have revealed that some Lactobacillus spp., such as L. acidophilus and L. plantarum could inhibit H. pylori colonization and gastric inflammation[23] and that Lactobacillus-derived short chain fatty acids (SCFA) could act as a signal for modulating colonic epithelium[24]. However, this is the first study to characterize L. paracasei as a gastric tumor-suppressive probiotic in vivo and in vitro.

Probiotics produce different kinds of molecules including proteins and metabolites to confer health benefits[25][26]. Our results further indicated that the tumor-suppressing effect of L. paracasei ZJUZ2-3 is attributed to its non-protein metabolites. A key finding of this study is that the L. paracasei ZJUZ2-3-derived IAA inhibited gastric tumor formation. Lactobacillus expresses tryptophase, which converts tryptophan into indole derivatives, such as IAA, indole-3-acetaldehyde (I3A), indole-3-lactic acid (ILA), and indole-3-propionic acid (IPA)[27]. However, there has always been debate about the positive and negative association between indole metabolites and tumors. It has been reported that ILA improves colorectal tumors by regulating the epigenetic mechanism of anti-tumor infiltration of CD8 + T cells[28], while supplementing with I3P can restore the growth of liver cancer cells lacking Trp, indicating that I3P is an important tumor metabolite in MYC driven liver tumors[29]. Here, we illustrated the anti-tumourigenic function of IAA against the growth of GC cells and subcutaneous tumor formation in nude mice. Taken together, these data suggested that IAA produced by L. paracasei ZJUZ2-3 has a protective effect against GC.

The aryl hydrocarbon receptor (AHR) is a ligand activated transcription factor that can be activated by indole, indole derivatives, and Kynurenine (Kyn). Activated AHR participates various cellular processes. For example, it can promote the release of cytokines, including IL-6, IL-17, and IL-22, thereby regulating intestinal homeostasis [30]. As an indole derivative, IAA, exhibits the ability to activate AHR and suppress the NF-κB signaling pathway. We found that both L. paracasei ZJUZ2-3 and IAA upregulated the expression of AHR. Remarkably, both AHR antagonists CH223191 and siAHR blocked the antitumor effect, suggesting AHR is an essential molecular involving in this process. Previous studies have shown that the activation of AHR could inhibit the NF-κB signaling pathway, however, the interaction between AHR and NF-κB is still unclear. We identified that the oncoprotein MTDH could interact with AHR and NF-κB by COIP-MS. Consistently, MTDH promoting hepatocyte NF-kB activity has been reported in hepatocellular carcinoma (HCC)[20]. In our study, we discovered that the AHR activated by IAA could bind MTDH to reduce its phosphorylation, which subsequently inhibit the NF-κB signaling pathway. In contrast, the treatment of siAHR and CH223191 rescued the phosphorylation of MTDH and IKB, promoting NF-kB activity in GC cells. Finally, we also identified putative binding sites between AHR and MTDH using computer simulation methods. Taken together, AHR restricts GC cells NF-kB activation by interfering the interaction between MTDH and IKB.

This study still has limitations. While we have elucidated the interaction between L. paracasei and GC, its potential interplay with other types of cells in the tumor microenvironment should be considered in future studies. Whether L. paracasei can work in concert with other probiotic bacteria during GC progression also deserves further investigation. Clinial studies can be implemented to further assess the antitumor function of L. paracasei.

With a tissue-borne isolate, we showed that L. paracasei suppresses gastric tumorigenesis via its metabolite IAA. IAA activates AHR, which suppresses NF-κB signaling pathway by competitively binding to MTDH in tumor cells. Our results indicate the depletion of L. paracasei in tumor tissues promotes gastric tumorigenesis, implying that supplementation of the probiotic could be a potential treatment option.

Human subjects

Tumor tissues and matched normal tissues from 90 gastric cancer patients receiving radical gastrectomy for gastric cancer surgery during 2018–2020 were postoperatively collected at the First Affiliated Hospital of Zhejiang University School of Medicine.

Bacterial isolation

The pathological specimen was obtained from a fresh normal gastric tissue specimen of a female patient who underwent radical surgery for gastric cancer at the First Affiliated Hospital of Zhejiang University School of Medicine. The specimen was collected within 2 hours after resection, and placed in PBS (Servicebio, G0002) pre-chilled at 4 ℃. The specimen was transported in an ice box and processed within 4 hours.

The tissue was washed twice with sterilized PBS, mechanically disaggregated, resuspended and diluted with TBS (Biotech, A510025). The dilutions were spread on MRS or lactobacillus culture agar plates (Haibo Biotech, HB0384, HB0392), which were anaerobically incubated at 37 ℃ for 24–48 hours. Single colonies were picked and re-diluted for culture of purified singly colonies. The obtained isolate was stored with LB or MRS containing 20% glycerol at -80 ℃.

Bacterial culture condition

A new strain of Lactobacillus paracasei ZJUZ2-3 was isolated from normal gastric tissue of a GC patient. It was cultured anaerobically in Lactobacillus Broth Medium (LBM) (HB8637-2, Hopebiol) for 24 hours at 37℃. Overnight L. paracasei ZJUZ2-3 broth culture was centrifuged at 5000 g for 15 minutes and the supernatant was filtered through a 0.22µm filter to obtain the L. paracasei conditioned medium (Lp.CM). E. coli DH5ɑ, which was used as control, was obtained from American Type Culture Collection (ATCC), and incubated aerobically in Luria Bertani (LB) broth (HB0128, Hopebiol) at 37℃.

Whole Genome Sequencing (WGS)

The Whole Genome Sequencing (WGS) was completed by Sangon biotech (Shanghai, China). They used Illumina HiSeq and PacBio RS II sequencing system to analysis the isolated bacteria L.paracasei ZJUZ2-3 and obtain the whole genome.

Cell Culture

AGS (ATCC) and HGC27 (Cell Bank of the Shanghai Institute of Cell Biology, Chinese Academy of Sciences) were cultured in royal park memorial institute (RPMI) medium (Hyclone) supplemented with 10% fetal bovine serum (FBS, Gibco) and maintained at 37°C with 5% CO₂.

Cell Viability Assay

Cell viability was evaluated using the Cell Counting Kit-8 (K1018, APExBIO). For each well in the 96-well plate, 2000 cells were seeded and treated with the bacteria-conditioned medium or bacteria directly. GC cells were treated with the bacterial conditioned medium for 4 consecutive days at the concentration of 1% (vol/vol). After each well was added with 10 µL CCK8 solution, the absorbance at 450 nm was determined per day at 37°C after incubation for 2 h.

A colony formation assay was then performed. 500 cells were seeded in the 6-well plate, followed by changing the treatment medium every 2 days. After 10–14 days of culture, cells were fixed with 4% paraformaldehyde and stained with 0.2% crystal violet solution (22172503, Biosharp). Over 50 cells were counted in the colony. All experiments were conducted in triplicate three times.

Enzyme‑linked immunosorbent assay (ELISA)

The levels of IAA and AHR in the treated cells and its culture supernatant and tumor tissues of nude mice were measured with sandwich ELISA kits (ARD13763, AoRuiDa biology, China; YX-E11299, Yuanxin, China), according to the manufacturer’s instructions.

Quantitative Real-Time Polymerase Chain Reaction (qPCR) and gel electrophoresis

The quantitative real-time PCR (qPCR) was used to measure the relative abundance of L. paracasei in clinical tissues and nude mice. The primers used to detect L.paracasei, and total bacteria were as described previously[31]. The primer sequences were: Lp, forward 5’ - CAACCGTGATGACACTG − 3’, reverse 5’ - CCAACGTTAATCCGGTACTG − 3’. The relative abundance was determined with reference to the total bacterial DNA, which was identified by means of qPCR using primers[32]: 16s rRNA, forward 5’ - GGTGAATACGTTCCCGG-3’, reverse 5’ -TACGGCTACCTTGTTACGACTT-3’. Detection and amplification of DNA was carried out using StepOnePlus (ABI Corp) according to the reaction conditions: a total of 40 cycles of 95℃ for 30 seconds (denaturation), 95℃ for five seconds (annealing), and 60℃ for 30 seconds (extension). Each DNA sample was assayed in 3 copies to acquire the mean of the three cycle threshold (Ct) values, which were determined by the count of cycles demanded for a fluorescent signal to cross the threshold. If the three Ct values of a same DNA sample, which ranged over 2 (Ct_max – Ct_min) or were undetermined, the samples were excluded. The relative abundance of certain bacteria was calculated and normalized to the total bacteria in each sample using the 2ΔCt method (ΔCt = mean Ct value of target bacterium – mean Ct value of total bacteria).

PCR products were electrophoresed at 100V for 30 minutes, followed by gel imaging using Invitrogen iBright (BIO-RAD, Amecica).

SiRNA transfection

For siRNA knockdown experiments, polyplus transfection kit was used to transfect AGS, HGC27 with siRNAs targeting AHR according to the manufacturer’ s protocol.

DNA extraction

DNA was extracted from tissue samples. QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) was used to isolate total DNA according to the manufacturer’s instructions. The DNA concentration was measured using a Nanodrop 2000 instrument (Thermo Scientific, Waltham, MA). All DNA samples were stored at -80℃ prior to PCR amplification.

Immunoprecipitations mass spectrometry (IP-MS)

Proteins was extracted by RIPA lysis buffer containing phosphatase and protease inhibitor, which was then incubated at 4°C overnight with protein A/G-agarose beads (YJ003, EpiZyme) and antibody together. For IP of AHR, anti-AHR antibody (28727-1-AP, Proteintech) was used while rabbit IgG served as negative control. The beads were washed and boiled with 40 ml loading buffer. Boiled samples were subjected to SDS-PAGE and immunoblotted with anti-AHR antibody (67785-1-Ig, Proteintech) and anti-MTDH antibody (13860-1-AP, Proteintech). And proteins in-gel were digested for HPLC tandem mass spectrometry (LC/MS) by the First Affiliated Hospital of Zhejiang University, and finally visualized with Coomassie brilliant blue staining. The resulting MS/MS raw data were processed using Proteome Discoverer software v2.5, developed by Thermo Scientific. Tandem mass spectra were searched against SwissProt Human database using the SEQUEST algorithm.

RNA sequencing (RNA-seq) and analysis

Total RNA was extracted from the HGC27 cells of IAA treated and PBS control using Trizol reagent. RNA-seq was performed by oebiotech (Shanghai, China). Gene expression levels were calculated as Fragments per Kilobase of transcript per Million mapped reads (FPKM) using DESeq2.

Western blot analysis

Total protein was extracted using RIPA lysis buffer containing phosphatase and protease inhibitors. The proteins concentration was measured using the BCA assay (A55860, Thermo Scientific), and then separated with 10% SDS-PAGE gel and transferred to the PVDF membrane (Beyotime Institute of Biotechnology, Shanghai, China). The membrane was blocked with 5% BSA for 1 h and incubated overnight using rabbit antibodies to GAPDH (1:2000, 60004-1-Ig, Proteintech), NF-κB (1:1000, 10745-1-AP, Proteintech), IκB-ɑ (1:1000, ab32518, ABcam), pIKB-ɑ (1:1000, ab92700, ABcam), pMTDH (1:1000, PK7863, pyram), mouse antibodies to AHR (1:1000, 67785-1-Ig, Proteintech), MTDH (1:5000, 68592-1-Ig, Proteintech). Subsequently, HRP-conjugated secondary antibodies were treated, and the signal was measured using the Enhanced ECL Chemiluminescent Substrate Kit (36222ES76, Hangzhou, China). The intensity was analyzed by Image J

software.

In vivo xenograft model

Male nude mice (4–5 weeks, BALB/C) were obtained from Hangzhou Ziyuan Laboratory Animal Technology Company. All animal experiments was approved by the Institutional Animal Care and Use Committee at the First Aflliated Hospital of Zhejiang University. A total of 3×10⁶ HGC27 cells were subcutaneously injected into the right side of mice. After seven days of tumor injection, mice in the treatment group received 1×10⁷ CFU Lp resuspended in 100 µL of PBS, 100 µL 10 µM IAA, 50 µM CH223191 or CH223191 + IAA, respectively once in two or three days via intratumoral injection, while the control group received an equal amount of PBS. Mice were sacrificed 2–3 weeks after treatment. Tumor volume was determined every two days and tumor weight was measured at the end, to detect the effect of Lp on tumor growth.

Fluorescence in Situ Hybridization (FISH)

Texas Red-Lab158 probe (sequence: 5’-AGT TAA ACA GTT TCC AAA GCC TACC-3’) was used to detect L. paracase colonization in paraffin-embedded gastric sections of mice and GC patients. After deparaffinization and rehydration, specimens were treated with 0.2 N HCl and Proteinase K for 10 min for each step. Following incubation with blocking buffer on 55°C for 2 h, Lab158 probe (1:50 in 35% hybridization buffer, pre-heated at 88°C for 3 min before use) was added and hybridized in a dark, humid chamber at 42°C overnight. Specimens were washed in wash solution (20 mM Tris-HCl, pH = 7.2; 40 mM NaCl) and mounted with DAPI-antifade solution (P36931, Thermo Fisher Scientific). Images were acquired with a fluorescent microscope (Leica).

Hematoxylin–eosin straining

Paraffin-embedded tissue sections were first deparaffinized and rehydrated. The slides were then incubated with hematoxylin (15 min), an ammonia solution (0.08% in water for 10 sec), and eosin (30 sec) and washed with tap water between each step. After dehydration, the slides were mounted onto cover slips using mounting media. Metastasis areas and foci were then quantified with ImageJ software.

Immunohistochemistry (IHC)

Ki-67 (12202, Cell Signaling Technology) IHC was performed on paraffin-embedded sections (4 mm). The proliferation index was calculated by percentage positive cells. At least 3 random fields from corpus to antrum sites were counted for each mouse under 20X magnification.

Immunofluorescence (IF) staining

Anti-AHR (1:500, 67785-1-Ig, Proteintech), anti-MTDH(1:500, 13860-1-AP, Proteintech) IF staining were performed on GC cells in confocal dishes. Images were acquired with a fluorescent microscope (Leica).

Molecular docking analysis

3D structures of AHR and MTDH were downloaded from the PDB protein database[33], And the structure of the AHR-MTDH complex was modelled by HDOCK[34], and visualized with ChimeraX.

Statistical analysis

Data were expressed as by mean ± SEM. The difference between the two groups was compared using the t-test. The difference between multiple groups was compared by one-way ANOVA analysis to determine the difference in cell viability. Results of statistical significance were indicated as follows: *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001. All tests were conducted through Graph-Pad Prism 9.0 software (GraphPad Software, San Diego, CA).

aryl hydrocarbon receptor AHR

Lactobacillus paracasei L. paracasei/Lp

gastric cancer GC

Indole-3-acetic acid IAA

nuclear factor kB NF-kB

Helicobacter pylori H. pylori

short-chain fatty acids SCFAs

tryptophan Trp

fluorescence in situ hybridization FISH

whole genome sequencing WGS

culture medium CM

L.paracasei conditional medium Lp.CM

protease K PK

phosphatidylinositol 3-kinase PI3K

Gene set enrichment analysis GSEA

differential expressed genes DEGs

Co-immunoprecipitation Co-IP

liquid chromatography and high-throughput mass spectrometry LC-MS/MS

Metadherin MTDH

The Cancer Genome Atlas TCGA

tumor necrosis factor α TNF-α

indole-3-acetaldehyde I3A

indole-3-lactic acid ILA

indole-3-propionic acid IPA

Kynurenine Kyn

hepatocellular carcinoma HCC

Lactobacillus Broth Medium LBM

American Type Culture Collection ATCC

royal park memorial institute RPMI

fetal bovine serum FBS

Cell Counting Kit-8 CCK8

Enzyme‑linked immunosorbent assay ELISA

Quantitative Real-Time Polymerase Chain Reaction qPCR

Immunoprecipitations mass spectrometry IP-MS

RNA sequencing RNA-seq

Hematoxylin–eosin straining HE

Immunohistochemistry IHC

Immunofluorescence IF

Anti_AHR.xlsx

Ethics approval and Consent to participate

The research was approved by the Ethics Committee of the First Affiliated Hospital, School of Medicine, Zhejiang University (IIT20230798A). Informed written consent was obtained from each patient before enrollment.

Consent for publication: Not applicable.

Availability of data and materials: Not applicable.

Conflict of interests: The authors declare that they have no competing interests.

Author Contributions: writing—original draft preparation, R.Y.; writing—drafting the article, K.K.H. D.X.B. and Y.Y.; visualization and supervision, W.L and L.S.T. All authors have read and agreed to the published version of the manuscript.

Funding: Key R&D Program of Zhejiang (2024C03146); the National Natural Science Foundation.(No 82302886); Project of the Regional Diagnosis and Treatment Centre of the Health Planning Committee (No. JBZX-201903), Project of Zhejiang Traditional Chinese Medicine Science and Technology (No. 2020ZZ013)

Sung, H., et al., Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin, 2021. 71(3): p. 209–249.
Amieva, M. and R.M. Peek, Jr., Pathobiology of Helicobacter pylori-Induced Gastric Cancer. Gastroenterology, 2016. 150(1): p. 64–78.
Stewart, O.A., F. Wu, and Y. Chen, The role of gastric microbiota in gastric cancer. Gut Microbes, 2020. 11(5): p. 1220–1230.
Lertpiriyapong, K., et al., Gastric colonisation with a restricted commensal microbiota replicates the promotion of neoplastic lesions by diverse intestinal microbiota in the Helicobacter pylori INS-GAS mouse model of gastric carcinogenesis. Gut, 2014. 63(1): p. 54–63.
Maleki-Kakelar, H., et al., Lactobacillus plantarum induces apoptosis in gastric cancer cells via modulation of signaling pathways in Helicobacter pylori. Bioimpacts, 2020. 10(2): p. 65–72.
Kaźmierczak-Siedlecka, K., et al., Next-generation probiotics - do they open new therapeutic strategies for cancer patients? Gut Microbes, 2022. 14(1): p. 2035659.
Zmora, N., et al., Personalized Gut Mucosal Colonization Resistance to Empiric Probiotics Is Associated with Unique Host and Microbiome Features. Cell, 2018. 174(6): p. 1388–1405.e21.
Dai, D., et al., Interactions between gastric microbiota and metabolites in gastric cancer. Cell Death Dis, 2021. 12(12): p. 1104.
Kim, W.K., et al., Lactobacillus paracasei KBL382 administration attenuates atopic dermatitis by modulating immune response and gut microbiota. Gut Microbes, 2020. 12(1): p. 1–14.
Li, C.H., et al., Safety Evaluation and Anti-Inflammatory Efficacy of Lacticaseibacillus paracasei PS23. Int J Mol Sci, 2022. 24(1).
Yang, Q., et al., A Review of Gut Microbiota-Derived Metabolites in Tumor Progression and Cancer Therapy. Adv Sci (Weinh), 2023. 10(15): p. e2207366.
Jiang, Z.M., et al., Sinomenine ameliorates rheumatoid arthritis by modulating tryptophan metabolism and activating aryl hydrocarbon receptor via gut microbiota regulation. Sci Bull (Beijing), 2023. 68(14): p. 1540–1555.
Bergmeier, L.A., et al., Editorial: Immunology of the Oral Mucosa. Front Immunol, 2022. 13: p. 877209.
Li, Q., et al., Streptococcus thermophilus Inhibits Colorectal Tumorigenesis Through Secreting β-Galactosidase. Gastroenterology, 2021. 160(4): p. 1179–1193.e14.
Bender, M.J., et al., Dietary tryptophan metabolite released by intratumoral Lactobacillus reuteri facilitates immune checkpoint inhibitor treatment. Cell, 2023. 186(9): p. 1846–1862.e26.
Dong, F., et al., Intestinal microbiota-derived tryptophan metabolites are predictive of Ah receptor activity. Gut Microbes, 2020. 12(1): p. 1–24.
Sanmarco, L.M., et al., Identification of environmental factors that promote intestinal inflammation. Nature, 2022. 611(7937): p. 801–809.
Stockinger, B., K. Shah, and E. Wincent, AHR in the intestinal microenvironment: safeguarding barrier function. Nat Rev Gastroenterol Hepatol, 2021. 18(8): p. 559–570.
Wang, Q.Y., et al., 2,3',4,4',5-Pentachlorobiphenyl induces mitochondria-dependent apoptosis mediated by AhR/Cyp1a1 in mouse germ cells. J Hazard Mater, 2023. 445: p. 130547.
Zhang, W., et al., The zinc finger protein Miz1 suppresses liver tumorigenesis by restricting hepatocyte-driven macrophage activation and inflammation. Immunity, 2021. 54(6): p. 1168–1185.e8.
Emdad, L., et al., Activation of the nuclear factor kappaB pathway by astrocyte elevated gene-1: implications for tumor progression and metastasis. Cancer Res, 2006. 66(3): p. 1509–16.
Krishnan, R.K., et al., Quantitative analysis of the TNF-α-induced phosphoproteome reveals AEG-1/MTDH/LYRIC as an IKKβ substrate. Nat Commun, 2015. 6: p. 6658.
Shen, S., et al., Lactobacillus acidophilus NCFM and Lactiplantibacillus plantarum Lp-115 inhibit Helicobacter pylori colonization and gastric inflammation in a murine model. Front Cell Infect Microbiol, 2023. 13: p. 1196084.
Yan, Z., et al., Multi-omics analyses of airway host-microbe interactions in chronic obstructive pulmonary disease identify potential therapeutic interventions. Nat Microbiol, 2022. 7(9): p. 1361–1375.
Bender, M.J., et al., Dietary tryptophan metabolite released by intratumoral Lactobacillus reuteri facilitates immune checkpoint inhibitor treatment. Cell, 2023. 186(9): p. 1846–1862.e26.
Bird, L., Probiotics promote local antitumour immunity. Nat Rev Immunol, 2023. 23(6): p. 343.
Xue, C., et al., Tryptophan metabolism in health and disease. Cell Metab, 2023. 35(8): p. 1304–1326.
Zhang, Q., et al., Lactobacillus plantarum-derived indole-3-lactic acid ameliorates colorectal tumorigenesis via epigenetic regulation of CD8(+) T cell immunity. Cell Metab, 2023. 35(6): p. 943–960.e9.
Venkateswaran, N., et al., Tryptophan fuels MYC-dependent liver tumorigenesis through indole 3-pyruvate synthesis. Nat Commun, 2024. 15(1): p. 4266.
Stockinger, B., K. Shah, and E. Wincent, AHR in the intestinal microenvironment: safeguarding barrier function. Nat Rev Gastroenterol Hepatol, 2021. 18(8): p. 559–570.
Kim, E., et al., Novel real-time PCR assay for Lactobacillus casei group species using comparative genomics. Food Microbiol, 2020. 90: p. 103485.
Kuczynski, J., et al., Using QIIME to analyze 16S rRNA gene sequences from microbial communities. Curr Protoc Bioinformatics, 2011. Chapter 10: p. 10.7.1–10.7.20.
PDB database. Available from: https://www.rcsb.org/.
HDOCK SERVER. Available from: http://hdock.phys.hust.edu.cn.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Lactobacillus paracasei ZJUZ2-3 suppresses gastric tumorigenesis by inhibiting NF-κB pathway via metabolite 3-IAA

Status:

Version 1

Abstract

Figures

Introduction

Results

IAA inhibit GC development in vitro and in vivo

IAA mediates antitumor effects via activation of the aryl hydrocarbon receptor (AHR)

IAA inhibits the activation of NF-κB signaling pathway

IAA suppressed NF-κB signaling pathway through inhibiting IKB-mediated MTDH phosphorylation

Discussion

Conclusion

Materials and Methods

Human subjects

Bacterial isolation

Bacterial culture condition

Whole Genome Sequencing (WGS)

Cell Culture

Cell Viability Assay

Enzyme‑linked immunosorbent assay (ELISA)

Quantitative Real-Time Polymerase Chain Reaction (qPCR) and gel electrophoresis

SiRNA transfection

DNA extraction

Immunoprecipitations mass spectrometry (IP-MS)

RNA sequencing (RNA-seq) and analysis

Western blot analysis

In vivo xenograft model

Fluorescence in Situ Hybridization (FISH)

Hematoxylin–eosin straining

Immunohistochemistry (IHC)

Immunofluorescence (IF) staining

Molecular docking analysis

Statistical analysis

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1