Cell, animal culture and reagents
Imatinib-sensitive CML cells (K562 cells, purchased from TRANSGEN BIOTECH Co., LTD., Shanghai, China) were cultured in RPMI 1640 (TRANSGEN BIOTECH, Beijing, China) medium containing 10% fetal bovine serum; Imatinib-resistant cells (K562R cells) were maintained and cultured in RPMI1640 medium containing 5µM imatinib. The cells were cultured in a 5%CO2 incubator at 37℃.
Nude mice were provided by Shanghai Sipple-Bikai Laboratory Animal Co., LTD., Animal production license No. SCXK (Shanghai) 2013-0016. Feeding conditions: constant temperature, temperature 22 ± 2°C, humidity 50%-60%, light and dark environment of 14 h light and 10h dark alternating, wind change times 15–20 times/hour. It is raised by Animal Experimental Research Center of Zhejiang Eyong Pharmaceutical Research & Development Co., Ltd. Laboratory breeding room license No. SYXK (Zhejiang) 2021-0033.
TSRP was isolated and extracted from Rubus parvifolius, a traditional Chinese medicine, and was provided by Professor Yang Bo from Pharmaceutical Laboratory of Zhejiang Chinese Medicine University. IM was acquired from Shanghai Maclin Biochemical Technology Co., LTD. CCK8 kit was purchased from Shanghai Biyuntian Biotechnology Co., LTD. Trizol was acquired from Shenggong BioEngineering Shanghai Co., LTD. The reverse transcription kit was purchased from Beijing Kangwei Century Biotechnology Co., LTD. The SYBR Premix Ex TaqII kit is a Japanese Takara brand; The apoptosis kit is the American BD brand; Both RIPA lysate and PMSF were purchased from Shanghai Biyuntian Biotechnology Co., LTD. BCA kit and chemiluminescence detection reagent were purchased from Beijing Solaibao Technology Co., LTD. The antibodies are from Affnity Reagents.
Construction of drug-resistant cell lines
K562R was constructed by limiting gradient dilution method, that is, K562 was cultured by continuously and gradually increasing the concentration of imatinib solution. The concentration of imatinib ranged from 0.1 to 5µM, increasing by 200 nM every 14 days, and then maintained in RPMI1640 culture medium containing 5µM imatinib.
Cell grouping and administration
K562 cells were divided into control group and imatinib treatment group (0.25µM, 0.50µM, 0.75µM, 1.00µM and 2µM). K562R cells were divided into control group and imatinib treatment group (5.0µM, 7.5µM, 10.0µM, 15.0µM and 20 µM). K562 cells at logarithmic growth stage were taken, digested and counted to make 8x105/ml cell suspension, and 100ul cell suspension was added into each well of the 96-well plate. After the well plates were cultured in an incubator for 24h, the culture medium of the well plates was removed, and the drug intervention was carried out according to the groups. After 48 hours of administration, 10µL CCK-8 solution was added to each well and incubated in the incubator for 30min. The absorbance at 450nm was measured by enzyme labeling (MD, CMaxPlus, USA), and the cell survival rate was calculated. Six compound pores were measured in parallel in each cell group.
Cell morphology observation
K562 and K562R cells were inoculated into a conventional 12-well plate with imatinib (IC50 concentration of imatinib in K562 cells) at the growth stage. The cells were treated with 3 multiple pores in each concentration group. After induction for 48h, the cell morphology was observed under inverted microscope (Motic, AE2000, CHINA).
RT-qPCR assays
The cells were divided into control group and drug-resistant strain group. 1000µl of Trizol was added into homogenate tube for every 1×107 cells, and total RNA was extracted according to the kit procedure. Reverse transcription reaction was performed according to the steps of reverse transcription kit. Reaction conditions were 42℃, 15min; 85℃, 5min; Real-time fluorescence quantitative PCR reaction was performed according to SYBR Premix Ex TaqII kit instructions. Real time PCR instrument (BIO RAD, CFX Connect, USA) Real-time fluorescence quantitative PCR instrument, made in USA. PCR procedures have been optimized. The finished 8 tubes were placed on the Realtime PCR instrument for PCR reaction. Reaction conditions: 95℃, 10min denaturation; 95℃, 15s; 60℃, 60s; 40 cycles. Primer sequence information is shown in Table 1.
Table 1
| Gene | Forward Primer | Reverse Primer |
| Human Bcr/Abl | TCCTCGTCCTCCAGCTGTTA | GCAACGAAAAGGTTGGGGTC |
| Human GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
Insert Table 1 here
Cell Proliferation assays(CCK8 assays)
First, we divided K562R cells into TSRP treated groups (0, 50, 100, 200, 300 or 400 µg/ml) and IM treated groups (0, 0.1, 0.2, 0.4, 0.8 or 1.6 µM). IC10 of TSRP and IC50 of IM were detected by CCK8.
The effects of TSRP combined with IM on the proliferation of K562R cells were divided into the following groups: control group, TSRP group, IM group, and TSRP + IM group. K562R cell suspension at logarithmic growth stage was administered in groups and inoculated into 96-well plates. After 48h of culture, 10µL CCK8 solution was added to each well and incubated in the incubator. The absorbance of MD, CMaxPlus, USA at 450nm was measured by enzyme labeling, and the cell survival rate was calculated. Six compound pores were measured in parallel in each group of cells.
Cell apoptosis analysis
K562R cells of logarithmic growth stage were planted in 6-well plates with a working volume of 2ml per well, and the cell inoculation density was 1.2×106 cells per well. After 24 hours of treatment in the above groups, cells were collected, pre-cooled and washed twice with PBS, and the cell concentration was adjusted to 1×106 cells /ml. Add 500µL binding buffer, centrifuge and discard supernatant, then add 100µL binding buffer and mix well, add 5µL Annexin V-FITC and 10µL PI respectively, mix well; The reaction was kept away from light at room temperature for 15min. Finally, 400µL binding buffer was added, and the apoptosis rate was detected by BD, C6, USA at 1h. The experiment was repeated three times.
Western blot assay
Cell protein preparation: the supernatant was removed by centrifugation, 600 µL RIPA lysate (including PMSF and protease inhibitor) was added, cracked on ice, and then the supernatant was removed by centrifugation and transferred to a new pre-cooled centrifuge tube. Preparation of histocin: 100mg tissue sample was Lysis, split and added to 1mL cold homogenate. The supernatant was centrifuged and measured by BCA kit. The protein was denatalized and stored in Loading buffer for later use. Appropriate amount of sample supernatant was absorbed and added into the sample hole, separated by SDS-PAGE gel electrophoresis at 80V for 2h, and wet-transferred to PVDF membrane at 350mA and 90min. Closed with 5% skim milk powder BSA for 2 hours, cut the film, added primary antibody, incubated at 4℃ overnight. After TBST film washing, the corresponding secondary antibodies were added and incubated at room temperature for 1h away from light. After TBST film washing, the ECL chemiluminescence instrument (Shanghai Qinxiang Scientific Instrument Co., LTD., 610020-9Q, Shanghai, China) was developed. Image Studio Ver 2.0 software was used for semi-quantitative analysis of protein gray scale.
Bioinformatics analysis
Query by literature, the main composition of TSRP including raspberries glycosides, carrot glycosides, bitter mei glycosides, rose acid, beta sitosterol [21], we through the PubChem database (http://pubchem.ncbi.nlm.nih.gov/) of main ingredients primer name, Import the Swiss Target Prediction (http://www.swisstargetprediction.ch/) in the database for the active ingredient of targets, remove all the ingredients of targets duplicates as TSRP gene pool. CML disease targets from Gene Cards ((http://www.genecards.org/)) and OMIM database (http://www.omim.org/), the two merged duplication targets to establish CML Gene pool, Through Venny 2.1.0 (http://bioinfo.cnb.csic.es/tools/venny/index.html) for TSRP and CML intersection of genes, Using annotations, visualization and comprehensive database of DAVID (https://david.ncifcrf.gov/), which USES the gene ontology (GO) and enrichment of the Kyoto encyclopedia (KEGG) gene and genome analysis to evaluate intersection genes, species, type is set to "Homo sapiens", When adjusted for P < 0.05, the difference was statistically significant. bioinformatics(http://www.Bioinformatics.com.cn/) was used to analyze the significant enrichment results of GO analysis and KEGG analysis to draw bubble maps respectively.
Construction of transplanted tumor model in nude mice
K562R cells of logarithmic growth stage were digested, washed and centrifuged in a 1.5ml centrifuge tube with pancreatic enzyme. The cells were suspended and counted with normal saline, and then the cell suspension was adjusted to 5×107 cells /ml with normal saline. A 6-week-old female nude mouse was taken, the left armpit skin was disinfected with 75% alcohol, and 100ul cell suspension was injected subcutaneously into the left armpit with a disposable 1ml syringe. The conditions of nude mice were observed twice a week, including the volume of transplanted tumor (volume = length × width 2/2), weight and survival of nude mice.
Animals were grouped and administered
The nude mice were divided into model group, TSRP group, IM group and TSRP + IM group. When the graft volume of each experimental group was close to 30mm3, the drug was administered according to the experimental group, with 50mg/kg IM and 100mg/kg TSRP by intraperitoneal injection every day, and the control group was injected intraperitoneally with the same amount of normal saline every day for consecutive 3 weeks. The naked mice were stripped of the neck and dissected, the tumor tissue was weighed, and the long diameter and short diameter of the tumor tissue were measured with a vernier caliper, and the volume was calculated (volume = long diameter * short diameter 2/2).
Immunohistochemical detection
Tissue sections were routinely dewaxed, hydrated, antigen-repaired with citrate buffer solution by microwave, incubated with 3% H2O2 for 10min to eliminate endogenous peroxidase activity, and rinsed with PBS 3 times. Drop the sealing solution (5%BSA) and leave it in a wet box at room temperature for 30min. Wipe off the sealing solution with filter paper, add a suitable concentration of primary antibody (all 1:50), incubate in a wet box at 4℃ overnight, and wash off the primary antibody with PBS. Biotin was added to the secondary antibody solution, incubated in a wet box at room temperature for 20min, and the secondary antibody was washed with PBS. Streptomyces ovialbumin working solution labeled with horseradish enzyme was added, incubated in a wet box at room temperature for 20min, and washed off with PBS. DAB color development agent, rinse fully with tap water. Hematoxylin redyeing, dehydration, transparent, neutral gum seal. The tumor tissue of nude mice was randomly selected under section microscope and the 6 fields were not repeated.
Statistical analysis
SPSS 16.0 statistical software was used for data analysis, and all data were expressed as mean ± standard deviation (‾χ ± s), P< 0.05 was considered statistically significant. For pairwise comparison between groups, t test of two independent samples was used for homogeneity of variance, and Kruskal-Wallis H test was used for heterogeneity of variance.