HNRNPAB is involved in the development of gastric cancer by regulating EMT through the AkT-GSK3β-Wnt signaling pathway

doi:10.21203/rs.3.rs-4897511/v1

Download PDF

Research Article

HNRNPAB is involved in the development of gastric cancer by regulating EMT through the AkT-GSK3β-Wnt signaling pathway

https://doi.org/10.21203/rs.3.rs-4897511/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Background

Gastric cancer (GC) is a leading cause of cancer-related death, and metastasis significantly contributes to poor prognosis. Splicing factors are known to influence cancer progression, including metastasis. This study aimed to investigate the role of heterogeneous nuclear ribonucleoprotein A/B (hnRNPAB) in GC cell invasion and migration.

Methods

An investigation into the role of hnRNPAB in GC was conducted. This study analyzed hnRNPAB expression in human gastric cancer tissues. Functional studies were then performed using gastric cancer cell lines with overexpression or knockdown of hnRNPAB to assess its effects on cell proliferation, migration, and invasion. Mechanistic studies were conducted to determine the signaling pathways involved in hnRNPAB-mediated effects.

Results

Overexpression of hnRNPAB in gastric cancer cell lines promoted cell proliferation, migration, and invasion. Conversely, hnRNPAB knockdown had the opposite effect. Mechanistically, hnRNPAB induced a switch in the expression of cell adhesion markers, increasing the expression of mesenchymal markers (N-cadherin, vimentin, and Snail1) while decreasing the expression of the epithelial marker E-cadherin, indicating its role in epithelial‒mesenchymal transition (EMT). Further investigation revealed that hnRNPAB activates the Akt-GSK3β-Wnt signaling pathway by promoting Akt phosphorylation and inactivating GSK3β.

Conclusions

These findings demonstrate that hnRNPAB promotes EMT and GC development by activating the Akt-GSK3β-Wnt signaling pathway. These findings suggest that hnRNPAB could be a potential target for developing novel diagnostic and therapeutic strategies for GC. Further studies are warranted to explore its therapeutic potential fully.

Gastric cancer

hnRNPAB

metastasis

EMT

Akt-GSK3β-Wnt signaling pathway

therapeutic target

Gastric cancer (GC) represents a significant global health burden, ranking as the fifth most commonly diagnosed malignancy and the third leading cause of cancer-related mortality worldwide. While early-stage gastric cancer can be effectively treated with surgical intervention, advanced GC, which is often characterized by metastatic spread, has a dismal prognosis. The median survival time for patients with metastatic GC is less than one year. ^[1–3]. Metastasis is the leading cause of cancer death ^{[4, 5]}. Therefore, the exploration of new targets and potential mechanisms for GC transfer is urgently needed.

RNA-binding proteins (RBPs), such as heterogeneous nuclear ribonucleoproteins (hnRNPs) and serine-arginine-rich (SR) proteins, play crucial roles in regulating splicing ^[6]. These RNA-binding proteins play crucial roles in whole RNA biogenesis. Among these, heterogeneous nuclear ribonucleoproteins (hnRNPs) have been implicated in various aspects of cancer development, including cell proliferation, migration, and tumorigenesis ^[7–9]. Previous studies have shown that specific heterogeneous nuclear ribonucleoproteins, hnRNPs, such as hnRNP-F and hnRNP Q1, are involved in regulating crucial processes such as epithelial‒mesenchymal transition (EMT), cell proliferation, and tumorigenesis in other cancers ^[10][11]. Moreover, the splicing factor serine/arginine-rich splicing factor 1 (SRSF1) is involved in the progression and metastasis of breast ^[12] and lung cancer ^[13]. These findings highlight the potential of targeting splicing factors as a novel therapeutic approach for cancer treatment.

HNRNPAB (heterogeneous nuclear ribonucleoprotein A/B) is a single-stranded DNA-binding protein that interacts with the CarG frame CC (rich in A/T) 6GG in α-smooth muscle actin ^[14]. HNRNPAB contains 331 amino acid residues. HNRNPAB consists of a distinct nonconserved N-terminal region, a highly conserved central region containing two RNA binding domains (RBDs), and a glycine-rich conserved C-terminal region ^[15–18]. This arrangement is present in many heterogeneous ribonucleic acid-binding proteins (HNRNPs)^[18]. Previous research has shown that hnRNPAB promotes metastasis in other cancers, including hepatocellular carcinoma (HCC) ^[19–21]. However, the roles and molecular mechanisms of hnRNPAB in GC invasion and migration remain unclear. This study aims to elucidate the preceding puzzle.

Wnt signal transduction is mediated by various protein complexes, including GSK3β, which target β-catenin for degradation through ubiquitination and subsequently block its nuclear translocation. However, ubiquitin-mediated inhibition of β-catenin degradation in the presence of Wnt stimulation (inactivated GSK3β) leads to cytoplasmic accumulation and subsequent nuclear translocation of β-catenin ^[22–24]. Nuclear β-catenin then binds to the TCF/LCF family to activate several target genes, including c-myc and cyclin D1, which are involved in cell proliferation. Wnt/β-catenin alterations are evident in human malignancies. The Wnt signaling pathway, a key regulator of cell proliferation, differentiation, and migration, is frequently dysregulated in various cancers, including GC, and may be influenced by the activity of hnRNPAB. ^[23].

The Wnt signaling pathway, a key regulator of cell proliferation, differentiation, and migration, is frequently dysregulated in various cancers, including GC. This pathway is mediated by various protein complexes, including GSK3β, which targets β-catenin for degradation through ubiquitination, effectively blocking its nuclear translocation. However, when Wnt signaling is activated (inactivated GSK3β), ubiquitin-mediated inhibition of β-catenin degradation is blocked, leading to its cytoplasmic accumulation and subsequent nuclear translocation. ^[22–24] Once in the nucleus, β-catenin binds to the TCF/LCF family, activating target genes such as c-myc and cyclin D1, which are involved in cell proliferation. This pathway may be influenced by the activity of hnRNPAB, a factor that plays a significant role in the development and progression of cancer. ^[23]. This study aimed to investigate the role of hnRNPAB in GC progression and metastasis. Specifically, we hypothesize that hnRNPAB promotes GC cell proliferation, migration, and invasion by activating the Wnt pathway through Akt/GSK3β phosphorylation. Our findings could provide valuable insights into the molecular mechanisms underlying GC metastasis and identify hnRNPAB as a potential therapeutic target.

Cell Culture

The human gastric cancer-derived cell line MKN-45 was purchased from NTCC (Shanghai, China), and MKN-7 cells were purchased from Procell (Wuhan, China). All the cells were treated with 10% fetal bovine serum (Life Technologies, USA) and 1% penicillin‒streptomycin solution (Life Technologies, USA) in 1640 medium (Life Technologies, USA). The cells were placed in a wet air incubator containing 5% carbon dioxide at 37°C.

Cancer database analysis

The UALCAN database (http://ualcan.path.uab.edu) was used to analyze the expression of hnRNPAB in various cancers, especially gastric cancer. Further analysis of hnRNPAB expression in GC was conducted via the GEPIA database to analyze the differential expression of hnRNPAB in 408 GC tissues and 211 normal tissues. String (https://string-db.org) and Genemania (https://genemania.org) database searches revealed the relationship between the AKT-Wnt/β-catenin pathway and EMT progression. The correlations between hnRNPAB and MYC, CTNNB1, and CCND1 in gastric cancer were also investigated via the GEPIA database (http://gepia.cancer-pku.cn).

RNA Extraction and Quantitative Real-time Polymerase Chain Reaction (QRT‒PCR)

The cells were harvested, and total RNA was extracted from the cells or tissue samples using the TRIzol reagent (Qiagen, Hilden, Germany) following the manufacturer's instructions. The RNA was then reverse-transcribed into cDNA via a Hifair® II 1st Strand cDNA Synthesis Kit (YEASEN, Shanghai). Hieff® qPCR SYBR® Green Master Mix (YEASEN, Shanghai) was used for QPCR. Relative quantitative analysis was conducted according to the 2-ΔΔCt method, and the results were normalized to the expression of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The following primer sequences were used:

HNRNPAB:

Forward: 5'TTTGGagAGGTCGTTGACTGT-3’,

Reverse: 5'-GTGGcTTCAGGATTcAGACC-3'.

GAPDH:

Forward: 5'GACACCCACTCCTCCACCTTT3'

Reverse: 5'TGTTGCTGTAGCCAAATTCGTT3'

Plasmid construction and cell transfection

RT‒PCR was used to amplify the cDNA of gastric cancer cells with hnRNPAB-specific primers. The PCR products were homologously recombined into pmXS-FLAG mammalian expression vectors. The logarithmic growth mKN-7 and MKN45 cells were spread in six-well plates and then transfected into MKN45 and MKN7 cells with shRNA-HNRNPAB (Tsingke, Beijing) or PMXS-Flag-HNRNPAB plasmid via Lipofectamine 6000 transfection agent (Beyotime, Shanghai) according to the manufacturer's protocol. The corresponding empty vector was used as the control group.

MTT Assay

The proliferation of GC cells was determined via the MTT assay. A total of 1× 103 gastric cancer cells were inoculated into a 96-well plate. After the cells adhered to the plate, 10 µl of 5 mg/ml MTT (Beyotime, Shanghai) was added to each well, and the mixture was cultured at 37°C for 4 hours. The supernatant was carefully aspirated. DMSO (150 µl) was added to each well, and the samples were placed in a low-speed shaker for 10 minutes. The OD value was measured at 490 nm with a microplate reader (BioTek Synergy LX Multimode Reader).

Wound healing assay

Cell migration was examined through a wound healing assay, and 5×10⁵ cells/well were inoculated into a six-well plate. When the degree of cell confluence reached 90%, a wound was formed at the bottom of the six-well plate with the tip of a sterile 200 µL pipette. The cells were washed with PBS (3 times) to remove the cell debris, which was then replaced with serum-free medium for culture. The culture was continued in incubators under preestablished conditions (37°C and 5% CO₂) for 24 h. Finally, images of wound closure were taken at 0 h and 24 h under an inverted microscope.

Transwell Assay

Cell invasion ability was examined via a transwell assay. MKN7 or MKN45 cells were digested, centrifuged, and resuspended in serum-free DMEM (density 5 × 105/mL). A total of 100 µL of each cell suspension was added to a Matrigel (BD Biosciences, USA)-preconditioned Transwell (Corning, USA), and 600 µL of DMEM containing 20% FBS was added to the lower chamber. After incubation at 37°C for 24 hours, the chamber was removed, washed with PBS, fixed with 4% paraformaldehyde for 20 minutes, and dyed with DAPI for 20 minutes. A cotton swab was used to gently wipe the cells that had not crossed the upper surface of the lumen membrane. Six fields of high magnification were randomly selected under a fluorescence microscope. The number of cells that migrated through the Matrigel-coated membrane in each field of view was counted, and the average number of migrated cells per field was calculated.

Immunofluorescence

The cells cultured on a cover glass in a 6-well plate were fixed with 4% paraformaldehyde (Beyotime, Shanghai, China), blocked with 3% BSA (Beyotime, Shanghai, China), and incubated overnight with the corresponding antibodies at 4°C. The cells were washed with PBS and incubated at room temperature with a secondary antibody (Abcam, USA) for 2 h. The nuclei were stained with DAPI (Beyotime, Shanghai, China). The mixture was then fixed with anti-fading fluorescent medium. The fluorescence signal was observed under a microscope.

Western blot

In the presence of a protease inhibitor mixture (Roche, Switzerland)/1% phosphatase inhibitor mixture (Roche, Switzerland), the cells were lysed in 1x RIPA lysis buffer. The protein concentration was measured with a BCA protein quantitative kit (Life Technologies, USA). The total protein (20 g) was subjected to 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and then transferred to a PVDF membrane (Millipore, USA). The membrane was subsequently blocked with a blocking solution (5% skim milk powder protein solution in Tris buffer salt solution containing 0.5% Tween-20 (TBS-T)) for 120 min at room temperature. The membrane was incubated with primary antibody (CST, USA) overnight in a closed solution at 4°C and washed with TBS-T 5 times (7 min each), and the secondary antibody conjugated with horseradish peroxidase (HRP) was incubated at room temperature for 1.5 h. The membrane was then washed with TBS-T 5 times (7 min each), and enhanced chemiluminescence detection was performed. Protein expression was standardized relative to that of TUBULIN.

Statistical analysis

Each experiment was repeated 3 times. Statistical analysis was performed via GraphPad Prism. Statistical analyses were performed with an unpaired Student's t test or one-way ANOVA for more than two groups. P < 0.05 was considered statistically significant.

The expression of HNRNPAB was significantly different between high- and low-metastatic gastric cancer cells.

Differential gene expression analysis was conducted via transcriptomic sequencing to compare highly metastatic gastric cancer cells (MKN45) with poorly metastatic gastric cancer cells (MKN7). (Fig. 1A-B) and QPCR (Fig. 1C). Compared with those in MKN7 cells, the expression levels of hnRNPA1, hnRNPAB, hnRNPF, SRSF8, and SF3B3 were increased in MKN45 cells. The expression levels of hnRNPH, SRSF6, etc.,etc. were decreased. However, other splicing factors, such as 9G8 and SF3B1, are similar. The protein expression levels of the hnRNP AB, hnRNPF, SRSF8, and SF3B3 genes in gastric cancer cells with high and low metastatic capacity were subsequently analyzed via Western blot analysis (Fig. 1D). The protein expression levels of the hnRNP AB, hnRNPF, SRSF8, and SF3B3 genes were 3.45, 2.32, 1.90, and 2.55 times greater, respectively, in MKN45 cells than in MKN7 cells. The results showed that the expression level of HNRNPAB may be related to the ability of gastric cancer cells to metastasize.

HNRNPAB is highly expressed in human gastric cancer tissue

An analysis of the UALCAN database and GEPIA database revealed that hnRNPAB may be related to various types of cancer, including gastric cancer (Fig. 2A), and that hnRNPAB is more highly expressed in gastric cancer tissues than in normal tissues (Fig. 2A-2B). The expression level of hnRNPAB in the three stages of gastric cancer development was also greater than that in normal tissues, and there was a positive correlation between the expression level of hnRNPAB and the progression of gastric cancer (Fig. 2C). These results indicate that hnRNPAB is highly expressed in human gastric cancer tissues and that hnRNPAB may be associated with GC metastasis.

HNRNPAB overexpression enhanced the proliferation, migration, and invasion of GC cells

Western blotting was used to verify the overexpression efficiency of hnRNPAB (Fig. 3A). MTT assays revealed that hnRNPAB overexpression significantly promoted the proliferation of MKN7 (Fig. 3B) and MKN45 (Fig. 3C) cells. Wound healing experiments revealed that hnRNPAB overexpression promoted the migration of MKN7 and MKN45 cells (Fig. 3D). Similarly, Transwell migration analysis revealed that hnRNPAB overexpression promoted the invasion ability of MKN7 and MKN45 cells (Fig. 3E). These data indicated that hnRNPAB overexpression promoted the proliferation, migration, and invasion of GC cells.

Knocking down HNRNPAB inhibited GC cell proliferation, migration, and invasion.

The SHHNRNPAB vector with the highest HNRNPAB knockdown efficiency was screened via Western blotting (Fig. 4A). MTT was then performed to assess the role of hnRNPAB in malignant proliferation, and the downregulation of hnRNPAB significantly inhibited the proliferation of MKN7 cells (Fig. 4B) and MKN45 cells (Fig. 4C). To assess the migration of HNRNPAB in GC cells, wound-healing tests were performed. Compared with the GC cells transfected with PLKO.1, the GC cells transfected with PLKO.1-shhnRNPAB exhibited significantly inhibited cell migration (Fig. 4D). A matrix-coated transwell chamber was used to detect cell invasion in vitro. When hnRNPAB was downregulated, the invasion ability of MKN45 and MKN7 cells was significantly reduced compared with that of control cells (Fig. 4E). These data showed that hnRNPAB downregulation inhibited GC cell proliferation, migration, and invasion.

HNRNPAB promotes the development of EMT

EMT is a key process that drives cancer metastasis. To evaluate the role of hnRNPAB in EMT, the expression of EMT marker proteins was detected. Overexpression of hnRNPAB decreased the expression of the epithelial marker protein E-cadherin in MKN7 cells and MKN45 cells (Fig. 5A-B) and increased the expression of the mesenchymal marker proteins N-cadherin, vimentin and Snail. Knockdown of hnRNPAB increased the expression of the epithelial cell marker protein E-cadherin in MKN7 cells and MKN45 cells (Fig. 5A-B) and reduced the expression of the mesenchymal cell marker proteins N-cadherin, vimentin and Snail.

HnRNPAB promotes the development of gastric cancer through the Wnt/β-catenin signaling pathway.

Analysis of the GeneMANIA database (Fig. 5C) revealed that the Wnt/β-catenin signaling pathway significantly influences the EMT process. Subsequent analysis of the GEPIA database (Fig. 5D) revealed a significant positive correlation between hnRNPAB and MYC, CTNNB1 (β-catenin), and CCND1 (cyclin D1) in gastric cancer. Western blot results revealed that the overexpression of hnRNPAB significantly increased the expression of β-catenin, c-myc, and cyclin D1 (Fig. 6A). Moreover, the knockdown of hnRNPAB significantly decreased the expression of β-catenin, c-myc, and cyclin D1. Immunofluorescence revealed that hnRNPAB overexpression increased the expression of β-catenin and Myc in MKN7 cells and promoted the nuclear transport of β-catenin (Fig. 6B). Knockdown of hnRNPAB reduced the expression of β-catenin and Myc in MKN45 cells and inhibited the nuclear transport of β-catenin (Fig. 6B). These results suggest that hnRNPAB promotes EMT and gastric cancer progression through the Wnt/β-catenin signaling pathway.

HnRNPAB activates the Wnt signaling pathway through Akt-GSK3β.

Analysis of the STRING database (Fig. 7A) revealed that GSK3β has an important effect on the Wnt/β-catenin signaling pathway. Western blotting revealed that overexpression of hnRNPAB resulted in increases in P-Akt (Ser473)/total Akt and P-GSK-3β (Ser9)/total GSK3β levels in MKN45 and MKN7 cells; however, knockdown of hnRNPAB resulted in decreases in P-Akt (Ser473)/total Akt and P-GSK-3β (Ser9)/total GSK3β levels in MKN45 and MKN7 cells (Fig. 7B-D).

The differential expression of splicing factors can affect tumor metastasis. This study is the first to screen for splicing factors that are differentially expressed in the highly metastatic gastric cancer cell line MKN45 and the poorly metastatic gastric cancer cell line MKN7^[25–29]. The expression of hnRNPAB in highly metastatic gastric cancer cells was significantly higher than that in low-metastatic gastric cancer cells, and the splicing factor hnRNPAB, which might be related to gastric cancer metastasis, was identified. HnRNPAB is the only hnRNP protein that is generally upregulated in breast cancer and is essential for breast cancer survival ^{[30, 31]}. However, the role of hnRNPAB in GC has not been reported. By analyzing the UALCAN and GEPIA databases, this study revealed that the expression of hnRNPAB in GC tissue samples was greater than that in normal control samples. These results suggest that the expression level of hnRNPAB may be a potential biomarker for evaluating gastric cancer patients.

Next, the function of hnRNPAB in gastric cancer tumorigenesis and metastasis was investigated. The results revealed that hnRNPAB overexpression promoted the proliferation, migration, and invasion of gastric cancer cells, whereas hnRNPAB knockdown had the opposite effect. These results indicate that hnRNPAB plays an important role in the growth and metastasis of GC cells.

Epithelial‒mesenchymal transformation (EMT) is a process in which epithelial cells acquire mesenchymal characteristics ^[32]. Epithelial‒mesenchymal transformation (EMT) is associated with carcinogenesis and confers metastatic properties to cancer cells by enhancing cell migration, invasiveness, and resistance to apoptotic stimuli. The complex biological process of EMT is considered a key marker of carcinogenesis ^[33–35], and targeting the EMT pathway constitutes an attractive cancer treatment strategy. Although there is growing evidence that hnRNPAB plays an important role in tumorigenesis and metastasis, its mechanism remains unclear. The study revealed that hnRNPAB overexpression decreased E-cadherin expression, whereas N-cadherin, vimentin, and Snail1 expression significantly increased, whereas hnRNPAB knockdown resulted in the opposite phenomenon. These findings suggest that hnRNPAB may promote the metastasis of gastric cancer cells through EMT. Many signaling pathways, such as the Wnt and Akt pathways, contribute to EMT^{[36, 37]}, and the key molecular event is the downregulation of the cell adhesion molecule E-cadherin. This study revealed that hnRNPAB promoted the nuclear translocation of β-catenin and upregulated the protein expression of its downstream targets, c-myc and cyclin D1. Akt is activated by phosphorylation at Thr308 or Ser473 and phosphorylates several downstream protein substrates, including GSK3β^[38]. GSK3β is inactivated by the phosphorylation of S9 serine residues in GSK3β, and Akt is the major mediator of this serine phosphorylation and subsequent GSK3 inactivation ^{[39, 40]}. In the classical Wnt pathway, the inhibition of GSK3β is critical for the stabilization and nuclear translocation of β-catenin. Our results show that hnRNPAB overexpression induces Akt phosphorylation at Ser473 and GSK-3β phosphorylation at Ser9. These findings suggest that hnRNPAB promotes phosphorylation of the Akt pathway and inactivates GSK3β, thereby activating the Wnt pathway.

In conclusion, this study demonstrated the significant overexpression of hnRNPAB in human gastric cancer tissues and highly metastatic cell lines. These findings further show that hnRNPAB promotes gastric cancer cell proliferation, migration, and invasion. Mechanistically, hnRNPAB appears to contribute to gastric cancer development by regulating epithelial‒mesenchymal transition (EMT) through the Akt–GSK3β–Wnt signaling pathway. These findings suggest that hnRNPAB may represent a promising therapeutic target for gastric cancer.

APS	Ammonium persulfate
AKT	protein kinase B
BCA	Bicinchoninic acid
DAPI	6-diamidino-2-phenylindole
DEPC	Diethy pyrocarbonate
DMSO	Dimethyl sulfoxide
EMT	Epithelial–mesenchymal transition
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase
GC	gastric cancer
GSK-3β	glycogen synthase kinase 3β
HNRNPAB	Heteroribonucleoprotein AB
MTT	3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide
PMSF	Phenylmethanesulfonyl fluoride
PVDF	Polyvinylidene fluoride
RT‒qPCR	Quantitative Real-time Polymerase Chain Reaction
SDS‒PAGE	Sodium dodecyl sulfate‒Polyacrylamide gel electrophoresis
shRNA	Short hairpin RNA

Conflict of interest statement

The authors declare that they have no competing interests.

Data avaibility statement

The authors declare that the data supporting the findings of this study are available within the paper. Should any raw data files be needed in another format they are available from the corresponding author upon reasonable request

Funding statement

This work was supported by the Guangzhou Basic and Applied Basic Research Project (NO.202201010010), the Natural Science Foundation of Guangdong Province NO.2022A151501636 and 20241515013257), and the Quality Engineering Construction Project of Jinan University.

Author Contribution

L.H. conceived and designed the study, performed experiments, and wrote the initial draft of the manuscript. A.Y.G.T. contributed to the experimental work and critically reviewed and edited the manuscript. assisted in data analysis and visualization and provided critical review and editing of the manuscript. Y.M. assisted in data analysis and provided critical review and editing of the manuscript. Z.G. performed formal analysis, reviewed, and edited the manuscript. Q.Z. supervised the research, contributed to the methodology, managed the project, and provided critical review and editing of the manuscript. F.W. provided overall supervision, contributed to the study design and methodology, secured funding for the project, and reviewed and edited the manuscript.

Data Availability

Elizabeth C, Smyth M, Nilsson HI, Grabsch, Nicole CT, van Grieken. Florian Lordick gastric cancer[J] Lancet. 2020;396:635–48.
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68(6):394–424.
Group G, Oba K, Paoletti X, Bang YJ, Bleiberg H, Burzykowski T, et al. Role of chemotherapy for advanced/recurrent gastric cancer: an individual-patient-data meta-analysis. Eur J Cancer. 2013;49(7):1565–77.
Harper K, Sosa MS, Entenberg D, et al. Abstract 3051: Mechanism of early dissemination and metastasis in Her2 + mammary cancer[J]. Cancer Res. 2017;77(13 Supplement):3051–3051.
Sosa María, Soledad, Bragado P, Aguirre-Ghiso JA. Mechanisms of disseminated cancer cell dormancy: an awakening field[J]. Nat Rev Cancer. 2014;14(9):611.
K?Dzierska H, Piekie?Ko-Witkowska A. Splicing factors of SR and hnRNP families as regulators of apoptosis in cancer[J]. Cancer Lett. 2017;396(Complete):53.
Anczuków O, Krainer AR. Splicing-factor alterations in cancers[J]. RNA. 2016;22(9):1285–301.
C R S A B, A A W, D Y G A, et al. The role of alternative splicing in cancer: From oncogenesis to drug resistance - ScienceDirect[J]. Drug Resistance Updates; 2020. p. 53.
Takeiwa T, Mitobe Y, Ikeda K, et al. Roles of Splicing Factors in Hormone-Related Cancer Progression[J]. Int J Mol Sci. 2020;21(5):1551.
Li F, Zhao H, Su M et al. HnRNP-F regulates EMT in bladder cancer by mediating the stabilization of Snail1 mRNA by binding to its 3′ UTR[J]. EBioMedicine, 2019, 45.
Chn-Hsna Y-CH. Jnq-Chan, et al. Translational upregulation of Aurora-A by hnRNP Q1 contributes to cell proliferation and tumorigenesis in colorectal cancer[J]. Cell Death & Disease; 2017.
Anczuków O, Akerman M, Cléry A, et al. SRSF1-Regulated Alternative Splicing in Breast Cancer[J]. Molecular Cell; 2015.
SRSF1 modulates PTPMT. 1 alternative splicing to regulate lung cancer cell radioresistance.[J]. Ebiomedicine, 2018.
Kamada S, Miwa T. A protein binding to CArG box motifs and to single-stranded DNA functions as a transcriptional repressor[J]. Gene. 1992;119(2):229.
Smidt MP, Bernadetta R, Lenie S, et al. Cloning and characterisation of a nuclear, site specific ssDNA binding protein[J]. Nucleic Acids Res. 1995;23(13):2389–95.
Lau PP, Zhu HJ, Nakamuta M, et al. Cloning of an Apobec-1-binding Protein That Also Interacts with Apolipoprotein B mRNA and Evidence for Its Involvement in RNA Editing[J]. J Biol Chem. 1997;272(3):1452–5.
Weismanshomer P. Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n[J]. Nucleic Acids Res. 2002;30(17):3672.
Alaitz A. David, CArG box-binding factor-A interacts with multiple motifs in immunoglobulin promoters and has a regulated subcellular distribution[J]. Eur J Immunol, 2006.
Zhou ZJ, Dai Z, Zhou SL, et al. HNRNPAB Induces EpithelialMesenchymal Transition and Promotes Metastasis of Hepatocellular Carcinoma by Transcriptionally Activating SNAIL[J]. Cancer Res. 2014;74(10):2750–62.
Zhou ZJ, Wang XY, Xu XY, et al. [High expression of hnRNPAB/Kap1 together promote poor prognosis in HCC].[J]. Zhonghua gan zang bing za zhi = Zhonghua ganzangbing zazhi = Chinese. J Hepatol. 2017;25(6):452.
Yang Y, Chen Q, Piao Hai℡an et al. HNRNPAB-regulated lncRNA‐ELF209 inhibits the malignancy of hepatocellular carcinoma[J]. Int J Cancer, 2019, 146(1).
Clevers H, Nusse R. Wnt/β-Catenin Signaling and Disease[J]. Cell. 2012;149(6):1192–205.
Stewart DJ. Wnt Signaling Pathway in Non–Small Cell Lung Cancer[J]. J Natl Cancer Inst(1):djt356.
Zheng CH, Wang JB, Lin MQ, et al. CDK5RAP3 suppresses Wnt/β-catenin signaling by inhibiting AKT phosphorylation in gastric cancer[J]. J Experimental Clin Cancer Res. 2018;37(1):59.
Ishii M, Hashimoto S, Tsutsumi S, Wada Y, Matsushima K, Kodama T, Aburatani H. Direct comparison of GeneChip and SAGE on the quantitative accuracy in transcript profiling analysis. Genomics. 2000;68:136–43.
Hippo Y. Differential gene expression profiles of scirrhous gastric cancer cells with high metastatic potential to peritoneum or lymph nodes[J]. Cancer Res, 2001, 61.
Okamoto K, Yamaguchi T, Otsuji E, Yamaoka N, Yata Y, Tsuruta H, Kitamura K, Takahashi T. Targeted chemotherapy in mice with peritoneally disseminated gastric cancer using monoclonal antibodydrug conjugate. Cancer Lett. 1998;122:231–6.
Yawata A, Adachi M, Okuda H, Naishiro Y, Takamura T, Hareyama M, Takayama S, Reed JC, Imai K. Prolonged cell survival enhances peritoneal dissemination of gastric cancer cells. Oncogene. 1998;16:2681–6.
Takeshi Tsuchiya,Yurai Okaji,Nelson. H. Tsuno,Daisuke Sakurai,Naoyuki Tsuchiya,Kazushige Kawai. Targeting Id1 and Id3 inhibits peritoneal metastasis of gastric cancer[J]. Cancer Science,2005,96(11).
Cao Y, Zhang W, Jin YT, et al. Mining the Prognostic Value of HNRNPAB and Its Function in Breast Carcinoma[J]. Int J Genomics. 2020;2020:1–17.
Luo 31AJ, An Z. W, Identification of spliceosome components pivotal to breast cancer survival[J]. RNA Biol, 2020:1–10.
Ievgenia P. Cédric, et al. EMT Transition States during Tumor Progression and Metastasis.[J]. TRENDS IN CELL BIOLOGY; 2018.
Mittal V. Epithelial Mesenchymal Transition in Tumor Metastasis[J]. Annu Rev Pathol. 2018;13(1):395–412.
B G B A, A G G A, A N Z Z. J. EMT, cancer stem cells and autophagy; The three main axes of metastasis[J]. Biomedicine & Pharmacotherapy, 133.
Coban B, Bergonzini C, Zweemer AJM et al. Metastasis: crosstalk between tissue mechanics and tumour cell plasticity[J]. British Journal of Cancer.
Feng Y-L, Chen Dan‐Qian, Vaziri ND et al. Small molecule inhibitors of epithelial‐mesenchymal transition for the treatment of cancer and fibrosis[J]. Med Res Rev, 2020, 40.
Larue L, Bellacosa A. Epithelial–mesenchymal transition in development and cancer: role of phosphatidylinositol 3′ kinase/AKT pathways[J]. Oncogene. 2005;24(50):p–gs.
Mengqiu, Song A et al. AKT as a Therapeutic Target for Cancer.[J]. Cancer Res, 2019.
Cross DA, Alessi DR, Cohen P, Andjelkovich M, Hemmings BA. Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature. 1995;378:785–9.
Hur EM, Zhou FQ. GSK3 signalling in neural development[J]. Nature Reviews Neuroscience.

No competing interests reported.

Download PDF

Editor assigned by journal
13 Aug, 2024
Submission checks completed at journal
12 Aug, 2024
First submitted to journal
12 Aug, 2024

You are reading this latest preprint version

HNRNPAB is involved in the development of gastric cancer by regulating EMT through the AkT-GSK3β-Wnt signaling pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

Introduction

Materials and methods

Cell Culture

Cancer database analysis

RNA Extraction and Quantitative Real-time Polymerase Chain Reaction (QRT‒PCR)

HNRNPAB:

GAPDH:

Plasmid construction and cell transfection

MTT Assay

Wound healing assay

Transwell Assay

Immunofluorescence

Western blot

Statistical analysis

Results

HNRNPAB is highly expressed in human gastric cancer tissue

HNRNPAB overexpression enhanced the proliferation, migration, and invasion of GC cells

HNRNPAB promotes the development of EMT

Discussion

Abbreviations

Declarations

Conflict of interest statement

Data avaibility statement

Funding statement

Author Contribution

Data Availability

References

Additional Declarations

Status:

Version 1