Cell line and reagents
The mouse hippocampal neuronal cell line HT-22 cells were kindly gifted from the Research Center for Neurobiology of Xuzhou Medical University (Xuzhou, China). NaHS and SAMe (97% purity) was purchased from Aladdin Reagent Co., Ltd (Shanghai, China) and MedChemExpress (Monmouth Junction, NJ, USA), respectively. Resveratrol and glucose were purchased from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against CBS and β-actin were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA) and ZSGB-BIO (Beijing, China), respectively. Antibodies against SIRT1, p-mTOR, mTOR, p-NF-κB p65 and NF-κB p65 were purchased from Cell Signaling Technology Inc. (Danvers, MA, USA). Unless specifically indicated, all other reagents were purchased commercially.
Synthesis of H2S probe NIR-NP
A dicyanoisophorone-based near-infrared fluorescent probe (NIR-NP) for detection of H2S was synthesized as described in the previous study [26] and its structure was verified by 1H NMR and HRMS. The spectroscopic properties of NIR-NP probe such as selectivity, sensitivity and stability were validated using a Hitachi F-4600 fluorescence spectrophotometer.
Cell culture and treatments
The culture of HT-22 cells was conducted in DMEM medium containing 10% (v/v) FBS and 1% (v/v) penicillin/streptomycin in an incubator (37 ℃, 5% CO2). HT-22 cells were grown in 96-well plate (5×103 cells/well) for 24 h and incubated with glucose, SAMe, NaHS, resveratrol and NIR-NP at a range of concentrations for another 24 h, respectively. Then the cells were incubated with MTT (0.1 mg/well) at 37 ℃ for 4 h. The Microplate reader (ELX808IU, Bio-tek Instruments Inc., USA) was used to detect the optical density at 550 nm.
According to previous reports [27-30] and the results of MTT assay (Supplementary Figure S1), we selected glucose, SAMe, NaHS and resveratrol at a concentration of 85 mM, 0.2 mM, 250 μM and 10 μM to treat HT-22 cells, respectively, and divided them into the following five groups: control group (25 mM glucose), high glucose (HG) group (85 mM glucose), HG + NaHS group (85 mM glucose + 250 μM NaHS), HG + SAMe group (85 mM glucose + 0.2 mM SAMe) and HG + resvertatrol (RES) group (85 mM glucose + 10 μM resveratrol).
Cell imaging
HT-22 cells were cultured on coverglass (Lab-TekH II Chambered Coverglass, Nale Nunc, Naperville, USA). After being treated with high glucose, SAMe, NaHS or resveratrol as above mentioned, HT-22 cells were incubated with 10 μM NIR-NP for 30 min and Na2S (50 μM and 100 μM) for following 20 min. The Olympus FV1000 confocal laser scanning microscope was used to obtain confocal fluorescence images. Images and data were analyzed using Olympus software (FV10-ASW).
The detection of H2S levels in HT-22 cells using NIR-NP
The levels of H2S in HT-22 cells were examined using NIR-NP according to the reported method [31]. Cells were treated with high glucose and/or other agents and then collected in PBS buffer. Cells were homogenized and centrifuged at 12,000 g at 4 ℃ for 15 min. The Pierce BCA Protein Assay Kit (Beyotime Institute of Biotechnology, Shanghai, China) was used to determine total protein concentrations of the collected supernatant. The H2S content in the treated cells was determined using supernatant spiked with Na2S solution at a series of concentrations as the internal criterion. To obtain zero point, ZnCl2 was added to scavenge the endogenous H2S within the sample. In Eppendorf tubes, 20 μL homogenates supernatant and 1 µL 1.0 mM NIR-NP probe were mixed with 69 μL PBS, which was spiked with 0, 0.4, 0.8,1.2, 1.6 µL of 100 µM Na2S solution and double distilled water (10, 9.6, 9.2, 8.8, 8.4 µL) correspondingly. After incubation at 37 ℃ for 20 min, the fluorescence intensity was detected using the Hitachi F4600 Fluorescence Spectrophotometer. Each sample was measured at least three times in parallel. According to the calibration curve of Na2S, the concentration of each sample was calculated and expressed as μmol/g protein.
Real-time quantitative polymerase chain reaction (RT-qPCR)
The TRIzol reagent (Invitrogen Co., Carlsbad, CA, USA) was used for the extraction of total RNA. The determination of total RNA concentration was performed on NanoDrop 1000 spectrophotometer (Thermo Scientific). ReverTra Ace qPCR RT kit (TOYOBO CO., LTD.) was used to synthesize cDNA. The forward and reverse primers sequences of IL-1β, TNF-α, IL-6 and β-actin (Sangon Biotech Co. Ltd., Shanghai, China) were presented in Table 1. 10 μL reaction solution including SYBR Green MIX, cDNA, forward primer, reverse primer and RNase-free water was centrifuged and subject to LightCycle 480 (Roche Applied Science). LightCycler 480 software was used to determine the relative mRNA levels.
Western BlottingA Pierce BCA Protein Assay Kit was used to determine the supernatant protein concentrations of HT-22 cell lysis buffer. After being electrophoresed in SDS-PAGE gels, the separated proteins were transferred to nitrocellulose membranes, which were blocked at 37 ℃ for 2 h in Tris-buffered saline with 5% BSA and 0.05% Tween 20 and incubated with the primary antibodies against CBS, SIRT1, mTOR, p-mTOR, NF-κB p65, p-NF-κB p65 and β-actin (all antibodies were diluted at 1:1000) at 4 ℃ overnight, respectively. Subsequently, the membranes were incubated with the secondary horseradish peroxidase-linked anti-rabbit (1:10000) or anti-mouse (1:10000) antibodies (ZSGB-BIO, Beijing, China) at 37 ℃ for 1 h. After the membranes were washed with TBST, chemiluminescent reagent was applied and the images were captured using Odyssey infrared fluorescence imaging system.ImmunofluorescenceHT-22 cells were cultured on glass coverslips in a 24-well plate (1.5×10
4 cells/well). After being rinsed with PBS, HT-22 cells were fixed in 4% paraformaldehyde for 15 min, and then penetrated with 0.5% Triton X-100 (PBS) for 5 min and blocked at room temperature in 1 mL of PBS solution containing 5% FBS for 1 h. After blocking, HT-22 cells were incubated at 4 ℃ with the primary antibodies against CBS, SIRT1, p-mTOR and p-NF-κB p65 (All antibodies were diluted at 1:200) overnight and then incubated at room temperature in the dark with 300 μL Alexa Fluor-labeled fluorescent anti-rabbit (1:200) or anti-mouse (1:200) antibodies for 1 h. 300 μL DAPI solution (1 mg/mL) were then applied for the following 5 min. The coverslips were placed on a slide with antifade mounting medium. Images were acquired using the OLYMPUS upright fluorescence microscope and analyzed with Image J.Statistical AnalysisAll results are analyzed by SPSS 16.0 (SPSS, Inc., Chicago, IL, USA). The intergroup differences were assessed by one-way ANOVA accompanied by LSD test or Dunnett’s T3 post hoc analysis. Data from all experiments were presented as mean ± SD (n = 3).
P < 0.05 represented a statistical significance.
Table 1
Primer sequences for the RT-qPCR analysis.
Gene
|
Forward primer (5’-3’)
|
Reverse primer (5’-3’)
|
IL-1β
|
GCAGAGCACAAGCCTGTCTTCC
|
ACCTGTCTTGGCCGAGGACTAAG
|
TNF-α
|
GCGACGTGGAACTGGCAGAAG
|
GCCACAAGCAGGAATGAGAAGAGG
|
IL-6
|
AGGAGTGGCTAAGG
ACCAAGACC
|
CTGACCACAGTGAGGAATGTCCAC
|
β-actin
|
CCCATCTATGAGGGTTACGC
|
TTTAATGTCACGCACGATTTC
|