Isolation of Bacillus zhangzhouensis OBB from local Polyphylla fullo (L.) larvae and PCR-based detection of cry1 gene

doi:10.21203/rs.3.rs-4887511/v1

Download PDF

Research Article

Isolation of Bacillus zhangzhouensis OBB from local Polyphylla fullo (L.) larvae and PCR-based detection of cry1 gene

https://doi.org/10.21203/rs.3.rs-4887511/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The most commonly used bacteria in biopesticide production is Bacillus thuringiensis due to cry proteins. Since continuous and repeated use of biopesticides may cause resistance development in pests, it is necessary to investigate isolates containing new cry genes. Bacillus zhangzhouensis OBB was isolated from Polyphylla fullo larvae. The presence of the cry gene was detected in this isolate. The conclusion that the strain carries the cry gene was made by PCR and SEM analysis. In addition, the central location of the Bacillus zhangzhouensis OBB spore structure, SDS-PAGE analysis and DNA sequence analysis showed phylogenetic differences between B. thuringiensis. B. zhangzhouensis showed bands between ̴ 250 kDa and ̴ 80 kDa. As a result, Bacillus zhangzhouensis OBB can be used as an alternative biopesticide in case of insect resistance to B. thuringiensis biopesticides. Indicating that this isolate has the potential to be effective against Coleoptera insect pests.

Bacillus zhangzhouensis OBB

cry genes

Polyphylla fullo

PCR

SDS-PAGE

The world population is expected to reach 8.5 billion in 2030, 9.7 billion in 2050, and exceed 11 billion by approximately 2100 (Wrachien et al., 2021). The demand for food for such a high population will also increase. Food production has been increasing impressively in different parts of the world in the last 40 years, especially due to the unsustainable use of chemical pesticides. Inappropriate and widespread pesticide use causes resistance among organisms and new pest problems (Ozdal et al., 2017). According to the Food and Agriculture Organization of the UN, pests destroy 40% of food crops worldwide, causing trade losses of 220 billion USD per year (Kumar, 2021). The family Scarabaeidae (Insecta: Coleoptera) consists of more than 30,000 insect species worldwide. One of the most important of this family is Polyphylla fullo (P. fullo) (L.). It is one of the most harmful to orchards, vineyards, ornamental plants, grass, potatoes, peppers, tomatoes and many other crops and causes significant losses in plant production and forestry (Anonymous, 2008). P. fullo adults start to emerge from the soil in April-May when the weather warms up. Adults fly to the trees after sunset and mate and lay their eggs in the soil in uncultivated and grassed gardens. The larvae that hatch from the eggs live in groups and gnaw the roots of the grass and shed their skins after 2 months and become second-stage larvae. Second-stage larvae feed voraciously. They go deep into the soil in autumn to spend the winter. A feeding that will cause significant damage begins in March-April and continues until the beginning of June. Then they shed another skin and become third-stage larvae. The third stage larvae last for one year and cause significant damage during this period. In July, they pupate in a soil nest 15–35 cm deep from the soil surface. The pupae that become adults in September do not leave the nest and stay there until spring the following year. The individual that hatches from the egg in this way becomes an adult after 3 years and produces offspring once every 3 years. Adults cause damage by feeding on leaves and flowers. They can leave fruit and forest trees, where they are densely located, defoliated (Anonymous, 2008; 2011a,b). They attack the root systems of many crops, including young fruit trees, grape vines, grass and ornamental plants. Young larvae feed on the roots of herbaceous plants; Older larvae gnaw at the roots of trees, causing the plants to dry out and die (Davidson and Lyon, 1979; Borror et al., 1981; Woodruff and Beck, 1989; Buss, 2006).

Cry proteins, also called Delta-endotoxins, are inactive protoxins. Delta endotoxins are usually encoded by “cry” genes located on plasmids. These crystal (cry) genes are effective against insects in the groups Lepidoptera, Diptera and Lepidoptera, Coleoptera, Diptera and Coleoptera and Lepidoptera. The first cry gene was cloned from Bt ssp. kurstaki HD-1 in 1981. The search for new cry genes has been ongoing worldwide since it was cloned (Schnepf and Whiteley 1981) and 560 cry genes have been characterized so far (Crickmore et al., 2011).Among the techniques used in profiling cry genes, PCR-based has advantages such as applicability, minimum laboratory facilities required and speed. PCR-based methods are recommended to identify cry genes. It was wondered whether this isolate has the potential to be effective against Coleoptera pests and a PCR-based analysis was performed to understand the cry gene profile of this strain.

Sample collection

The P. fullo larvae to be used in the study were collected from vineyards, gardens and fields in some cities in the Turkey where they are seen densely. The larvae collected from the field were kept in plastic containers with some soil on them. The larvae, which were kept in 11 L plastic containers as 6 pieces, are fed regularly with fruits. Collected larvae samples were obtained in September 2023.

Isolation of Bacillus zhangzhouensis OBB from P. fullo

P. fullo larvae brought to the laboratory and surface sterilization was performed with 70% ethyl alcohol in sterile petri dishes. Then, they were placed in petri dishes containing sterile pure water, washed 2–3 times, and the alcohol was removed, and the insects' intestines were used in isolation. The intestines were crushed with 10 ml of phosphate buffer (PB, 50 mM, pH 7.4). 1 liter of MYPGP (10 g Mueller Hinton, 10 g Yeast extract, 3 g K₂HP0₄, 2 g Glucose, 0.5 g trehalose) medium was prepared (Sharpe et al., 1970). Then, 500 µl of the crushed intestine sample was taken and inoculated into 30 ml of MYPGP medium. After overnight incubation (30^oC, 180 rpm), the bacterial culture was incubated in a water bath at 70^oC for 15 minutes. 100 µl of bacterial culture was inoculated into 30 ml of fresh MYPGP medium containing vancomycin (150 ug/ml). After 48 hours of incubation at 30^oC, the bacterial culture was diluted to 10^− 9 and then inoculated into 50 µl of MYPGP agar medium with appropriate diluents. After overnight incubation (30^oC), the colony formed was collected and inoculated onto fresh MYPGP_V agar medium (Kang et al., 2012). The purified colony was identified using morphological, biochemical and molecular methods (16S rRNA).

Gram Staining, Spore Staining and Crystal Protein Structure Staining of Bacillus zhangzhouensis OBB isolates

For Gram staining, bacterial samples were spread on a clean slide with pure water and detected in a burner flame. First, they were treated with crystal violet and washed with pure water. Then, they were treated with Lugol and washed again with pure water. They were washed again with alcohol and stained with safranin. Finally, they were washed with pure water, dried and examined under a light microscope. Bacteria with purple colored gram-positive bacillus morphology were observed (Claus, 1992).

For endospore staining, a small drop of water was left in the middle of a clean slide and a small amount of bacterial culture was spread with the help of a loop. The slide was detected by passing it through a flame. The preparation placed on a boiling water bath apparatus was treated with malachite green for 5 minutes. Then, after being washed with pure water, it was treated with safranin for 30 seconds (Temiz, 2000; Uçan and Erganiş, 2005). The presence of green stained spores was observed (Reynolds et al., 2009).

In order to determine whether the isolates contained parasporal crystal proteins, Coomassie Brilliant Blue solution, which is used for protein staining, was used in the identification of the isolates. After each isolate was incubated in petri dishes for a period of 5–10 days sufficient for the production of endospore and toxin protein, it was spread on the slide by placing 1 drop of water and dried as a thin film, then Coomassie Brilliant Blue solution was dropped on the slide, waited for 1 minute, washed with distilled water and dried, and then examined (Rampersad et al., 2002). Microscopically, the presence of endospore and endotoxin was examined with both light microscope (OLYMPUS-CX31) and Phase Contrast Microscope (OLYMPUS-CKX41). In addition, images were taken by conducting scanning electron microscope (SEM) examinations.

Molecular identification of bacterium

Genomic DNA isolation was performed using a DNA purification kit (Genomic DNA Miniprep Kit, BioBasic). 16S rRNA sequences of bacterial isolates whose genomic DNAs were isolated were amplified by PCR method using 5' ATGGTACCGTGTGTGACGGGCGGTGTGA-3' (forward) and 5'-ATTCTAGAGTTTGATCATGGCTCA 3' (reverse) primers (William et al., 1991). Taq 2X PCR master mix was used (Applied Biological Materials-G888). PCR, 25 µl Taq 2X PCR master mix, 1 µl 10 µM forward primer, 1 µl 10 µM reverse primer, 1 µl (5 ng/µl) DNA, 23 µl pure water were used to set up a total of 25 µl reaction. Samples were left to react in a thermocycler (Sensoquest). The reaction steps are given in Table 1. PCR products were visualized on a 1.2% agarose gel. The visible band on the gel was sent to MACROGEN (The Netherlands) for sequencing. 16S rRNA sequencing was performed using universal primers. Sequences were verified with BLAST in the NCBI GenBank database.

Table 1

PCR conditions used for amplification of the16S rRNA gene region
PCR Cycle	Temperature	Time	Number of cycles
Initial denaturation	95°C	30 s.	1
Denaturasyon	95°C	30 s.
Annealing	55°C	30 s.	35
Extension	72°C	1 dk.
Final extension	72°C	5 dk.	1

Bacillus zhangzhouensis OBB phylogeny

Sequence assembly was performed using Bioedit software (Hall et al., 2011 ). The sequence of the isolate was uploaded to the GenBank database. Sequence was deposited in GenBank under accession number PQ100677. The sequences were compared with the RefSeq database using the nBLAST search tool from NCBI GenBank. The sequence of the isolate and its closely related species were used for phylogenetic analysis. Phylogeny tree analyses were performed online with BLAST.

Determination of cry genes of Bacillus zhangzhouensis OBB isolates by PCR

The presence of cry genes was determined by PCR using the primers specified in Table 2. It was performed with the PCR conditions specified in Table 1.

Table 2

Primers used to screen for the presence of cry genes
Gene	Primer sequences (5' -> 3')	Tm (°C)
cry1 (277 bp)	CATGATTCATGCGGCAGATAAAC (f) TTGTGACACTTCTGCTTCCCATT (r)	59
cry2 (701 bp)	GTTATTCTTAATGCAGATGAATGGG (f) CGGATAAAATAATCTGGGAAATAGT (r)	55
cry3 (604bp)	CGTTATCGCAGAGAGATGACATTAAC (f) CATCTGTTGTTTCTGGAGGCAAT (r)	59
cry4 (439 bp)	GCATATGATGTAGCGAAACAAGCC (f) GCGTGACATACCCATTTCCAGGTCC (r)	59

SDS Polyacrylamide Gel Electrophoresis

The bacterial isolate is grown in TSB (Tryptic Soy Broth) for 10 days. When the sporulation is more than 90%, it is precipitated by centrifugation at 14000 rpm at + 4 oC. Since the proteins (cry) are large, they remain in the pellet after centrifugation. The pellet is washed several times with pure water and used directly for sds. Protein concentrations of the spore-crystal mixture were obtained according to the procedures outlined by Bradford (1976). Total proteins were screened by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (10% PAGE) (Mehtap, 2022). The determined amounts of proteins were taken at equal concentrations from the samples and the samples were kept in boiling water for 10 minutes after the treatment buffer (60 mM Tris-HCl (pH 6.8), 25% Glycerol, 2% SDS, 5% 2-mercaptoethanol, 0.1% bromophenol blue) was added. Then, it was loaded onto 10% SDS-PAGE as described by Laemmli (1970). The separation process was carried out by applying 130 V current to the gel. After the running process was completed, the gel was stained with Coomassie Brilliant Blue dye for 1 night and then washed with pure water. The gel image was transferred to the computer with a scanner.

Bacteria were isolated from dead P. fullo larvae. According to 16s rRNA and blast results, Bacillus zhangzhouensis bacteria were obtained. Bacillus zhangzhouensis Gram positive, rod shaped, aerobic, colonies are creamy white, round, translucent and have an elliptical endospore in the middle and are positive for catalase and oxidase. A phylogenetic tree was drawn in NCBI according to the blast results (Fig. 2).

The cell shape, Gram staining, endospore structure and motility characteristics of the isolates were examined. It was determined under the light microscope that the bacilli stained purple as a result of Gram staining were Gram positive. Endospore staining was performed for the diagnosis of spore presence. Green colored forms of the spores stained with malachite green were detected under the microscope. Parasporal crystal proteins of the isolates were stained with Coomassie Brilliant Blue and examined with phase contrast microscope (OLYMPUS-CKX41) (Fig. 3). The presence of crystal protein was also observed with electron microscopy (Fig. 4).

The spore-crystal mixture prepared from B. zhangzhouensis OBB strain was examined with light microscopy and electron microscopy to determine the presence of crystal proteins (Fig. 4). In the examinations performed with electron microscopy, it was determined that the crystals were bipyramidal, cubic and square in shape (Fig. 4). A subspecies can synthesize more than one crystal protein. Crystal proteins can have bipyramidal, cubic, flat rhomboid, spherical and composite types of shapes (Yu et al., 2015). Microscopic analysis revealed that cry proteins varied among the isolates. We observed both bipyramidal and other crystal types. These results are another evidence of the diversity of cry genes.

As a result of the investigation of toxin genes from B. zhangzhouensis OBB strain with PCR, it was determined that it contained cry1 gene. PCR was performed using the primer pairs specified in Table 2 as specified in Table 1. After the PCR product was run on a 1% agarose gel, it was observed that the cry1 gene in Bacillus zhangzhouensis OBB formed a band of 277 bp and the expected size (Fig. 5). Reyaz et al. (2017) reported that five Bt strains (SWK1, KS2-3, 2M-6, KS2-6 and QZ-19) from Kashmir valley were positive for lepidopteran active genes cry1, cry2Aa and cry2Ab, which were found to have insecticidal proteins. Shishir et al. (2014) used PCR primers to detect several cry gene families (cry1 to cry11) and observed that cry1 genes were the most abundant (30.8%). Salama et al. (2015) also used PCR primers for diversity studies and found that cry1 gene family genes were the most abundant (83.33%). Since the cry1 gene was the most common gene in this collection and the Cry1 protein has specific insecticidal activities against Lepidoptera (Liu, 2003; Song et al., 2003), we wonder whether different geographical and climatic environments create different ecology in insects and as a result lead to the presence of the Cry protein gene in the related B. zhangzhouensis.

B. zhangzhouensis showed bands between ̴ 250 kDa and ̴ 80 kDa (Fig. 6). We observed that the electrophoretic bands were extremely diverse by using SDS-PAGE to analyze the spore crystal suspension of the isolates. B. zhangzhouensis expressed multiple proteins. Spore crystal mixture collected from 80 Bt species isolated from Sichuan basin showed protein bands ranging from 40 to 130 kDa belonging to the major Cry protein family in SDS-PAGE analysis (Zhu et al., 2009).

Bacillus thuringiensis (Bt) has long been used in agriculture due to its insecticidal proteins, which make it a valuable, environmentally friendly biopesticide. The presence of δ-endotoxins, especially cry protein, is what gives the bacteria their insecticidal properties. There are also some plant and secreted insecticidal proteins that show toxic activity against certain species. The use of harmful pesticides and chemicals causes various health and environmental problems; therefore, Bt serves as the best alternative to overcome this problem. In our study, the presence of cry1 gene in B. zhangzhouensis OBB bacterium was demonstrated for the first time. If the expression and purification of cry proteins in this bacterium are carried out, this bacterium can be used to control P. fullo. Considering the effects of cry proteins in the literature and the harmful effect of the insect, these proteins have the potential to be developed as biopesticides and used against pests. In addition to laboratory application, both bacteria and proteins can be developed as biopesticide and used against P. fullo by supporting field application. It is very important to know the toxic potential of strains that give unusual PCR products, which will lead to the identification and characterization of putative new cry genes.

CRediT authorship contribution statement

Ozlem Bakir Boga: Funding acquisition, Investigation, original draft, Methodology, Writing. Esabi Basaran Kurbanoglu: Conceptualization,review & editing, Supervision, Project administration

Funding

This work was funded by the The Scientific and Technological Research Council of Türkiye (TUBITAK), 1002-A.

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

No data was used for the research described in the article.

Anonymous, 2008. T.C. Tarim ve Koyisleri Bakanligi Tarimsal Arastirmalar Genel Mudurlugu, Zirai Mucadele Teknik Talimatlari. Cilt 4, Ankara, 316–318.
Anonymous, 2011a. June beetles. Available online: http://www.bahcesel.net/forumsel/genel-zararlilar/12225-haz304ran-bocekler304-polyphylla-fullo/
Anonymous, 2011b. Technical Instructions for Integrated Pest Management in Vineyards. Availableonline: http://www.tarim.gov.tr/GKGM/Belgeler/Bitki%20Sa%C4%9Fl%C4%B1%C4%9F%C4%B1%20Hizmetleri/bitki
_sagligi/entegre_mucadele/006_ba%C4%9F%20entegre%20m%C3%BCcadele%20teknik%20talimat%C4%B1.pdf
Borror, D.J., De Long D.M., Triplehorn C.A., 1981. “An introduction to the study of insects”, Saunders college publishing, Fort Worth, TX, 838.
Bradford, M. M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding, Analytical Biochemistry, 72 (1-2), 248-254.
Buss, E.A., 2006. White grub biology and management. EDIS. Available online: http://edis.ifas.ufl.edu/LH037
Claus, D., 1992. A standardized Gram staining procedure. World J Microbiol Biotechnol., 8(4), 451–452
Crickmore, N., Zeigler, D., Feitelson, J., Schnepf, E., Van Rie, J., Lereclus, D., Baum, J., Dean, D., 1998. Revision of the nomenclature for the Bacillus thuringiensis pesticidal crystal proteins. Microbiol. Mol. Biol. Rev., 62(3), 807-813.
Davidson, R.H., Lyon, W.F., 1979. Insect Pests of Farm, Garden, and Orchard. John Wiley and Sons, New York.
Hall, T., Biosciences, I., Carlsbad, C., 2011. BioEdit: moleküler biyoloji için önemli bir yazılım. GERF Bull Biosci, 2(1), 60–61
Kang, T.H., Han, S.H., Weon, H.Y., Lee, Y.B., Kim, N., Nam, S.H., Park, H.C., 2012. Purification and identification of Paenibacillus sp., isolated from diseased larvae of Allomyrina dichotoma (Linnaeus, 1771) (Coleoptera: Scarabaeidae) in Insect Farms, International Journal of Industrial Entomology, 25(2), 195-203.
Kumar, J., Ramlal, A., Mallick, D., Mishra, V., 2021. An overview of some biopesticides and their importance in plant protection for commercial acceptance, Plants, 10(6), 1185.
Laemmli, U. K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. nature, 227(5259), 680-685.
Liu, R., 2003. Identification of cry1-type genes from Bacillus thuringiensis strains by PCR-RFLP. Master Dissertation. Wuhan Institute of Virology, Chinese Academy of Sciences.
Mehtap, U., 2022. Local isolate of Bacillus thuringiensis (Berliner, 1915) (Bacteria: Bacillaceae) from Cydalima perspectalis (Walker, 1859)(Lepidoptera: Crambidae: Spilomelinae) includes cry1, cry3 and cry4 genes and their insecticidal activities, Turkish Journal of Entomology, 46(2), 227-237.
Ozdal, M., Ozdal, O.G., Algur, O.F., Kurbanoglu, E.B., 2017. Biodegradation of α-endosulfan via hydrolysis pathway by Stenotrophomonas maltophilia OG2, 3 Biotech 7(2), 1-7.
Rampersad, J., Khan, A. and Ammons, D., 2002. Usefulness of Staining Parasporal Bodies When Screening for Bacillus thuringiensis, Journal of Invertebrate Pathology, 79, 203-204. http://dx.doi.org/10.1016/S0022-2011(02)00018-6.
Reyaz, A., Gunapriya, L., Arulselvi, P.I., 2017. Molecular characterization of indigenous Bacillus thuringiensis strains isolated from Kashmir valley. 3 Biotech, 7(2), 143.
Reynolds, J., Moyes, R., Breakwell, D.P., 2009. Differential staining of bacteria: Endospore stain. In Current Protocols in Microbiology (pp. A.3J.1-A.3J.5), John Wiley and Sons, Inc. https://doi.org/10.1002/9780471729259.mca03js15.
Salama, H.S, Abd El-Ghany, N.M, Saker, M.M., 2015. Diversity of Bacillus thuringiensis isolates from Egyptian soils as shown by molecular characterization. J Genet Eng Biotechnol, 13(2),101–109. doi: 10.1016/j.jgeb.2015.10.001
Schnepf, H.E., Whiteley, H.R., 1981. Cloning and expression of the Bacillus thuringiensis crystal protein gene in Escherichia coli. Proceedings of the National Academy of Sciences, 78(5), 2893-2897.
Sharpe, E.S., Julian, G.S., Crowell,C., 1970. Characteristics of a new strain of Bacillus popilliae sporogenic in vitro, Applied microbiology, 19(4), 681-688.
Shishir, A., Roy, A., Islam, N., Rahman, A., Khan, S.N., Hoq, M., 2014. Abundance and Diversity of Bacillus thuringiensis in Bangladesh and their cry Genes Profile. Front Env Sci, 2(20), 1–10. https://doi.org/10.3389/fenvs.2014.00020
Song F.P., Zhang J., Gu A., Wu Y., Han L.L., He K.L., Chen Z.Y., Yao J., Hu Y.Q., Li G.X., Huang D.F., 2003. Identification of cry1I-type genes from Bacillus thuringiensis strains and characterization of a novel cry1I-type gene. Appl. Environ. Microbiol., 69, 5207- 5211.
Temiz, A., 2000. Genel mikrobiyoloji uygulama teknikleri, 4. baskı. Hatipoğlu yayınevi, Ankara, 223-228.
UÇAN, U.S., Açik, L., Çelebi, A., ERGANİŞ, O., Arslan, E., 2005. Plasmids and protein patterns of Escherichia coli isolated from bovine mastitis in Konya, Turkey. Turkish Journal of Veterinary & Animal Sciences, 29(2), 475-480.
William, G.W., Susan, M.B., Dale A.P., David, J.L., 1991. 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology, 173 (2), 697-703.
Woodruff, R.E., Beck B.M., 1989. The scarab beetles of Florida: the May or June beetles (genus Phyllophaga), Arthropods Fla. Neighb. Areas,13,1–226.
Wrachien, D., Schultz, B., Goli, M.B., 2021. Impacts of population growth and climate change on food production and irrigation and drainage needs: A world‐ wide view, Irrigation and Drainage, 70, 981-995.
Yu, Z., Gong, L., Li, Q., Huang, G., He, L., Li, P., Zheng, A., 2015. Diversity of insecticidal crystal protein genes of Bacillus thuringiensis isolated from soil and cloning of novel haplotypes of cry genes. Annals of microbiology, 65, 2179-2186.
Zhu, J., Tan, F., Tang, J., Li, Y., Zheng, A., Li, P., 2009. Characterization of insecticidal crystal protein cry gene of Bacillus thuringiensis from soil of Sichuan Basin, China and cloning of novel haplotypes cry gene. Annals of Microbiology, 59(1), 1.

Download PDF

Editorial decision: Major revisions
14 Oct, 2024
Reviewers agreed at journal
14 Aug, 2024
Reviewers invited by journal
14 Aug, 2024
Editor assigned by journal
13 Aug, 2024
First submitted to journal
09 Aug, 2024

You are reading this latest preprint version

Isolation of Bacillus zhangzhouensis OBB from local Polyphylla fullo (L.) larvae and PCR-based detection of cry1 gene

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Sample collection

Molecular identification of bacterium

SDS Polyacrylamide Gel Electrophoresis

Result and Discussion

Conclusion

Declarations

References

Status:

Version 1