N6-methyladenosine modification of circular RNA circASH2L suppresses growth and metastasis in hepatocellular carcinoma through regulating hsa-miR-525-3p/MTUS2 axis

doi:10.21203/rs.3.rs-4895856/v1

Download PDF

Research Article

N6-methyladenosine modification of circular RNA circASH2L suppresses growth and metastasis in hepatocellular carcinoma through regulating hsa-miR-525-3p/MTUS2 axis

https://doi.org/10.21203/rs.3.rs-4895856/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

CircRNAs have been demonstrated to play a crucial role in regulating the growth and progression of various cancers, including hepatocellular carcinoma (HCC). Nevertheless, the circRNA's expression pattern and function in HCC need more investigation.

Methods

Bioinformatics techniques were used to identify differentially expressed circRNAs in HCC. CircASH2L expression in HCC tissues was assessed through qRT-PCR and ISH analysis. To assess circASH2L's impact on HCC progression, a variety of experiments were carried out both in vitro and in vivo, such as CCK8, colony formation, EdU assay, flow cytometry, transwell assay, and xenograft mouse model. Various experimental techniques including qRT-PCR, dual luciferase reporter assay, FISH, RNA pull-down, and RIP experiments were utilized to evaluate the relationship between circASH2L, miR-525-3p, and MTUS2. Additionally, experiments were conducted to explore the impact of m⁶A modification on circASH2L expression, including RNA stability assay, m⁶A RNA immunoprecipitation assay (MeRIP), and Co-IP experiments.

Results

We found that circASH2L was downregulated in HCC tissues and the downregulation of circASH2L was significantly correlated with malignant characteristics as well as poor overall survival of patients with HCC. CircASH2L was found to inhibit cells growth, migration and invasion as well as tumorigenesis and metastasis in vivo. Mechanistically, we established that circASH2L directly interacted with miR-525-3p to enhance MTUS2 expression, subsequently leading to tumor suppression. Moreover, the influence of circASH2L on tumor suppression was attenuated by increasing miR-525-3p levels, and MTUS2 was recognized as an essential intermediary in circASH2L-induced tumor suppression. Additionally, N⁶⁻methyladenosine (m6A) modification was identified in circASH2L. Our data suggested that METTL3 was responsible for mediating m⁶A methylation of circASH2L, ultimately regulating circASH2L expression through the promotion of its degradation. These findings collectively highlight the role of circASH2L as a tumor suppressor through a unique circASH2L/miR-525-3p/MTUS2 axis, shedding light on the significance of m⁶A modification in regulating circASH2L function.

Conclusion

The work emphasizes circASH2L as a promising therapeutic target for treating HCC, offering new insights into the role of circRNAs in HCC development.

Circular RNA

CircASH2L

HCC

miR-525-3p

MTUS2

METTL3

HCC is a common type of cancer worldwide and is considered the third leading cause of cancer-related mortality[1, 2]. Common factors that greatly increase the risk of developing HCC are infections of hepatitis B virus (HBV) and HCV, heavy alcohol intake, eating food contaminated with aflatoxin, and metabolic issues[3]. Despite advancements in surgical procedures and treatments, the survival rate for HCC patients remains low due to frequent postsurgical recurrence, metastasis within and outside the liver, and resistance to anticancer medications[4]. The precise molecular mechanisms underlying HCC development and metastasis are not fully understood. Therefore, it is crucial to identify predictive biomarkers, investigate potential mechanisms behind HCC progression, and create specific treatment choices.

Circular RNAs (circRNAs) have emerged as a newly discovered class of endogenous non-coding RNAs, primarily generated through back-splicing events from various genomic regions[5, 6].They have been linked to the pathogenesis of many diseases, such as different forms of cancer[7, 8]. These circRNAs play crucial roles in biological and pathological processes by acting as miRNA sponges, regulators of transcription and translation, interactors with RBPs, and even potential protein encoders[9, 10]. Increasing evidence indicates that numerous circRNAs are deregulated in hepatocellular carcinoma (HCC) tissues, implying possible involvement in HCC development [11, 12]. The majority of these dysregulated circRNAs in HCC appear to primarily function by indirectly modulating the expression of target genes through their miRNA sponge activity[13]. For instance, certain circRNAs like hsa_circ_0008301 and CircMTO1 have been shown to promote or suppress HCC growth and metastasis by interacting with specific miRNAs[14, 15]. However, the field of circRNA research in HCC is still in its early stages, with only a limited number of functionally characterized HCC-related circRNAs identified so far. Therefore, deeper investigations into the roles and mechanisms of circRNAs in HCC could significantly expand our understanding of HCC pathogenesis and pave the way for the development of novel diagnostic biomarkers and therapeutic targets for this deadly disease.

In this study, we conducted a comparison of circRNA expression profiles in HCC tissues using microarrays obtained from GEO database. A newly discovered circRNA, circASH2L (circBase ID: hsa_circRNA_0006302), originating from the exons of the ASH2 like gene, was identified. Our analysis confirmed a decrease in circASH2L levels in HCC tissues, with its downregulation linked to aggressive clinicopathological features and unfavorable outcomes in HCC patients. Through in-depth analysis, we determined that circASH2L inhibits the growth and metastasis of hepatocellular carcinoma by modulating the hsa-miR-525-3p/MTUS2 pathway. Additionally, we uncovered that METTL3 facilitates m⁶A methylation of circASH2L, leading to its degradation and subsequent regulation of circASH2L expression. These findings hold promise for the development of potential diagnostic and therapeutic targets for HCC.

Identification of Differently Expressed CircRNAs (DECs) in HCC from GEO

Initially, we obtained two microarray expression profiles related to circRNAs from the GEO database (GSE97332 [16], which included seven HCC samples and their corresponding non-cancerous tissues; GSE78520 [17], which consisted of three liver tumor tissues and their corresponding adjacent normal tissues) and standardized all original expression values using log2-transformation. Following this, DECs (Differently Expressed CircRNAs) were detected with the Limma Bioconductor tool, which is frequently employed for comparing RNA-sequencing and microarray data [18],

with a cutoff of an absolute log2 (Fold-change) greater than 2 and FDR values less than 0.05. Finally, by intersecting two datasets, we were able to determine the DECs associated with HCC.

Patients and HCC tissue specimens

This study involved 162 patients recruited from two independent cohorts. Patients were diagnosed with hepatocellular carcinoma (HCC) both pathologically and clinically between 2011 and 2014. Cohort 1 included 40 frozen tumor tissues (T) and corresponding non-cancerous samples (N) obtained from HCC patients who had liver resection at our institution (Hepatic Surgery Center, Tongji Hospital) for primary tumors. The frozen specimens were quickly placed in liquid nitrogen and stored at -80°C until they were analyzed. The cohort 2 comprised 122 HCCs were collected from the same hospital. Tissues removed during surgery were promptly fixed with formalin and embedded in paraffin. Ethical approval for the study was granted by the Ethical Committee of Tongji Medical College of Huazhong University of Science and Technology, with all participants providing written consent for the use of their tissue samples. The research methods followed the guidelines set forth in the Declaration of Helsinki.

Plasmid construction and cell transfection

The plasmids including circASH2L overexpression construct (pLent-circASH2L), control vector, circASH2L miR-525-3p-binding site mutation construct (circASH2L-miR-mut), and METTL3 overexpression construct (plenti-METTL3) were acquired from Vigene Biosciences (Shandong, China). To silence circASH2L, three specific siRNAs which were designed targeting the back-splice junction site of circASH2L were customized from RiboBio (Guangzhou, China). By screening the most effective one (si-circASH2L-2) through qRT-PCR, it was utilized to establish shRNA plasmid vector (referred to as sh-circASH2L) from ObiO Biotech (Shanghai, China). CircASH2L and MTUS2-3’UTR sequences were engineered with mutant variations that removed miR-525-3p binding sites. These modified constructs were then inserted into a luciferase reporter known as psiCHECK2 for experimental purposes. These constructs were labeled as circASH2L-wt, circASH2L-mut, MTUS2-3’UTR-wt, and MTUS2-3’UTR-mut. DNA Sanger sequencing was conducted to confirm all sequences. RiboBio (Guangzhou, China) provided various siRNAs, miRNA mimics, inhibitors, and their respective controls. Transfections of cells were performed with Lipofectamine 3000 according to the suggested procedures. To monitor bioluminescence, HCC cells were transfected with a luciferase-expressing construct and screened with G418. The specific sequences of siRNAs and shRNAs utilized in the research are available in Supplementary Table S2-S3.

RNA pull-down assay

Biotin-labeled circASH2L probe (5’-Biotin- ATCAATAAATGGTATAATATCCTCGATCATGTAGGGCTAACAAA-3’) was custom synthesized by Sangon Biotech (Shanghai, China). Biotin-labeled-miR-525-3p probe (5’- Biotin - CGCTCTAAAGGGAAGCGCCTTC − 3’) was obtained from RiboBio (Guangzhou, China). For the biotin-coupled RNA pull-down experiment, we used the RNA Antisense Purification (RAP) Kit from BersinBio in Guangzhou, China, and followed the instructions provided. Initially, HCC cells were washed by cold PBS for twice, then lysed with co-IP buffer containing RNase inhibitor. Subsequently, the supernatant was further incubated with the biotinylated circRNA or miRNA probe overnight with rotation. Each binding reaction was supplemented with 50 µl of purified M-280 streptavidin magnetic beads (Invitrogen, USA) and allowed to incubate for an extra 2–4 hour at 37°C. Following three thorough washes with washing buffer, the complexes were eluted and recovered using the RNeasy Mini Kit (QIAGEN). Following the elution of RNA, qRT-PCR analysis was conducted, and the eluted proteins were subjected to western blot analysis after boiling the RNA-protein binding mixture in SDS buffer.

More detailed methods were described in Supplementary Materials and Methods.

CircASH2L is reduced in HCC, and lower CircASH2L levels are associated with a worse prognosis in HCC patients

Two GEO datasets (GSE97332 and GSE78520) were analyzed to pinpoint the circular RNAs that are consistently disturbed in hepatocellular carcinoma (HCC). The analysis revealed that multiple circular RNAs exhibited decreased expression in HCC in comparison to precancerous tissues. In the GSE78520 dataset, 6 circRNAs were decreased and 55 circRNAs were increased in HCC (Fig.S1A). A total of 51 circRNAs were down-regulated and 98 circRNAs were up-regulated in the GSE97332 cohort (Fig.S1B). Analysis revealed 5 down-regulated and 16 up-regulated circRNAs in both cohorts (Fig.S1C). In HCC tissues, the circRNA hsa_circRNA_0006302 (circASH2L) was discovered to have a notable decrease in comparison to normal tissues (Fig.S1C). This circRNA, derived from exons 6, 7, 8, 9, and 10 of the ASH2L gene, has a length of 580 nt [CircBase ID: hsa_circ_0006302, termed circASH2L] and is identified as hsa_circ_0006302 in CircBase (Fig. 1A). The head-to-tail splicing of circASH2L was confirmed through Sanger sequencing (Fig. 1B). The sequence aligns with circBase database annotation. Convergent and divergent primers were developed to amplify ASH2L mRNA and circASH2L to exclude the possibility of head-to-tail splicing being caused by transsplicing or genomic rearrangements. Both cDNA and gDNA from HCC hepG2 cells were utilized as templates. The findings showed that circ0006302 could be amplified only in cDNA using divergent primers, and not in gDNA (Fig. 1C). qPCR examination of RNA level after RNase R treatment showed that circASH2L was resistant to degradation, while ASH2L mRNA transcripts were degraded (Fig. 1D and E). Moreover, treating HCC cells with actinomycin D, a transcription inhibitor, showed that the circASH2L transcript had a more stable half-life compared to ASH2L mRNA (Fig. 1F). The results collectively verified the attributes of circASH2L as a circRNA.

We assessed the level of circASH2L of 40 matched HCC samples and peri-tumor tissues (cohort 1) using qRT-PCR. RNA-seq data indicated a notable reduction in circASH2L levels in HCC samples compared to their corresponding non-cancerous tissues (Fig. 1G). CircASH2L level in HCC patients was further studied by determining its expression using in situ hybridization (ISH) on tissue microarrays (TMAs) including 122 pairs of HCC tissues (cohort 2). CircASH2L was markedly reduced in HCC specimens compared to the similar non-cancerous tissues, as seen in Fig. 1H and Fig.S1D. We next examined the connections between circASH2L expression and the clinicopathological features in 122 HCC patients, as shown in Table 1. The chi-square test indicated a significant association between decreased circASH2L levels in HCC tissues and various aggressive clinicopathologic indicators like microvascular invasion, advanced TNM stage, and BCLC stage. The survival plot indicated that individuals with hepatocellular carcinoma (HCC) who had lower levels of circASH2L expression experienced poorer overall survival rates (OS P = 0.007) and disease-free survival rates (DFS P = 0.017), as illustrated in Fig. 1.I and J). Our research indicates that circASH2L is reduced in HCC tissues and lower circASH2L levels in HCC are associated with a worse prognosis for patients.

Table 1

Correlation of the clinicopathological variables with CircASH2L expression in HCC
Clinicopathological		CircASH2L expression
Clinicopathological	n	low	high	P Value
Gender*
Male	102	54	48	1.000
Femanle	20	11	9	1.000
Age*
≤ 50	59	35	24	0.209
> 50	63	30	33	0.209
ALT(ng/mL)*
≤ 75	113	62	51	0.294
> 75	9	3	6	0.294
AFP(ug/ul)*
≤ 20	32	11	21	0.013
> 20	90	54	36	0.013
Cirrhosis*
NO	34	18	16	0.963
YES	88	47	41	0.963
Tumor size*
≤ 5	49	24	25	0.436
> 5	73	41	32	0.436
Tumor encapsulation*
Complete	66	27	39	0.003
None	56	38	18	0.003
Tumor number*
Solitary	95	50	45	0.788
Multiple(≥ 2)	27	15	12	0.788
TNM clinical stage
Ⅰ-Ⅱ	91	43	48	0.022
Ⅲ-Ⅳ	31	22	9	0.022
Vascular invasion*
NO	97	48	49	0.098
YES	25	17	8	0.098
Differentiation*
Ⅰ-Ⅱ	42	35	7	0.001
Ⅲ-Ⅳ	80	30	50	0.001
BCLC stage*
A	80	37	43	0.032
B + C	42	28	14	0.032
Abbreviations: TNM, tumor node metastasis; BCLC: Barcelona Clinic Liver Cancer. Bold text represents P-values with significant difference.

CircASH2L hinders the growth, the migratory and invasive properties of HCC cells in vitro

Subsequently, the biological roles of circASH2L in HCC advancement were examined. We selected the HCC cell lines for silencing or overexpression of circASH2L based on the analysis of circASH2L expression using RT-qPCR in several human HCC cell lines. MHCC97H, HLF, and HCCLM3 cells showed reduced levels of endogenous circASH2L, while HepG2, Hep3B, Huh7, Sk-hep1, and PLC/PRF/5 cells displayed increased circASH2L expression (Fig.S2A). Thus, MHCC97H and HLF cells were chosen for upregulating circASH2L, whereas HepG2 and Huh7 cells were selected for downregulating circASH2L. Subsequently, we generated stable clones of MHCC97H and HLF cells with considerable overexpression of circASH2L (Fig. 2A). We successfully reduced circASH2L expression in HepG2 and Huh7 cells by employing small interfering RNAs (siRNAs) that target the back-splicing region, as shown in Fig. 2B. We used qPCR to demonstrate that our transfection did not impact additional ASH2L splicing variants. ASH2L mRNA expression remained unchanged after either overexpression or silencing of circASH2L, indicating the specificity of circASH2L manipulation (Fig.S2B, C).

A series of experiments were carried out to assess the influence of circASH2L on cellular proliferation. Elevated circASH2L levels were found to notably decrease the growth of MHCC97H and HLF cells, as demonstrated by CCK-8 assay and colony formation experiments (Fig. 2C and E, Fig.S2D and F), while decreasing circASH2L levels promoted cell growth (Fig. 2D and F, Fig.S2E and G). EdU experiments showed that overexpressing circASH2L significantly reduced the number of EdU-positive cells (Fig. 2G, I), whereas reducing circASH2L had the reverse effect (Fig. 2H, J). In HCC cells, the study of the cell cycle revealed that circASH2L expression impeded the transition from G1 to S phase (Fig. 2K). In contrast, reducing circASH2L levels promoted this progression. (Fig. 2L). Following this, the influence of circASH2L on the migratory and invasive properties of cancer cells was evaluated through transwell and wound healing tests. Upregulation of circASH2L significantly impeded the migratory and invasive properties of MHCC97H and HLF cells (Fig. 2M and O, Fig.S2H). Conversely, suppressing circASH2L notably enhanced these properties of HepG2 and Huh7 cells (Fig. 2N and P, Fig.S2I).

CircASH2L inhibits HCC growth and metastasis of HCC cells in vivo

We further conducted a study to examined the impact of circASH2L on tumor development and metastasis in living organisms. MHCC97H cells after transfection with circASH2L plasmid or a control vector, were implanted subcutaneously in BALB/c nude mice. Within 21 days of injection, the findings showed that overexpressing circASH2L led to a significant decrease in xenograft tumor sizes and weights (Fig. 3A-C). Silencing circASH2L increased tumor development of HepG2 cells (Fig.S3A). CircASH2L knockdown dramatically increased the tumor sizes and weights (Fig.S3B and C). IHC was conducted after collecting the subcutaneous tumor tissues. Ki-67 levels were considerably reduced in xenograft tumors overexpressing circASH2L (Fig. 3D) and raised in tumors where circASH2L was knocked down (Fig.S3D and E). Consistently, circASH2L-overexpressed MHCC97H cells and vector control cells were orthotopically transplanted into the livers of nude mice for the intrahepatic tumor implantation experiment. The tumors were reduced in size in the group overexpressing circASH2L compared to the group with vector control after growing in situ for 4 weeks in HCC MHCC97H xenografts (Fig. 3E-I).

We then examined whether circASH2L may impact metastasis in a live organism. Cells that overexpressed circASH2L and negative control cells were injected intravenously in the tail vein of nude mice to assess lung metastasis. In nude mice injected with circASH2L-overexpressed HLF cells, tumor volume, number of nodules, and lung metastasis incidence decreased significantly compared to mice injected with control cells (Fig. 3J and K). This was determined by analyzing bioluminescence intensity, number of lung nodules (Fig. 3M-O), and incidence of lung metastasis (Fig. 3L). Overall, our research suggests that circASH2L plays a role in inhibiting the growth and metastasis of HCC cells in vivo.

CircASH2L could act as a miR-525-3p sponge

FISH was performed on HCC cells to investigate circASH2L expression at the subcellular level. The superimposed images displayed a predominant cytoplasmic localization of circASH2L expression (Fig. 4A). Subsequent to cellular isolation, both nuclear and cytoplasmic RNA samples were subjected to analysis. The quantification of circRNA expression was conducted by qRT-PCR, revealing a cytoplasmic predominance of circASH2L expression (Fig. 4B). We investigated whether circASH2L, which is situated in the cytoplasm, may bind to miRNAs, considering the known role of circRNAs as miRNA sponges. We performed RNA immunoprecipitation (RIP) using an antibody targeting argonaute 2 (AGO2) in HepG2 and Huh7 cells. The findings indicated that circASH2L was notably concentrated by the AGO2 antibody (Fig. 4C, Fig.S4A), indicating that circASH2L could serve as a binding site for AGO2 and miRNAs. The Targetscan prediction engine on the CircInteractome website (https //circinteractome.nia.nih.gov/) was utilized to discover miRNAs that could potentially target circASH2L. We identified 27 candidate miRNAs that are predicted to bind to circASH2L.We conducted a circRNA pull-down test using biotin-labeled circASH2L probes to analyze 27 potential miRNAs in the complex for precise identification of interacting miRNAs (Fig. 4E). qRT-PCR analysis revealed a significant increase in miR-524-3p and miR-525-3p levels in the circASH2L probe group compared with the control (Fig. 4D and E), suggesting that these miRNAs are connected with circASH2L in HCC cells. To confirm this discovery, a luciferase assay was performed using HEK-293T cells co-transfected with circASH2L-wt reporter plasmid alongside miR-524-3p or miR-525-3p mimics. The results indicated that miR-525-3p imitations caused a notable reduction in luciferase activity in contrast to the control imitations NC, while miR-524-3p did not impact the luciferase activity (Fig. 4F). Consistent with the circRNA pull-down findings, miR-525-3p was identified as the highest enriched microRNA, suggesting its ability to bind circASH2L among the 27 microRNAs.

Next, we altered the specific locations targeted by miR-525-3p in the luciferase reporter. After transfection, a notable decrease in luciferase activity was observed in the wild-type (circASH2L-WT) HCC cell group following treatment with miR-525-3p mimics, whereas no impact was detected in circASH2L-mut group (Fig. 4G and H). This indicates a potential direct interaction between circASH2L and miR-525-3p. We conducted a pull-down test employing biotin-labeled miR-525-3p mimics and found a significant enrichment of circASH2L compared to the negative control (mimics NC) (Fig. 4I-K). Colocalization between circASH2L and miR-525-3p in HCC cells and xenograft tumor tissues was confirmed through a double FISH test (Fig. 4L and M). Nevertheless, circASH2L remained unchanged after the increase or decrease of miR-525-3p mimic expression in HCC MHHC97H and HepG2 cells, and likewise, miR-525-3p did not display notable variations after the enhancement or inhibition of circASH2L expression in HCC cells (Fig.S4B-E). This indicates that circASH2L and miR-525-3p may not degrade each other. Collectively, our studies indicate that circASH2L may act as a miR-525-3p sponge.

CircASH2L upregulates MTUS2 expression via sponging miR-525-3p

MiRNAs are widely recognized for their role in controlling the functions of target genes, ultimately influencing the behavior of cancer cells. We explored the downstream target of miR-525-3p to examine the pathogenic processes of circASH2L after discovering that miR-525-3p may be sponged by circASH2L. We used miRNA prediction techniques (miRDB, TargetScan, and miRwalk) to forecast the target mRNAs of miR-525-3p. It targeted nine candidates by overlapping with the results of miRNA target prediction, as illustrated in Fig. 5A. Following this, we elevated the levels of miR-525-3p mimics and examined the levels of their particular targets through qRT-PCR analysis (Fig.S5A, B). Genes suppressed by miR-525-3p include KCNQ5, MTUS2, AFAP1, TLX3, and RANBP10, among others. Following the overexpression or silencing of circASH2L, we subsequently monitored the levels of these targets. MTUS2 exhibited the most significant upregulation when circASH2L was overexpressed (Fig.S5C, D) and the most significant downregulation when circASH2L was shut down (Fig.S5E, F). Luciferase assays were employed to validate if miR-525-3p targeted MTUS2 mRNA. We created luciferase reporters with both wild type and mutant potential binding sites of MTUS2 transcripts (Fig. 5B). Luciferase reporter assays demonstrated a notable reduction in luciferase activity when miR-525-3p mimics were transfected, compared to the mimic NC, indicating the impact on the wild-type MTUS2 3′-UTR-wt (Fig. 5C). In contrast, the mutant luciferase reporter(MTUS2 3′-UTR -mut) was not affected (Fig. 5C). The results suggest a direct relationship between miR-525-3p and MTUS2 mRNA in HCC cells. An RNA-pulldown experiment was performed to confirm if circASH2L functions as a ceRNA in regulating MTUS2 expression by examining its influence on the binding of MTUS2 with miR-525-3p. The qRT-PCR findings indicated a significant decrease in the endogenous MTUS2 pull-down by the biotin-labeled miR-525-3p probe in cells transfected with circASH2L in comparison to those transfected with vector plasmids (Fig. 5D). This suggests that circASH2L may impede the interaction between MTUS2 and miR-525-3p. A luciferase assay demonstrated that altering the levels of circASH2L can lead to either an increase or decrease in luciferase activity of the MTUS2 wild type reporter (Fig. 5E). In addition, it was found that the introduction of circASH2L was able to recover the reporter activity of the normal MTUS2-3′-UTR -wt plasmid in HCC cells co-transfected with miR-525-3p mimics, but not in those with the mutated version (Fig. 5F). Western blot analysis indicated that increased miR-525-3p or decreased circASH2L led to a decrease in MTUS2 expression levels (Fig. 5G). Conversely, inhibiting miR-525-3p or increasing circASH2L expression led to a substantial rise in MTUS2 levels in HCC cells (Fig. 5H). The rise in MTUS2 caused by circASH2L overexpression was reversed by miR-525-3p mimics, as anticipated (Fig. 5I). These findings demonstrate that circASH2L functions as a decoy for miR-525-3p to control MTUS2 in HCC cells by relieving its suppression.

MiR-525-3p promotes HCC progression and reverses the tumor suppressor role of circASH2L in HCC cells

We conducted experiments to investigate the functional impact of miR-525-3p in order to gain a deeper understanding of its role. The CCK-8 experiments showed that upregulation of miR-525-3p led to enhanced proliferation of HCC cells, as seen in Fig. 6A-B. Transwell migration and matrigel invasion studies showed that miR-525-3p mimics significantly enhanced HCC cell migration and invasion (Fig. 6C-D). Furthermore, miR-525-3p were able to counteract the inhibitory effects of circASH2L on proliferation, migration, and invasion in MHCC97H cells (Fig. 6E-F). We altered the miR-525-3p-binding site on circASH2L and then transfected the modified circASH2L-miR-mut into MHCC97H cells to confirm that the cellular phenotype was induced by the interaction between circASH2L and miR-525-3p. Surprisingly, the results showed no significant distinction in the properties of cells to grow, move, and invade when transfected with circASH2L-miR-mut or control vector (Fig. 6G-H). These findings reinforce the idea that upregulation of miR-525-3p accelerates progression of HCC and hinders the tumor-inhibiting role of circASH2L in HCC cells.

CircASH2L suppresses HCC progression through the miR-525-3p-MTUS2 axis

Our hypothesis is that MTUS2 is involved in the tumor suppression process of the circASH2L-miR-525-3p axis, leading to the inhibition of malignant biological behaviors. Examination of the TCGA dataset showed a significant reduction in MTUS2 messenger RNA levels in HCC samples when compared to healthy tissues (Fig.S6A). Lower MTUS2 mRNA levels were linked to worse overall survival in liver cancer patients, as seen in the Kaplan-Meier plots (Fig.S6B). To delve deeper into the role of MTUS2, we investigated the functional impact of MTUS2 on HCC cells. Inhibition of MTUS2 was found to increase the ability of HepG2 and Huh7 cell lines to proliferate, migrate, and invade, as evidenced by Fig. 7A-D. The findings above identified MTUS2 as a tumor suppressor gene. We then designed rescue experiments. Overexpression of circASH2L in MHCC97H cells resulted in suppression of proliferation, migration, and invasion effects, which were reversed by knocking down MTUS2 (Fig. 7E-F). To confirm whether these findings could be replicated in a living organism, we introduced a xenograft hepatocellular carcinoma (HCC) model. The tumor suppression caused by circASH2L overexpression was successfully reversed by MTUS2 knockdown, as shown in Fig. 7G-I, consistent with the in vitro experiment findings. utilizing qRT-PCR method, we identified the presence of MTUS2 and circASH2L expression in the 40 HCC tissues. Pearson correlation analysis revealed a significant positive correlation between MTUS2 and circASH2L levels (Fig. 7J). The findings together show that circASH2L inhibits the development of HCC via the circASH2L / miR-525-3p / MTUS2 axis.

CircASH2L is modulated by m⁶A RNA methylation

The m⁶A alteration is crucial for posttranscriptional control and the formation of circRNAs[19]. We used RMBase 2.0 to identify probable m⁶A sites in circASH2L and identified 8 m⁶A sites using the algorithm (Fig.S7A). We used methylated RNA immunoprecipitation (MeRIP) tests to isolate known m⁶A-containing RNAs like RARA and circASH2L, which also showed significant m⁶A methylation (Fig. 8A), confirming the presence of m⁶A methylation in circASH2L. The abnormal expression of m⁶A writers (METTL3, METTL14, and WATP) is crucial for m⁶A modification and is linked to the aggressive development of HCC[20, 21]. We silenced m⁶A writers individually and found that only METTL3 knockdown, not METTL14 or WTAP knockdown, substantially influenced circASH2L expression, indicating METTL3 as the primary regulator of m⁶A modification in circASH2L regulation (Fig.S7B-D). METTL3 is the primary methyltransferase responsible for m⁶A alteration and contributes to the development of tumors[22]. RIP experiments confirmed the presence of circASH2L in complexes isolated with METTL3 antibody compared to those isolated with control IgG (Fig. 8B). To validate the interaction between METTL3 and circASH2L, we performed an RNA pull-down experiment as shown in Fig. 8C. M⁶A-specific immunoprecipitation assays (MeRIP) demonstrated a substantial drop in the m⁶A levels of circASH2L when METTL3 was silenced (Fig. 8D). Conversely, up-regulation of METTL3 of HCC cells resulted in a notable rise in circASH2L m⁶A levels (Fig. 8E). Thus, we indicated that METTL3 mediates the m⁶A modification of circASH2L in HCC. We then questioned if the m⁶A methyltransferase METTL3 may influence circASH2L function. When METTL3 was silenced, the half-life of circASH2L was extended compared to the control scramble (Fig. 8F), leading to a considerable increase in the expression of circASH2L (Fig. 8G). Enforcing the expression of METTL3 decreased the stability of circASH2L and lowered its expression levels in HCC cells (Fig. 8H and I). In 70 HCC patient samples, an immunohistochemistry (IHC) analysis showed a reverse relationship between circASH2L expression and METTL3 expression levels (8J and K). The findings showed that the METTL3-mediated m⁶A alteration may control circASH2L expression by aiding in its degradation.

Research indicates that circRNAs exhibit differential expression in HCC and have a significant impact on the development of HCC[23–25]. The fundamental process by which circRNAs contribute to the progression of HCC is not well understood. We identified circRNAs associated with HCC carcinogenesis by analyzing aberrantly expressed circRNAs of HCC and neighboring noncancerous tissues using two GEO circRNA microarray datasets. We discovered a new circular RNA called circASH2L that was noticeably reduced in HCC tissues. The reduction in circASH2L was strongly associated with the clinical stage and worse overall survival rates in HCC patients. Our findings suggest that circASH2L could impede the proliferation and metastasis of HCC cells, as evidenced by experiments conducted in both in vitro setups and in vivo models.

Circular RNAs plays a remarkable role in the initiation and advancement of hepatocellular carcinoma, with the potential to serve as important diagnostic and therapeutic biomarkers for cancer[26–28]. Research has indicated that hsa_circ_0001649 could be a valuable predictive biomarker for HCC, demonstrating high levels of specificity, accuracy, and sensitivity[29, 30]. Circular RNAs may also be found in other physiological fluids such as plasma, serum, urine, and cell-derived exosomes[31, 32]. Circular RNAs containing competitive miRNA binding sites, referred to as miRNA response elements (MREs), are categorized as ceRNAs[25, 33]. Circular RNAs are predominantly located in the cytoplasm and are recognized for their role as miRNA inhibitors, forming the circRNA-miRNA-mRNA pathway[34, 35]. An example is the demonstration that circRNA circRNA-5692 hindered the progression of liver cancer by functioning as a decoy for miR-328-5p, ultimately enhancing the synthesis of DAB2IP [36]. By functioning as a competing endogenous RNA (ceRNA), Hsa_circ_0000098 promoted the advancement of hepatocellular carcinoma (HCC) and decreased the responsiveness to doxorubicin, neutralizing the suppressive impact of miR-383 on the target gene MCUR1[37]. We verified that circASH2L was mostly found in the cytoplasm in our research. We discovered via bioinformatics study that circASH2L has the miR-525-3p binding site. The FISH experiment showed that circASH2L and miR-525-3p were co-located together in the cytoplasm of hepatocellular carcinoma (HCC) cells and tissues. Furthermore, circASH2L was confirmed to function as a miR-525-3p sponge through various assays including dual-luciferase reporter, RT-qPCR, RIP, and RNA pull-down (Fig. 4). MiR-525-3p is notably increased in hepatitis B virus-related HCC tissues according to report[38]. Another study showed that miR-525-3p promotes the motility and invasiveness of liver cancer cells[39]. Our own findings revealed that increasing miR-525-3p levels led to enhanced growth, motility, and invasion of liver tumor cells, and could reverse the suppressive impacts induced by circASH2L (Fig. 6A-F). Subsequent bioinformatics analysis was conducted to identify potential target genes of miR-525-3p, with the results showing that it directly targets MTUS2 via luciferase reporter assays. Interestingly, elevated miR-525-3p levels were associated with decreased MTUS2 expression. We also found that increasing the level of circASH2L led to higher levels of MTUS2 in both mRNA and protein, whereas reducing circASH2L had the opposite effect. Rescue experiments revealed that circASH2L effectively attenuates the inhibitory effects of miR-525-3p on MTUS2. Therefore, we have elucidated that circASH2L serves as a miRNA sponge for miR-525-3p to alleviate its repression of MTUS2.

MTUS2 is a new microtubule plus end tracking protein that plays a role in many cellular processes[40, 41]. Examination of the TCGA database unveiled a notable decline in MTUS2 mRNA levels in HCC tissues, and this reduced MTUS2 expression was linked to a worse prognosis of HCC patients. Nevertheless, the involvement of MTUS2 in HCC process remains unclear. Knockdown of MTUS2 was confirmed to enhance proliferation, and migratory and invasive properties of HCC cells (Fig. 7A-D). We next investigated the importance of MTUS2 in the suppressive impact mediated by circASH2L. Depletion of MTUS2 rescued the inhibitory effects on proliferation, and invasion induced by increased expression of circASH2L (Fig. 7E-H). Furthermore, Analysis showed a positive correlation between MTUS2 and circASH2L level. The findings indicates that circASH2L hinders the development of HCC via affecting the miR-525-3p-MTUS2 axis.

N⁶-methyladenosine is a common alteration seen in mRNAs and ncRNAs, such as circRNAs[19, 42], during transcription. Recent research indicates that m⁶A modification plays a crucial role in circRNA expression by impacting precursor cleavage, nuclear export, RNA translation, and RNA stability[19]. Methyltransferase-like 3 (METTL3) is a crucial catalytic subunit involved in the m⁶A modification process as part of the m⁶A 'writer' complex[43]. Several studies have shown that METTL3 may control RNA expression in a m⁶A-dependent way and play a role in tumor advancement[44, 45]. Jie et. found that METTL3-mediated m⁶A methylation regulated the activity and role of circPRKAR1B [46]. METTL3-induced m⁶A methylation alters Hsa_circ_0058493 to enhance HCC tumor formation[47]. In this study, the RNA pull-down and RIP assays revealed that METTL3 cooperated with circASH2L, and the MeRIP assay showed that METTL3 could regulate m⁶A-modification of circASH2L. Through various assays, it was demonstrated that METTL3 over-expression leads to a decrease in the stability and expression of circASH2L. Conversely, reducing METTL3 activity decreased the m⁶A modification level of circASH2L and increased the stability of circASH2L. Our work is the first to provide evidence that METTL3-mediated m⁶A alteration may control circASH2L expression by aiding in its degradation. The m⁶A modification process is controlled by many variables such as readers (YTHDF1/2/3 and YTHDC1/2), writers (METTL3/14 and WTAP), erasers (FTO and ALKBH5), and other regulatory elements like IGF2BP[19]. It is uncertain whether additional methylation-related proteins could manipulate circASH2L, which requires further research.

In summary, we have shown that circASH2L is markedly reduced in HCC for the first time. Low circASH2L levels are associated with an unfavorable prognosis in HCC patients. CircASH2L inhibits the progression of hepatocellular carcinoma by functioning as a miR-525-3p sponge and enhancing MTUS2 levels, showcasing its role as a tumor suppressor in hepatocellular carcinoma. We discovered that METTL3 is responsible for the m⁶A methylation of circASH2L and controls circASH2L expression by promoting its degradation. This work was the first to demonstrate that the m⁶A-modified circASH2L has a tumor-suppressive effect in HCC via influencing the miR-525-3p/MTUS2 pathway, suggesting it might be a potential valuable biomarker for diagnosing and treating HCC.

circRNA: circular RNA; HCC: hepatocellular carcinoma; qRT-PCR: quantitative real-time PCR; gDNA: genomic DNA; ISH: in situ hybridization; RIP: RNA immunoprecipitation; TNM: tumor node metastasis; BCLC: Barcelona Clinic Liver Cancer; OS: overall survival; DFS: disease-free survival; FISH: fluorescence in situ hybridization; MREs: miRNA response elements; ceRNA: competing endogenous RNA; miRNA: microRNA; GEO: Gene expression omnibus; siRNAs: small interfering RNAs; AGO2: Argonaute2; RAP: RNA Antisense Purification; ASH2L: ASH2 like, histone lysine methyltransferase complex subunit; TCGA: The Cancer Genome Atlas; MTUS2: microtubule associated scaffold protein 2; MeRIP: methylated RNA immunoprecipitation; METTL3: Methyltransferase-like 3; METTL14: methyltransferase-like 14; WTAP: Wilms tumor 1 associated protein.

Ethics approval and consent to participate

The procedure of human sample collection was approved by the Institutional Review Board of Tongji Medical College of Huazhong University of Science and Technology on 16 November 2021 (NO. TJ-IRB20211163) and all procedures were meet the criteria of the Declaration of Helsinki. Written informed consent for specimens was obtained from all patients. All of the animal experiments met the National Institutes of Health guidelines and were approved by the Committee on the Ethics of Animal Experiments of the Tongji Medical College, HUST on 20 September 2021 (approval NO. TJH-202109032, IACUC Number: 2750). All animal experiments were performed in accordance with the Declaration of Helsinki and “Guide for The Care and Use of Laboratory Animals” (NIH publication 86 − 23 revised 1985).

Competing interests

All authors declare that they have no conflict of interests.

Consent for publication

All authors had read and agreed to publish the paper.

Funding

This research was supported by The National Natural Science Foundation of China (82103608 to Jia Song, 82160472 to Dafeng Xu); Hainan Provincial Science and Technology Program (Hainan Clinical Research Center for Malignant Tumors of Digestive System): LCYX202208; Hainan Province Science and Technology Special Fund (Social Development Projects): ZDYF2022SHFZ131.

Authors’ contributions

Dafeng Xu, Yachong Liu, and Qiumeng Liu were responsible for experiments conduction, data analysis. Ganxun Li conducted bioinformatic analysis. Jia Song wrote and edited the manuscript. Lu Zhang, Chengpeng Yu, Huifang Liang, and Xiaoping Chen provided support. Jia Song, Jinfang Zheng designed, supervised and provided funding for the study. All authors read and approved the final paper.

Acknowledgements

We thank Lanping Ding from institute of Organ Transplantation, Tongji Hospital for mice care.

Availability of data and materials

All the data and study materials used in the current study is available from the corresponding authors on reasonable request.

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, Bray F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin. 2021;71:209–49.
Rumgay H, Arnold M, Ferlay J, Lesi O, Cabasag CJ, Vignat J, Laversanne M, McGlynn KA, Soerjomataram I. Global burden of primary liver cancer in 2020 and predictions to 2040. J Hepatol. 2022;77:1598–606.
Singh AK, Kumar R, Pandey AK. Hepatocellular Carcinoma: Causes, Mechanism of Progression and Biomarkers. Curr Chem Genom Transl Med. 2018;12:9–26.
Vogel A, Meyer T, Sapisochin G, Salem R, Saborowski A. Hepatocellular carcinoma. Lancet. 2022;400:1345–62.
Zhang Y, Zhang XO, Chen T, Xiang JF, Yin QF, Xing YH, Zhu S, Yang L, Chen LL. Circular intronic long noncoding RNAs. Mol Cell. 2013;51:792–806.
Chen LL, Yang L. Regulation of circRNA biogenesis. RNA Biol. 2015;12:381–8.
Liu J, Li D, Luo H, Zhu X. Circular RNAs: The star molecules in cancer. Mol Aspects Med. 2019;70:141–52.
Su M, Xiao Y, Ma J, Tang Y, Tian B, Zhang Y, Li X, Wu Z, Yang D, Zhou Y, et al. Circular RNAs in Cancer: emerging functions in hallmarks, stemness, resistance and roles as potential biomarkers. Mol Cancer. 2019;18:90.
Kristensen LS, Andersen MS, Stagsted LVW, Ebbesen KK, Hansen TB, Kjems J. The biogenesis, biology and characterization of circular RNAs. Nat Rev Genet. 2019;20:675–91.
Bach DH, Lee SK, Sood AK. Circular RNAs in Cancer. Mol Ther Nucleic Acids. 2019;16:118–29.
Wang M, Yu F, Li P. Circular RNAs: Characteristics, Function and Clinical Significance in Hepatocellular Carcinoma. Cancers (Basel) 2018, 10.
Pea A, Jamieson NB, Braconi C. Biology and Clinical Application of Regulatory RNAs in Hepatocellular Carcinoma. Hepatology. 2021;73(Suppl 1):38–48.
Yu J, Xu QG, Wang ZG, Yang Y, Zhang L, Ma JZ, Sun SH, Yang F, Zhou WP. Circular RNA cSMARCA5 inhibits growth and metastasis in hepatocellular carcinoma. J Hepatol. 2018;68:1214–27.
Liu Y, Song J, Zhang H, Liao Z, Liu F, Su C, Wang W, Han M, Zhang L, Zhu H, et al. EIF4A3-induced circTOLLIP promotes the progression of hepatocellular carcinoma via the miR-516a-5p/PBX3/EMT pathway. J Exp Clin Cancer Res. 2022;41:164.
Li D, Zhang J, Yang J, Wang J, Zhang R, Li J, Zhang R. CircMTO1 suppresses hepatocellular carcinoma progression via the miR-541-5p/ZIC1 axis by regulating Wnt/β-catenin signaling pathway and epithelial-to-mesenchymal transition. Cell Death Dis. 2021;13:12.
Han D, Li J, Wang H, Su X, Hou J, Gu Y, Qian C, Lin Y, Liu X, Huang M, et al. Circular RNA circMTO1 acts as the sponge of microRNA-9 to suppress hepatocellular carcinoma progression. Hepatology. 2017;66:1151–64.
Barrett T, Wilhite SE, Ledoux P, Evangelista C, Kim IF, Tomashevsky M, Marshall KA, Phillippy KH, Sherman PM, Holko M, et al. NCBI GEO: archive for functional genomics data sets–update. Nucleic Acids Res. 2013;41:D991–995.
Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W. Smyth GK: limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43:e47.
Zhang L, Hou C, Chen C, Guo Y, Yuan W, Yin D, Liu J, Sun Z. The role of N(6)-methyladenosine (m(6)A) modification in the regulation of circRNAs. Mol Cancer. 2020;19:105.
Qu N, Bo X, Li B, Ma L, Wang F, Zheng Q, Xiao X, Huang F, Shi Y, Zhang X. Role of N6-Methyladenosine (m(6)A) Methylation Regulators in Hepatocellular Carcinoma. Front Oncol. 2021;11:755206.
Chen J, Zhang Q, Liu T, Tang H. Roles of M(6)A Regulators in Hepatocellular Carcinoma: Promotion or Suppression. Curr Gene Ther. 2022;22:40–50.
Pan F, Lin XR, Hao LP, Chu XY, Wan HJ, Wang R. The Role of RNA Methyltransferase METTL3 in Hepatocellular Carcinoma: Results and Perspectives. Front Cell Dev Biol. 2021;9:674919.
Meng H, Niu R, Huang C, Li J. Circular RNA as a Novel Biomarker and Therapeutic Target for HCC. Cells 2022, 11.
Huang Z, Xia H, Liu S, Zhao X, He R, Wang Z, Shi W, Chen W, Kang P, Su Z, et al. The Mechanism and Clinical Significance of Circular RNAs in Hepatocellular Carcinoma. Front Oncol. 2021;11:714665.
Shen H, Liu B, Xu J, Zhang B, Wang Y, Shi L, Cai X. Circular RNAs: characteristics, biogenesis, mechanisms and functions in liver cancer. J Hematol Oncol. 2021;14:134.
Lei B, Tian Z, Fan W, Ni B. Circular RNA: a novel biomarker and therapeutic target for human cancers. Int J Med Sci. 2019;16:292–301.
Chaichian S, Shafabakhsh R, Mirhashemi SM, Moazzami B, Asemi Z. Circular RNAs: A novel biomarker for cervical cancer. J Cell Physiol. 2020;235:718–24.
Zhang HD, Jiang LH, Sun DW, Hou JC, Ji ZL. CircRNA: a novel type of biomarker for cancer. Breast Cancer. 2018;25:1–7.
Qin M, Liu G, Huo X, Tao X, Sun X, Ge Z, Yang J, Fan J, Liu L, Qin W. Hsa_circ_0001649: A circular RNA and potential novel biomarker for hepatocellular carcinoma. Cancer Biomark. 2016;16:161–9.
Zhang X, Qiu S, Luo P, Zhou H, Jing W, Liang C, Tu J. Down-regulation of hsa_circ_0001649 in hepatocellular carcinoma predicts a poor prognosis. Cancer Biomark. 2018;22:135–42.
Li Y, Zheng Q, Bao C, Li S, Guo W, Zhao J, Chen D, Gu J, He X, Huang S. Circular RNA is enriched and stable in exosomes: a promising biomarker for cancer diagnosis. Cell Res. 2015;25:981–4.
Wang S, Zhang K, Tan S, Xin J, Yuan Q, Xu H, Xu X, Liang Q, Christiani DC, Wang M, et al. Circular RNAs in body fluids as cancer biomarkers: the new frontier of liquid biopsies. Mol Cancer. 2021;20:13.
Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 2011, 146:353–8.
Hansen TB, Jensen TI, Clausen BH, Bramsen JB, Finsen B, Damgaard CK, Kjems J. Natural RNA circles function as efficient microRNA sponges. Nature. 2013;495:384–8.
Memczak S, Jens M, Elefsinioti A, Torti F, Krueger J, Rybak A, Maier L, Mackowiak SD, Gregersen LH, Munschauer M, et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013;495:333–8.
Liu Z, Yu Y, Huang Z, Kong Y, Hu X, Xiao W, Quan J, Fan X. CircRNA-5692 inhibits the progression of hepatocellular carcinoma by sponging miR-328-5p to enhance DAB2IP expression. Cell Death Dis. 2019;10:900.
Li Y, Wu A, Chen L, Cai A, Hu Y, Zhou Z, Qi Q, Wu Y, Xia D, Dong P, et al. Hsa_circ_0000098 is a novel therapeutic target that promotes hepatocellular carcinoma development and resistance to doxorubicin. J Exp Clin Cancer Res. 2022;41:267.
Wang W, Zhao LJ, Tan YX, Ren H, Qi ZT. Identification of deregulated miRNAs and their targets in hepatitis B virus-associated hepatocellular carcinoma. World J Gastroenterol. 2012;18:5442–53.
Pang F, Zha R, Zhao Y, Wang Q, Chen D, Zhang Z, Chen T, Yao M, Gu J, He X. MiR-525-3p enhances the migration and invasion of liver cancer cells by downregulating ZNF395. PLoS ONE. 2014;9:e90867.
Ward T, Wang M, Liu X, Wang Z, Xia P, Chu Y, Wang X, Liu L, Jiang K, Yu H, et al. Regulation of a dynamic interaction between two microtubule-binding proteins, EB1 and TIP150, by the mitotic p300/CBP-associated factor (PCAF) orchestrates kinetochore microtubule plasticity and chromosome stability during mitosis. J Biol Chem. 2013;288:15771–85.
Jiang K, Wang J, Liu J, Ward T, Wordeman L, Davidson A, Wang F, Yao X. TIP150 interacts with and targets MCAK at the microtubule plus ends. EMBO Rep. 2009;10:857–65.
Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature. 2014;505:117–20.
Zaccara S, Ries RJ, Jaffrey SR. Reading, writing and erasing mRNA methylation. Nat Rev Mol Cell Biol. 2019;20:608–24.
Qi YN, Liu Z, Hong LL, Li P, Ling ZQ. Methyltransferase-like proteins in cancer biology and potential therapeutic targeting. J Hematol Oncol. 2023;16:89.
Xu P, Ge R. Roles and drug development of METTL3 (methyltransferase-like 3) in anti-tumor therapy. Eur J Med Chem. 2022;230:114118.
Zhao J, Zhao Z, Ying P, Zhou Y, Xu Z, Wang H, Tang L. METTL3-mediated m(6) A modification of circPRKAR1B promotes Crohn's colitis by inducing pyroptosis via autophagy inhibition. Clin Transl Med. 2023;13:e1405.
Wu A, Hu Y, Xu Y, Xu J, Wang X, Cai A, Liu R, Chen L, Wang F. Methyltransferase-Like 3-Mediated m6A Methylation of Hsa_circ_0058493 Accelerates Hepatocellular Carcinoma Progression by Binding to YTH Domain-Containing Protein 1. Front Cell Dev Biol. 2021;9:762588.

FigS1.pdf
Figure S1. CircASH2L is reduced in HCC, and lower CircASH2L levels are associated with a worse prognosis in HCC patients. (A and B) Volcano plots were generated to examine the Differentially Expressed Genes (DEGs) in Hepatocellular Carcinoma (HCC) by utilizing two microarray datasets obtained from GEO- GSE78520 and GSE97332. The volcano plot was created using the R package 'ggplot2'. Highly upregulated and downregulated circRNAs are shown by red and blue colors, respectively. (C) Construct a Venn diagram representing these two datasets. Only circRNAs having a statistical significance of P<0.01 and a fold change of at least 2 were selected. (D) Representative pictures of circASH2L expression in HCC tissues from cohort 2 were identified using in situ hybridization (ISH) tests.
FigS2.pdf
Figure S2. CircASH2L hinders the growth, movement, and penetration of HCC cells in vitro. (A) CircASH2L levels in several HCC cell lines were assessed using qRT-PCR analysis. (B and C) The qRT-PCR experiments indicated that the mRNA level of ASH2L remained unchanged after overexpression (B) or silencing (C) of circASH2L. (D and E) CCK-8 experiments were conducted to assess the growth of HCC cells following circASH2L upregulation (D) or downregulation (E). (F and G) Representative pictures of Colony formation assays following circASH2L overexpression (F) or knockdown (G). (H and I) Transwell assays were used to assess migratory and invasive properties in HLF and Huh7 cells after transfection with designated vectors.
FigS3.pdf
Figure S3. CircASH2L inhibits HCC growth and metastasis of HCC cells in vivo. (A) Six nude mice were used to derive subcutaneous xenograft tumors from HepG2 cells transfected with designated vectors, and photos were taken of the tumors. (B and C) The size and and weight f subcutaneous xenograft tumors originating from HepG2 cells in nude mice. (D) Representative photos showing immunohistochemical staining of Ki67. Scale bar: 50 micrometers. (E) Quantitative assessment of Ki67 staining in subcutaneous xenograft tumors.
FigS4.pdf
Figure S4. CircASH2L could act as a miR-525-3p sponge.(A) RIP experiments were performed with an antibody that targets AGO2 on extracts obtained from HCC Huh7 cells. Following this, qRT-PCR was applied to search the presence of circASH2L and circANRIL. (B and C) qRT-PCR was applied to measure the expression of circASH2L in MHHC97H and HepG2 cells following transfection with either miR-525-3p (B) or miR-525-3p inhibitor (C). (D and E) miR-525-3p expression was measured via qRT-PCR in HCC cells after upregulation (D) or downregulation (E) of circASH2L.
FigS5.pdf
Figure S5. CircASH2L upregulates MTUS2 expression via sponging miR-525-3p. (A and B) After transfecting HepG2 and MHHC97H cells with a miR-525-3p, a qRT-PCR experiments were conducted on the target genes of miR-525-3p. (C and D) qRT-PCR experiments were applied on the potential target genes of miR-525-3p in HLF and MHHC97H cells with circASH2L overexpression. (E and F) Quantitative PCR was employed to examine the potential target genes of miR-525-3p in HepG2 and Huh7 cells with circASH2L depletion.
FigS6.pdf
Figure S6. CircASH2L suppresses HCC progression through the miR-525-3p-MTUS2 axis. (A) The Cancer Genome Atlas (TCGA) database was applied to examine the levels of MTUS2 mRNA in both healthy liver tissue and hepatocellular carcinoma. (B) Kaplan-Meier analysis was utilized to assess the correlation between MTUS2 mRNA level and survival rates in a cohort of 370 individuals diagnosed with HCC. Information was collected and analyzed from the TCGA database.
FigS7.pdf
Figure S7. CircASH2L is modulated by m6A RNA methylation. (A) The candidate m⁶A modification sites in circASH2L predicted by RMBase 2.0. (B-D) qRT-PCR was utilized to examine the circASH2L expression in HepG2 cells following transfection with siRNA directed against METTL3, METTL14, or WTAP.
SupplementaryTableS1S3.docx
SupplementaryMethods.docx

Download PDF

Reviewers agreed at journal
16 Aug, 2024
Reviewers invited by journal
16 Aug, 2024
Editor assigned by journal
16 Aug, 2024
First submitted to journal
11 Aug, 2024

You are reading this latest preprint version

N6-methyladenosine modification of circular RNA circASH2L suppresses growth and metastasis in hepatocellular carcinoma through regulating hsa-miR-525-3p/MTUS2 axis

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Background

Methods

Identification of Differently Expressed CircRNAs (DECs) in HCC from GEO

Patients and HCC tissue specimens

Plasmid construction and cell transfection

RNA pull-down assay

Results

CircASH2L could act as a miR-525-3p sponge

CircASH2L upregulates MTUS2 expression via sponging miR-525-3p

MiR-525-3p promotes HCC progression and reverses the tumor suppressor role of circASH2L in HCC cells

CircASH2L suppresses HCC progression through the miR-525-3p-MTUS2 axis

CircASH2L is modulated by m⁶A RNA methylation

Discussion

Conclusions

Abbreviations

Declarations

Ethics approval and consent to participate

Funding

Authors’ contributions

Acknowledgements

Availability of data and materials

References

Supplementary Files

Status:

Version 1

N6-methyladenosine modification of circular RNA circASH2L suppresses growth and metastasis in hepatocellular carcinoma through regulating hsa-miR-525-3p/MTUS2 axis

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Background

Methods

Identification of Differently Expressed CircRNAs (DECs) in HCC from GEO

Patients and HCC tissue specimens

Plasmid construction and cell transfection

RNA pull-down assay

Results

CircASH2L could act as a miR-525-3p sponge

CircASH2L upregulates MTUS2 expression via sponging miR-525-3p

MiR-525-3p promotes HCC progression and reverses the tumor suppressor role of circASH2L in HCC cells

CircASH2L suppresses HCC progression through the miR-525-3p-MTUS2 axis

CircASH2L is modulated by m6A RNA methylation

Discussion

Conclusions

Abbreviations

Declarations

Ethics approval and consent to participate

Funding

Authors’ contributions

Acknowledgements

Availability of data and materials

References

Supplementary Files

Status:

Version 1

CircASH2L is modulated by m⁶A RNA methylation