A novel mechanism by which c-MYC is aberrantly activated by epigenetic silencing in cancer cells

doi:10.21203/rs.3.rs-4910582/v1

Download PDF

Article

A novel mechanism by which c-MYC is aberrantly activated by epigenetic silencing in cancer cells

https://doi.org/10.21203/rs.3.rs-4910582/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Proto-oncogenes are abnormally activated in nearly all types of tumors. However, the epigenetic mechanism of proto-oncogene activation has not yet been well elucidated. Here, we show that a subset of proto-oncogenes, including c-MYC, possess antisense RNAs. Upregulation of c-MYC in cancer tissues was attributed to the silencing of its antisense RNA MYC-AS1 via DNA hypermethylation. MYC-AS1 RNA markedly inhibited the proliferation of cancer cells in vitro and impeded tumor growth in nude mice in vivo by repressing the expression of c-MYC via an RNAi mechanism. MYC-AS1 RNA bound directly to the HuR protein in the cytoplasm, enhancing the RNA stability of MYC-AS1. Furthermore, MYC-AS1 inhibited c-MYC-targeted gene LDHA expression. Our work provides a novel mechanism by which c-MYC is activated in cancer cells by epigenetic silencing of its antisense RNA, which functions as a tumor suppressor.

Biological sciences/Cancer

Biological sciences/Genetics

Health sciences/Diseases

Antisense RNA

c-MYC

DNA methylation

Cancer

HuR

The present study reveals a novel mechanism of tumorigenesis by which oncogenes are activated by epigenetic silencing of their counterpart antisense lncRNAs. Identifying MYC-AS1 as a tumor suppressor may facilitate the design of new anticancer drugs.

Abnormal loss of function of tumor suppressor genes (TSGs) and activation of proto-oncogenes are important molecular characteristics in various types of cancer cells. Accumulated evidence shows that genetic mutations and/or epigenetic silencing result in loss of function of TSGs (1, 2). The discovery of epigenetic silencing of TSGs led to the introduction of epigenetic drugs into the arsenal of clinical cancer therapies (2). For example, DNA methylation inhibitors, such as 5-Aza-2-deoxycytidine (5-Aza-CdR) and 5-azacytidine (5-Aza-CR), have been approved by the USA Food and Drug Administration (FDA) for the treatment of myelodysplastic syndrome (MDS) (3) and are undergoing active investigation for solid tumors (4). Although genetic alterations, such as point mutation and amplification, contribute to oncogene activation, the epigenetic mechanisms of proto-oncogene activation remain unclear. In addition, the molecular mechanism and clinical efficacy of DNA methylation inhibitors are under debating (5). It is unclear whether oncogenes are simultaneously upregulated when TSGs are activated by DNA methylation inhibitors due to their global demethylation.

The well-known proto-oncogene c-MYC contributes to the initiation and maintenance of tumorigenesis in many human cancers (6–9). Although it is well known that genetic alterations, such as point mutations and amplification, contribute to the activation of c-MYC, the epigenetic mechanism of the proto-oncogene activation has not yet been well elucidated. Recently, several studies revealed that epigenetic drugs, such as the DNA methylation inhibitors 5-aza-2-deoxycytidine (5-aza-CdR) and 5-azacytidine (5-aza-CR), were involved in the epigenetic regulation of the c-MYC gene by inhibiting its protein expression (10), but no a rational explanation was given for this phenomenon.

In the previous study, we demonstrated that an antisense RNA can induce hypermethylation of its sense tumor suppressor gene (TSG) p15, giving rise to epigenetic silencing of the gene in AML (11). Consistent with this, the tumor suppressor gene p21 also possesses an antisense RNA that inhibits the expression of p21 through epigenetic mechanisms (12). These results suggest that antisense RNAs in cancer cells may downregulate tumor suppressor genes in cancer cells by inducing epigenetic modifications. In this study, we unexpectedly found that a set of oncogenes also possess their antisense RNAs by high-throughput RNA-Seq analysis. By studying a well-known oncogene c-MYC, we found that epigenetic silencing of its antisense RNA MYC-AS1 directly contributes to activation or upregulation of the c-MYC gene. We further uncovered that the antisense RNA MYC-AS1 functions as a tumor suppressor that strictly controls c-MYC expression. Once this suppressor becomes defective due to events such as epigenetic silencing, the oncogene c-MYC is abnormally activated and it's like the tumor suppressor brake is released. MYC-AS1 RNA binds directly to HuR protein in the cytoplasm, enhancing the RNA stability of MYC-AS1. Furthermore, MYC-AS1 inhibited c-MYC-targeted gene LDHA expression. These results reveal a novel mechanism of tumorigenesis by which the oncogene is activated by epigenetic silencing of its antisense lncRNA.

Human tissue samples

Surgical resection specimens including cancer tissues and matched normal tissues were obtained from the Chinese PLA General Hospital in Beijing. A total of 200 pairs of specimens were collected, including 50 pairs from es gastrointestinal cancer patients, 50 pairs from esophageal cancer patients, 50 pairs from gastric cancer, 50 pairs from colon cancer patients and 50 pairs from hepatocellular carcinoma patients.

Cell culture

The human colon cancer cell line HCT116 was maintained in McCoy's 5A Medium (Gibco) with 10% FBS (Gibco). The hepatocellular carcinoma cell line HepG2, gastric cancer cell line BGC823 and esophageal cancer cell line KYSE50 were maintained in DMEM-high glucose (Gibco) with 10% FBS. HEK293T cells were maintained in DMEM-high glucose (Hyclone) with 10% FBS.

Plasmid and constructs

The full-length sequences of MYC-AS1 were amplified from the 293T cell cDNA template with the following primers: forward 5′-CCCAAGCTTGCCTTTTCATTGTTTTCCA-3′ and reverse 5′-CGCGGATCCCCTTTTTTAAGACGGAGTC-3′. The HuR gene was amplified with the following primers: forward 5′-CCCAAGCTTATGTCTAATGGTTATGAAGACC-3′ and reverse 5′-CCGGAATTCTTATTTGTGGGACTTGTTGG-3′. The amplified product of MYC-AS1 or HuR was then cloned into the expression vector pcDNA3.1.

Transfection

HCT116 cells were plated in 6-well plates and transfected with pcDNA3.1-HuR, pcDNA3.1-MYC-AS1 or pcDNA3.1-EGFP expression plasmids using Xfect™ Transfection Reagent (631318, Takara) according to the manufacturer’s instructions. After 48 h of transfection, cells were collected for RNA and protein analysis.

RNA Interference

HCT116 cells were plated on 6-well plates and transfected with 100 nM siRNA for 72 h using Xfect™ RNA Transfection Reagent (631450, Takara) according to the manufacturer’s instructions. For the Dicer or HuR siRNA experiment, HCT116 cells were transfected with 100 nM siRNA for 24 h and then transfected with pcDNA3.1-MYC-AS1 or pcDNA3.1-EGFP expression plasmids using Xfect™ Transfection Reagent for an additional 48 h. All siRNA oligonucleotide duplexes used in this study were synthesized by RIBOBIO and are listed as follows.

Dicer siRNA-1: GTGCTAGATTACCAAGTGA

Dicer siRNA-2: GCAACTTGGTGGTTCGTTT

Dicer siRNA-3: GGCCGCCTTTCATATATGA

HuR siRNA-1: GACCCAGGATGAGTTACGA

HuR siRNA-2: GAGCGATCAACACGCTGAA

HuR siRNA-3: GGTTGCGTTTATCCGGTTT

MYC-AS1 siRNA-1: GAAAGGTCTCTGGACAAAAT

MYC-AS1 siRNA-2: AAATCACTCCTTTAGCAAGG

MYC-AS1 siRNA-3: CCCAAAGAGCCACATCTAAG

Lentivirus packaging and transduction

The full-length sequences of MYC-AS1 were amplified from the 293T cell cDNA template with the following primers: forward 5′-TGCTCTAGAGCCTTTTCATTGTTTTCCA-3′ and reverse 5′-CGCGGATCCCCTTTTTTAAGACGGAGTC-3′ and then cloned into the pCDH-CMV-MCS-EF1-Puro lentiviral vector. The EGFP was amplified using the following primers: forward 5′-TGCTCTAGAATGGTGAGCAAGGGCGAG-3′ and reverse 5′-CGCGGATCCTTACTTGTACAGCTCGTC-3′ and cloned into the pCDH-CMV-MCS-EF1-Puro lentiviral vector (as a control). Lentiviruses containing pCDH-CMV-MCS-EF1-Puro-MYC-AS1 or pCDH-CMV-MCS-EF1-Puro-EGFP were produced with a lentiviral packaging mix containing an optimized mixture of the three packaging plasmids, pLP1, pLP2, and pLP/VSVG, in 293T packaging cells. In brief, 293T cells were transfected with pCDH-CMV-MCS-EF1-Puro-MYC-AS1 or pCDH-CMV-MCS-EF1-Puro-EGFP and three packaging plasmids, pLP1, pLP2, and pLP/VSVG, in the presence of the Lipofectamine™ 2000 Transfection Reagent (11668019, Thermo Scientific). Viral supernatants were collected at 48 h after transfection, and viral particles were concentrated by ultracentrifugation at 50,000 g for 1.5 h at 4°C. To establish stable cell lines expressing MYC-AS1 or EGFP, HCT116 cells were transfected with lentivirus infection for 72 h, and stable transduced clones were generated following selection with 2 µg/mL puromycin for 1 to 2 weeks.

Tumor models

To assess the ability of MYC-AS1 to inhibit cell proliferation, stably expressed MYC-AS1 or EGFP HCT116 cells (8×10⁶) were inoculated s.c. into nude mice. At 3, 7, 9, 11 and 14 days after inoculation, tumor sizes were measured unblinded with a caliper for calculating tumor volumes using the equation (a²×b)/2 (a, width; b, length). All procedures were approved by the Animal Ethics Committee of the Chinese PLA General Hospital.

RACE and cloning of full-length MYC-AS1

The 5′ and 3′ rapid amplification of cDNA ends (RACE) was performed using the SMARTer® RACE 5′/3′ Kit (Takara, Clontech Laboratories, 634860) following the manufacturer’s instructions. Briefly, total RNA (the genomic DNA was removed) was converted into RACE-Ready first-strand cDNA using the 5′ or 3′ CDS Primer A, provided by the kit. Next, the 5′ RACE PCRs were conducted with the 5′ gene-specific primers CCACAGCAAACCTCCTCACAGCCCACT and Universal Primer (provided by the kit) to generate the 5′ cDNA fragments. The 3′ RACE PCRs were conducted by Universal Primer and first-round 3′ gene-specific primer: GTGTTCGCCTCTTGACATTCTCCTCGGTGT and then by Universal Primer and second-round 3′ gene-specific primer: AGTGGGCTGTGAGGAGGTTTGCTGTGG. The 5′ and 3′ RACE products were further characterized by 1.5% agarose gel electrophoresis and sequenced by TA cloning. After reaching the 5′ and 3′ cDNA ends, the full-length MYC-AS1 transcripts were amplified using the following primers: forward 5′-GCCTTTTCATTGTTTTCCA-3′ and reverse 5′-CCTTTTTTAAGACGGAGTC-3′ and subsequently cloned into the TA cloning vector for sequencing.

Northern blot

Northern blotting assays were performed with the DIG Northern Starter Kit (cat#12039672910, Roche) according to the manufacturer’s instructions. In brief, the full-length DNA template of MYC-AS1 was first prepared by PCR amplification with the following primers: forward 5′-GCCTCTTGACATTCTCCTC-3′ and reverse 5′-TAATACGACTCACTATAGGGCGCAATCAACCTCCAACC-3′. A digoxigenin (DIG)-labeled RNA probe was then prepared using in vitro transcription with the T7 polymerase. Next, total RNA was separated by 2% formaldehyde gel electrophoresis at 50 V for 6 h and then transferred to positively charged nylon membranes (11209299001, Roche) by capillary transfer with 20 × SSC overnight. After RNA fixation by baking at 80°C for 2 h, blots were hybridized with denatured DIG-labeled RNA probe overnight at 68°C. Finally, blots were incubated with anti-digoxigenin-AP antibody (Sigma-Aldrich Cat# 11093274910, RRID:AB_2734716) for 30 minutes at room temperature and developed using the ready-to-use chemiluminescence substrate CDP-Star on the FluorChem Q imaging system (Protein Simple).

Coding potential analysis of MYC-AS1 antisense RNA

Full-length MYC-AS1 was cloned into the eukaryotic expression vector pcDNA3.1 with the N-terminal start codons ATG and HA tag in all three coding possibilities, and the plasmid was subsequently transfected into HEK293T cells. P53 was cloned into the pcDNA3.1 vector and used as a positive control. After 48 h, immunoblotting was used to detect the HA tag. The primers used can be found in Table 1. Data are representative of three independent experiments.

Table 1

Primers used in this study.
Gene product	Primer sequence
c-MYC	RT primer: AAGTTCATAGGTGATTGCTCAGGACAT
	Forward primer: AGCCACAGCATACATCCT
	Reverse primer: CGCACAAGAGTTCCGTAG
MYC-AS1	RT primer: GAGACCTTTCTAACGTATTCATGCCTTGT
	Forward primer: TTCCTCATCTTCTTGTTCCT
	Reverse primer: CTAACGTATTCATGCCTTGT
GAPDH	RT primer: TGATCTTGAGGCTGTTGTCATACTTCT
	Forward primer: AAGGTGAAGGTCGGAGTCAA
	Reverse primer: GGAAGATGGTGATGGGATTT
LDHA	Forward primer: ATGGCAACTCTAAAGGATCAGC
	Reverse primer: CCAACCCCAACAACTGTAATCT
c-MYC sense	RT primer: GATTGCTCAGGACATTTC
	Forward primer: CACATCAGCACAACTACG
	Reverse primer: CTCAAGACTCAGCCAAGG
	Forward primer for q-PCR: AGCCACAGCATACATCCT
	Reverse primer for q-PCR: CGCACAAGAGTTCCGTAG
c-MYC antisense	RT primer: GAGGAGAATGTCAAGAGG
	Forward primer: CACATCAGCACAACTACG
	Reverse primer: CTCAAGACTCAGCCAAGG
	Forward primer for q-PCR: AGCCACAGCATACATCCT
	Reverse primer for q-PCR: CGCACAAGAGTTCCGTAG
NRAS sense	RT primer: GCTTTCCTTCAATGGTAGA
	Forward primer: TGAGACATCTATTCCACTGA
	Reverse primer: TGTTATCGGCTCTATTCTCT
	Forward primer for q-PCR: TGAGACATCTATTCCACTGA
	Reverse primer for q-PCR: TGTTATCGGCTCTATTCTCT
NRAS antisense	RT primer: GAATAACTACCTCCTCAC
	Forward primer: TGAGACATCTATTCCACTGA
	Reverse primer: TGTTATCGGCTCTATTCTCT
	Forward primer for q-PCR: TGAGACATCTATTCCACTGA
	Reverse primer for q-PCR: TGTTATCGGCTCTATTCTCT
JUN sense	RT primer: GTCAAGTTCTCAAGTCTG
	Forward primer: CATCGTCATAGAAGGTCG
	Reverse primer: GGAGACAAGTGGCAGAGT
	Forward primer for q-PCR: ATCAAGGCGGAGAGGAAG
	Reverse primer for q-PCR: CACCTGTTCCCTGAGCAT
JUN antisense	RT primer: TCACCTTCTCTCTAACTG
	Forward primer: CATCGTCATAGAAGGTCG
	Reverse primer: GGAGACAAGTGGCAGAGT
	Forward primer for q-PCR: CCGCACTCTTACTTGTCG
	Reverse primer for q-PCR: CTGCTCTGGGAAGTGAGT
ETS1 sense	RT primer: AGCACTCATCGTCTGTTG
	Forward primer: TGATGATGATGGCACAACT
	Reverse primer: CTGTACTTAGGCGGTGTT
	Forward primer for q-PCR: TGATGATGATGGCACAACT
	Reverse primer for q-PCR: CTGTACTTAGGCGGTGTT
ETS1 antisense	RT primer: GTCGTAATAGTAGCGTAG
	Forward primer: CTATCAGACGCTCCATCC
	Reverse primer: CCGCACATAGTCCTTGAA
	Forward primer for q-PCR: CCTCGGATTACTTCATTAGC
	Reverse primer for q-PCR: GGATGGAGCGTCTGATAG
JUNB sense	RT primer: CTTCACCTTGTCCTCCAG
	Forward primer: TCTACCACGACGACTCAT
	Reverse primer: CTGCTGAGGTTGGTGTAA
	Forward primer for q-PCR: CTACCACGACGACTCATAC
	Reverse primer for q-PCR: GACAATCAGGCGTTCCAG
JUNB antisense	RT primer: GAAATCATCCTCCTCCCT
	Forward primer: TCTACCACGACGACTCAT
	Reverse primer: CTGCTGAGGTTGGTGTAA
	Forward primer for q-PCR: CTACCACGACGACTCATAC
	Reverse primer for q-PCR: GACAATCAGGCGTTCCAG
FOS sense	RT primer: GAACATTCAGACCACCTC
	Forward primer: CCTTCGTCTTCACCTACC
	Reverse primer: CTATTGCCAGGAACACAG
	Forward primer for q-PCR: GACCTTATCTGTGCGTGA
	Reverse primer for q-PCR: CCTGGCTCAACATGCTAC
FOS antisense	RT primer: AGTGGAACCTGTCAAGAG
	Forward primer: CCTTCGTCTTCACCTACC
	Reverse primer: CTATTGCCAGGAACACAG
	Forward primer for q-PCR: GACCTTATCTGTGCGTGA
	Reverse primer for q-PCR: CCTGGCTCAACATGCTAC
BRAF sense	RT primer: GGTCTCTAATCAAGTCATC
	Forward primer: CCGTTACATCTTCTTCCTCT
	Reverse primer: CCTCTTCCTGTGGTATTGG
	Forward primer for q-PCR: CAGTGCTACCTTCATCTCTT
	Reverse primer for q-PCR: CCTCTCATCATCAGTGCTT
BRAF antisense	RT primer: GTTGGACTATGGCTTTGT
	Forward primer: CACCACAACCTTCACCTC
	Reverse primer: TGTCCAAAGAGCAGTTACC
	Forward primer for q-PCR: TCCCAAAGTGCTGAGATTAC
	Reverse primer for q-PCR: CTGAGTGCTGTCCAAAGAG
SET sense	RT primer: CAAGTCATCATTAGGAGAG
	Forward primer: TGCTTACTATGACCTTCC
	Reverse primer: TGCTCACCATCAGACTTC
	Forward primer for q-PCR: TTCCCTCTTGTGCTCAGT
	Reverse primer for q-PCR: CTCGGTGGTGTTGATTCC
SET antisense	RT primer: CCTAATGATGACTTGAGC
	Forward primer: TGCTTACTATGACCTTCC
	Reverse primer: TGCTCACCATCAGACTTC
	Forward primer for q-PCR: CACCACCATCCAACAGAC
	Reverse primer for q-PCR: TGCTCACCATCAGACTTC
MYC-AS	aagcttatggcctacccctacgacgtgcccgactacgccGCCTTTTCATTGTTTTCCA
	aagcttatggcctacccctacgacgtgcccgactacgccTGCCTTTTCATTGTTTTCCA
	aagcttatggcctacccctacgacgtgcccgactacgccTTGCCTTTTCATTGTTTTCCA
	tctagaCCTTTTTTAAGACGGAGTC

Flow cytometry assay

Apoptosis was performed using the Annexin V Apoptosis Detection kit according to the manufacturer’s recommendations (BD Bioscience, Franklin). FlowJo software (RRID:SCR_008520) was used for data analysis and graphic rendering.

Colony formation assay

HCT116 cells stably expressing MYC-AS1 or EGFP were seeded at 400 cells per well in 6-well culture plates in triplicate. After 12 days, cells were fixed with 75% ethanol for 30 min and stained with 0.2% crystal violet. The number of clones was then counted. Each experiment was repeated three times.

Cell viability assay

HCT116 cells stably expressing MYC-AS1 or EGFP were plated into 96-well plates at a density of 2.5 ×10³ cells per well, and cell viability was measured by the methyl thiazolyl tetrazolium (MTT) assay (KeyGEN Biotech, Nanjing, China) at 0, 24, 48, 72, 96 and 120 h. Absorbance was measured on a microplate reader (Thermo Multiskan MK3 [Thermo Fisher Scientific, Danvers, MA, USA]) at a wavelength of 490 nm.

DNA demethylation treatment

HCT116, HepG2, KYSE150 and BGC-823 cells were plated on 6-well plates and treated with 0, 1 or 5 µM 5-aza-2’-deoxycytidine (Aza, Sigma-Aldrich) for 48 h. The dose of Aza was selected based on preliminary studies as well as previously published studies (13, 14). Cells were harvested after Aza treatment for RNA analysis, protein analysis and DNA methylation analysis.

Actinomycin D treatment

HCT116 cells were plated on 6-well plates and transfected with 5 µg of pcDNA3.1-HuR or pcDNA3.1-EGFPplasmids using Xfect™ Transfection Reagent (631318, Takara). After 72 hours, cells were treated with 1 µg/mL Actinomycin D (A4262, Sigma) and harvested at 1, 2, 4 and 8 h after Actinomycin D treatment for RNA analysis.

RNA isolation and reverse transcription

Total RNA was extracted using TRIzol® Reagent (Life Technologies™, 15596-026) according to the manufacturer’s instructions. Briefly, growth media was removed from the culture dish, and 1 mL TRIzol® Reagent was added to each dish. After incubation for 5 minutes at room temperature, 0.2 mL of chloroform per 1 mL of TRIzol was added, and the samples were incubated for 3 minutes at room temperature and centrifuged at 12,000 × g for 15 minutes at 4°C. The aqueous phase was removed for RNA isolation. After RNA precipitation by 100% isopropanol and RNA was washed with 75% ethanol, and the RNA pellet was resuspended in RNase-free water. The concentrations of RNA yield were measured by a spectrophotometer.

Reverse transcription was performed with PrimeScript™ RT reagent Kit with gDNA Eraser (cat#RR047B, Takara) following the manufacturer’s instructions. For strand-specific reverse transcription, the gDNA Eraser-treated RNA samples were reverse-transcribed with gene-specific primers (GSP, Table 1) at 42°C for 15 minutes with PrimeScript® Reverse Transcriptase.

Quantitative PCR

Quantitative PCR (qPCR) was performed using SYBR Green Master Mix (cat# RR820B, Takara) on the CFX Connect™ Real-Time PCR Detection System (Bio-Rad). GAPDH RNA levels were used as internal control to normalize gene expression. The primers used can be found in Table 1.

DNA extraction and bisulfite treatment

The DNeasy Blood and Tissue Kit (QIAGEN, Germany) was used to extract genomic DNA from cells or tissue samples according to the manufacturer’s instructions. The EpiTect Fast DNA Bisulfite Kit (QIAGEN, Germany) was used and 1 µg genomic DNA was used for bisulfate conversion according to the manufacturer’s instructions.

DNA methylation pyrosequencing analysis

The forward and reverse primers used in PCR and the sequencing primers used in the pyrosequencing methylation assays were designed with PyroMark Assay Design 2.0 (QIAGEN, Germany; see Table 1). A pyrosequencing methylation analysis was conducted using the PyroMark Q24 system (QIAGEN, Germany) according to the manufacturer’s recommended protocol. Briefly, a volume of 5 ~ 20 µl of the PCR product was used for each pyrosequencing reaction based on the concentration of the PCR product and immobilized to streptavidin-coated Sepharose beads (QIAGEN, Germany). After the immobilized, PCR product was purified, denatured and washed with the PyroMark Q24 Workstation (QIAGEN, Germany). DNA strands were separated and released into a PyroMark Q24 Plate (QIAGEN, Germany). The sequencing primers were then annealed to DNA strands. The DNA methylation level was analyzed using PyroMark Q24 Advanced Software (QIAGEN, Germany). Non-CpG cytosine residues were used as controls to verify bisulfite conversion.

Protein extraction and immunoblotting

Whole-cell lysates were prepared with Cell Lysis Buffer (10x) (Cell Signaling Technologies, 9803) and resuspended in 4x Laemmli Sample Buffer (Bio-Rad, 161–0747) supplemented with 5% 2-mercaptoethanol. Total protein was separated by 12% SDS-PAGE at 120 V for 90 min and then transferred to polyvinylidene difluoride membranes at 50 V for 150 min. Membranes were blocked in TBS-T containing 5% nonfat dry milk (BIO-RAD). Primary antibodies were incubated overnight at 4°C with agitation. The following antibodies were used to determine protein expression: mouse anti-c-MYC (Santa Cruz Biotechnology Cat# sc-40 AC, RRID:AB_2857941), mouse anti-GAPDH (Santa Cruz Biotechnology Cat# sc-166574, RRID:AB_2107296), mouse anti-HA (Santa Cruz Biotechnology Cat# sc-7392 HRP, RRID:AB_2894930), rabbit anti-HuR (Abcam Cat# ab200342, RRID:AB_2784506) and rabbit anti-Dicer (ab227518, Abcam, 1:1,000). After washing extensively with TBST, secondary antibodies (anti-rabbit or anti-mouse horseradish peroxidase (HRP) conjugate, 1:10,000 dilution) were incubated for 1 h at room temperature. After washing extensively with TBST, blots were developed using enhanced chemiluminescent (ECL) detection reagents on the FluorChem Q imaging system (Protein Simple).

Immunofluorescence microscopy

Cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature, permeabilized with 0.25% Triton X-100 for 5 min, and blocked with 2% BSA for 30 min. Cells were then incubated with rabbit anti-HuR primary antibody (ab200342, Abcam, 1:200) at room temperature for 1 h, followed by incubation with goat anti-rabbit IgG conjugated with Alexa Fluor 488 dye (Abcam Cat# ab150081, RRID: AB_2734747) at room temperature for 45 min. After five washes in PBS-T (PBS with 0.05% Tween), cells were stained with DAPI dye (Sigma, Shanghai, China) at room temperature for 10 min. Images were acquired using a Leica TCS SP8 confocal microscope, and data analysis was carried out with Leica LAS AF Lite (Leica Microsystems).

RNA fluorescence in situ hybridization

RNA fluorescence in situ hybridization (FISH) was performed according to the manufacturer’s recommendations (RIBOBIO, Guang Zhou). We routinely ordered sets of fluorescent FISH probe mixes for MYC-AS1 from commercial sources (RIBOBIO). To achieve a sufficient signal-to-background ratio, multiple probes were targeted along each individual lncRNA sequence. A set of 15–20 probes that cover the entire length of the RNA molecule provided an optimal signal strength, and each probe carried multiple fluorophores. The pooled FISH probes were resuspended to a final concentration of 25 µM in RNase-free storage buffer and protected from light at -20°C. Cells were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 20 min at room temperature, permeabilized with 0.25% Triton X-100 for 5 min, and blocked with 2% BSA for 30 min. Cells were then incubated overnight with the MYC-AS1 probe mix at 37°C. For colocalization studies, after RNA-FISH, cells were subjected to immunofluorescence. The pictures were captured with a Leica SP8 confocal microscope (X100) and merged.

RNA pull-down

RNA synthesis in vitro transcription was performed using the T7 High Yield RNA Synthesis Kit (New England Biolabs, E2040S), and RNA purification was performed by a Monarch® RNA Cleanup Kit (New England Biolabs, T2040). The 3’ terminus of an RNA strand was then biotinylated by the Pierce™ RNA 3' End Desthiobiotinylation Kit (20163, Thermo Scientific). The whole-cell lysate from HCT116 cells was harvested and resuspended in Pierce™ IP Lysis Buffer (87787, Thermo Scientific) containing RNase and protease inhibitors.

RNA pull-down experiments were performed using the Pierce™ Magnetic RNA-Protein Pull-Down Kit (20164, Thermo Scientific). Briefly, biotinylated RNA (50 pmol) was added to 50 µL of prewashed Pierce Nucleic-Acid Compatible Streptavidin Magnetic Beads and incubated for 30 minutes at room temperature with agitation. Next, the beads were mixed with 200 µg of the whole-cell lysate and incubated for 60 minutes at 4°C with rotation. The beads were washed three times with wash buffer and then incubated for 30 minutes at 37°C with elution buffer. The eluted protein samples were separated on a 12% SDS-PAGE gel and stained with a Fast Silver Stain Kit (P0017S, Beyotime) according to the manufacturer’s instructions. Protein in gel slices was digested with trypsin and identified using nano-high-performance liquid chromatography mass spectrometry (Nano-HPLC-MS) in the Proteome Research Center of Fudan University.

RNA-Binding Protein Immunoprecipitation (RIP)

The whole-cell lysate from HCT116 cells was harvested and resuspended in Pierce™ IP Lysis Buffer (87787, Thermo Scientific) containing RNase and protease inhibitors. A total of 10 mg protein lysate was combined with 10 µg HuR antibody (Abcam Cat# ab200342, RRID:AB_2784506) or rabbit IgG (Abcam Cat# ab172730, RRID:AB_2687931) in 500 µL ice-cold RIP buffer and incubated overnight at 4°C with rotation. Next, the protein sample/antibody mixture was added to a 1.5 mL microcentrifuge tube containing 50 µL prewashed Pierce Protein A/G Magnetic Beads and incubated for 1 hour at 4°C with gentle rotation. After washing, the beads were resuspended in 1 mL TRIzol RNA extraction reagent, and then the coprecipitated RNA was isolated according to the manufacturer’s instructions. Strand-specific RT-qPCR was performed to detect MYC-AS1 in the precipitates.

Statistical analyses

Statistical analysis was performed with either Statistical Package for the Social Sciences (RRID:SCR_002865) software. Statistical significance was assessed using a two-tailed unpaired Student’s t-test with a threshold of the p-values < 0.05.

Ethics approval

All animal research were conducted in accordance with the ARRIVE guidelines(Animal Research: Reporting of In Vivo Experiments)and were approved by the Committee on the Ethics of Animal Experiments of Yangzhou University (licence number: 2021BW071.).A formal informed consent form has been signed by all participants or their legal representatives.Te Ethics Committee of the Chinese PLA General Hospital approved the study protocol and the informed consent following the Helsinki Declaration’s ethical principles.

A set of proto-oncogenes possess antisense RNAs

To screen antisense RNAs of the proto-oncogenes, we first established sense–antisense transcript libraries from gastrointestinal cancer cell lines (KYSE50, BGC823, HCT116 and HepG2) with or without 5-Aza-CdR treatment (Fig. 1A). 5-Aza-CdR treatment may facilitate potentially methylated genes to express. After high-throughput next-generation sequencing, we identified 55 eminent proto-oncogenes containing sense–antisense pairs in the region of 3’-UTRs, exon, introns or promoters, including c-MYC, JUN, FOS, and NRAS, JUNB and SET (Fig. 1B and C). To confirm the existence of naturally occurring proto-oncogenes antisense RNAs, we performed RT-PCR with strand-specific primers and antisense transcripts for these proto-oncogenes were identified in the HepG2 cell line by PCR sequencing (Fig. 1D). These results indicate that a set of proto-oncogenes possess antisense RNAs in human cells.

Identification of antisense RNA MYC-AS1 from proto-oncogene c-MYC

Based on the above results, we focused further study on the well-known oncogene c-MYC because it is frequently associated with tumorigenesis in many types of human cancers. By 5′ and 3′ rapid amplification of cDNA ends (RACE) analysis, we identified the c-MYC antisense RNA, named MYC-AS1, which is 826 bp in length (Fig. 2A-C). This result was further validated by strand-specific RT-PCR and Northern blot analyses (Fig. 2D and E). Additionally, we confirmed by in vitro translation analysis that MYC-AS1 has a poly(A) tail but does not have coding capacity (Fig. 2F), indicating that it is a long noncoding RNA (lncRNA).

MYC-AS1 inhibits cell proliferation and tumor growth

To further investigate the role of MYC-AS1 in tumorigenesis, we transfected the cells with a lentiviral expression vector containing the MYC-AS1 gene. Overexpression of MYC-AS1 significantly restrained proliferation and induced apoptosis in HCT116 cells (Fig. 3A and 3B). In addition, a colony formation assay was performed to determine whether the MYC-AS1 lncRNA affects clonogenic potential. Overexpression of the MYC-AS1 lncRNA significantly decreased the number of colonies in HCT116 cells (Fig. 3C). More importantly, transfection of MYC-AS1 also significantly reduced colorectal cancer cell growth and tumor weight (Fig. 3D and E) in mouse xenograft models in vivo, suggesting that the MYC-AS1 lncRNA plays an antitumor role. Together, these data strongly suggested that MYC-AS1 lncRNA functions as a tumor suppressor to inhibit cancer proliferation.

MYC-AS1 binds to HuR protein to enhance RNA stability

To further elucidate the mechanistic role of MYC-AS1 RNA in carcinogenesis, we performed a pulldown assay with biotinylated MYC-AS1 RNA in combination with mass spectrometry (MS) to search for potential MYC-AS1 RNA-interacting proteins. Human antigen R (HuR, also called ELAV-like protein 1), a regulator of mRNA stability of the c-MYC proto-oncogene, was identified (15, 16). Western blot analysis validated that HuR also specifically binds to MYC-AS1 RNA (Fig. 4A). Truncated RNA pulldown assays and bioinformatic analysis indicated that the 3′ fragment of MYC-AS1 RNA contains an AU-rich element (ARE) (AUUA), which is a core element for binding with HuR (Fig. 4B-D). RNA-binding protein immunoprecipitation assay (RIP) further verified the specificity of this interaction (Fig. 4E). Moreover, RNA FISH results confirmed that MYC-AS1 RNA is colocalized with HuR in the cytoplasm but not in the nucleus of HCT116 and BGC-823 cells (Fig. 4F and G).

MYC-AS1 lncRNA modulates c-MYC expression

Next, we analyzed the effect of MYC-AS1 lncRNA on the expression of proto-oncogene c-MYC. We found that overexpression of MYC-AS1 significantly inhibited the expression of c-MYC mRNA and protein in HCT116 cells (Fig. 5A-C). Inversely, knockdown of MYC-AS1 significantly increased the expression of c-MYC in both HCT116 and HEK293 cells (Fig. 5D and E). To verify the molecular mechanism by which the oncogene c-MYC is regulated by the antisense MYC-AS1 lncRNA, the DICER gene was knocked down by RNAi. Reduced DICER can abolish the inhibitory effect of MYC-AS1 lncRNA on c-MYC (Fig. 5F), indicating that MYC-AS1 lncRNA inhibits the expression of c-MYC through an RNAi mechanism. Furthermore, the inhibitory effect of MYC-AS1 lncRNA on c-MYC expression was weakened when HuR was disturbed (Fig. 5G). We further confirmed that HuR enhanced the stability of MYC-AS1 RNA (Fig. 5H). These results together indicate that MYC-AS1 lncRNA can bind HuR protein to enhance the stability of MYC-AS1 lncRNA, which is beneficial for inhibiting c-MYC expression.

MYC-AS1 lncRNA inhibits expression of c-MYC-targeted gene LDHA

To further address whether MYC-AS1 RNA modulates the c-MYC-targeted gene LDHA, we performed ChIP coupled with qPCR (ChIP-qPCR) for c-MYC in HCT116 cells. The binding of c-MYC to the LDHA gene was verified in HCT116 cells (Fig. 6A). Moreover, the binding of c-MYC to the LDHA gene was increased by MYC-AS1 knockdown (Fig. 6B) but reduced by overexpression of MYC-AS1 (Fig. 6C). Both RT–qPCR and Western blot data further showed that LDHA expression was significantly increased in HCT116 cells transfected with MYC-AS1 siRNAs (Fig. 6D). However, overexpression of MYC-AS1 significantly reduced the expression of the LDHA gene in HCT116 cells (Fig. 6E). These results together indicate that MYC-AS1 lncRNA may negatively regulate LDHA transcription via c-MYC in colorectal cancer cells. Interestingly, the samples with lower MYC-AS1 expression displayed strong expression of c-MYC and LDHA (Fig. 6F), while samples with high MYC-AS1 expression showed low levels of c-MYC and LDHA (Fig. 6F). These data indicate that MYC-AS1 expression is negatively correlated with c-MYC and LDHA expression in CRC tissues.

Epigenetic silencing of MYC-AS1 contributes to c-MYC activation

We then found that the expression of MYC-AS1 was inversely correlated with its DNA methylation in clinical colon cancer tissues and cell lines by bisulfite-PCR-pyrosequencing and RT-qPCR analyses. The MYC-AS1 gene was hypermethylated in cancer tissues but hypomethylated in matched normal tissues (Fig. 7A). Correspondingly, MYC-AS1 expression was much lower in cancer tissues than in matched normal tissues, while the expression of the oncogene c-MYC shows the opposite trend with higher expression in tumor tissues than in the matched normal tissues (Fig. 7B). When the HCT116 cells were treated with 5-Aza-CdR, the expression of MYC-AS1 was significantly induced, but the expression of the c-MYC gene was inhibited at both the mRNA and protein levels (Fig. 7C-E). These results demonstrate that demethylation of the MYC-AS1 gene can restore the expression of the MYC-AS1 antisense lncRNA, which further represses c-MYC expression. These results indicate that the high-level expression or activation of the oncogene is attributed to epigenetic silencing of their counterpart antisense RNA by DNA hypermethylation and that DNA methylation inhibitor can restore antisense RNA transcription, which further represses oncogene expression.

Our findings demonstrate that epigenetic silencing of antisense RNAs results in derepression or activation of proto-oncogenes. The activation of antisense RNAs may be an effective and safe strategy to inhibit the expression of proto-oncogenes. In particular, we discover that a set of proto-oncogenes possess antisense RNAs and that widespread activation of oncogenes may be attributed to epigenetic silencing of their counterpart antisense lncRNAs in multiple types of cancers. This finding enriches the understanding of epigenetic mechanisms underlying oncogene activation in tumorigenesis.

Most importantly, the present study demonstrates a new anticancer mechanism of the DNA methylation inhibitor. There has been an ongoing and endless debate about the molecular mechanisms underlying the clinical efficacy of the DNA methylation inhibitors in the treatment of cancers and whether this efficacy is a direct consequence of its effect on global demethylation (5). A recognized antitumor mechanism of 5-Aza-CdR is the reactivation of aberrantly methylated TSGs by demethylation (17). Consistent with this observation, many TSG promoters are hypermethylated in cancer cells (18). Another mechanism is that 5-Aza-CdR activates anticancer innate immunity through transcriptional activation of endogenous retroviral sequences (19–21). The present study provides a novel mechanism by which 5-Aza-CdR impedes rather than promotes the expression of proto-oncogenes via epigenetic activation of antisense RNAs.

Our study verifies this phenomenon by focusing on the proto-oncogene c-MYC. c-MYC contributes to initiate and maintain tumorigenesis in many human cancers and regulates the antitumor immune response through CD47 and PD-L1 (6), providing new insights into immunotherapies and epigenetic therapies (6–9). Although previous studies have reported that the MYC gene can be transcribed bidirectionally in humans, mice, rodents and bovines (22–25), we identified MYC-AS1 as a novel antisense noncoding RNA that is completely different from those previously reported (26). MYC-AS1 lncRNA functions as an anticancer molecule mainly through inhibition of the sense c-MYC gene via the RNAi pathway. Additionally, MYC-AS1 lncRNA strengthens its antitumor function by binding to HuR to enhance itself stability. The HuR protein contains several RNA recognition motifs and selectively binds the ARE motif, which is a well-studied signal present in the 3′-UTRs of many clinically relevant mRNAs, including those of cytokines, oncogenes and growth factors (27). The 3′ fragment of MYC-AS1 RNA contains an ARE motif (i.e., AUUA), which is a core element for binding with HuR. The stability of MYC-AS1 lncRNA is enhanced by binding to HuR, and thus is beneficial for the inhibition of c-MYC expression through the RNAi mechanism. In addition, HuR is involved in 3'-UTR ARE-mediated c-MYC mRNA stabilization (15, 16) and regulates the expression of c-MYC (28, 29). MYC-AS1 lncRNA may negatively regulate c-MYC by competitively inhibiting the binding of HuR to the 3'-UTR of the c-MYC mRNA.

In summary, we find that epigenetic silencing of the MYC-AS1antisense lncRNA directly contributes to activation or upregulation of the sense c-MYC gene. MYC-AS1 lncRNA clearly functions as a tumor suppressor that strictly controls c-MYC expression. Once this suppressor becomes defective due to events such as epigenetic silencing, the c-MYC oncogene is abnormally activated. These results reveal a novel mechanism of tumorigenesis by which oncogenes are activated by epigenetic silencing of their counterpart antisense lncRNAs (the working model is shown in Fig. 8). Further investigation remains to determine whether antisense RNAs for other proto-oncogene perform their functions in a similar manner. MYC-AS1, a specific regulator of tumorigenesis, may facilitate the design and development of new anticancer drugs.

Conflict of interest

The authors declare that they have no competing interests.

Data availability

Raw data are available from the corresponding author upon request.

Acknowledgments

This work was supported by grants from National Natural Science Foundation of China grant (81773013), National Key Research and Development Program of China grant (2016YFC1303604, 2018YFA0208902), National Natural Science Foundation of China (U1604281), Priority Academic Program Development of Jiangsu Higher Education Institutions (Animal Science and Veterinary Medicine).

Author contributions

X. H Conceptualization, Methodology, Formal analysis, Investigation, Writing - Original Draft; Y. W and M. Z Conceptualization, Methodology, Formal analysis, Investigation; C. D Methodology, Formal analysis, Investigation; L. W, G. Z, H. W and W. G Validation; X. W, S. C and Q. X Data Curation; M. G and H. C Writing - Review & Editing, Supervision, Project administration, Funding acquisition.

Conflict of interest

The authors declare that they have no conflicts of interest with the contents of this article.

Feinberg, A. P., Ohlsson, R., and Henikoff, S. (2006) The epigenetic progenitor origin of human cancer. Nat Rev Genet 7, 21–33
Mohammad, H. P., Barbash, O., and Creasy, C. L. (2019) Targeting epigenetic modifications in cancer therapy: erasing the roadmap to cancer. Nat Med 25, 403–418
E. Kaminskas, A. Farrell, S. Abraham, A. Baird, L. S. Hsieh, S. L. Lee, J. K. Leighton, H. Patel, A. Rahman, R. Sridhara, Y. C. Wang, and R. Pazdur. (2005) FDA, Approval summary: azacitidine for treatment of myelodysplastic syndrome subtypes. Clin. Cancer Res. 11, 3604–3608
Yang, X., Han, H., De Carvalho, D. D., Lay, F. D., Jones, P. A., and Liang, G. (2014) Gene body methylation can alter gene expression and is a therapeutic target in cancer. Cancer Cell 26, 577–590
Issa, J. P., and Kantarjian, H. M. (2009) Targeting DNA methylation. Clin Cancer Res 15, 3938–3946
Casey, S. C., Tong, L., Li, Y., Do, R., Walz, S., Fitzgerald, K. N., Gouw, A. M., Baylot, V., Gutgemann, I., Eilers, M., and Felsher, D. W. (2016) MYC regulates the antitumor immune response through CD47 and PD-L1. Science 352, 227–231
Dang, C. V. (2012) MYC on the path to cancer. Cell 149, 22–35
Stine, Z. E., Walton, Z. E., Altman, B. J., Hsieh, A. L., and Dang, C. V. (2015) MYC, Metabolism, and Cancer. Cancer Discov 5, 1024–1039
Topper, M. J., Vaz, M., Marrone, K. A., Brahmer, J. R., and Baylin, S. B. (2020) The emerging role of epigenetic therapeutics in immuno-oncology. Nat Rev Clin Oncol 17, 75–90
Topper, M. J., Vaz, M., Chiappinelli, K. B., DeStefano Shields, C. E., Niknafs, N., Yen, R. C., Wenzel, A., Hicks, J., Ballew, M., Stone, M., Tran, P. T., Zahnow, C. A., Hellmann, M. D., Anagnostou, V., Strissel, P. L., Strick, R., Velculescu, V. E., and Baylin, S. B. (2017) Epigenetic Therapy Ties MYC Depletion to Reversing Immune Evasion and Treating Lung Cancer. Cell 171, 1284–1300 e1221
Yu, W., Gius, D., Onyango, P., Muldoon-Jacobs, K., Karp, J., Feinberg, A. P., and Cui, H. (2008) Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature 451, 202–206
Morris, K. V., Santoso, S., Turner, A. M., Pastori, C., and Hawkins, P. G. (2008) Bidirectional transcription directs both transcriptional gene activation and suppression in human cells. PLoS Genet. 4, e1000258
Cameron, E. E., Bachman, K. E., Myohanen, S., Herman, J. G., and Baylin, S. B. (1999) Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nature genetics 21, 103–107
Perez-Mancera, P. A., Rust, A. G., van der Weyden, L., Kristiansen, G., Li, A., Sarver, A. L., Silverstein, K. A., Grutzmann, R., Aust, D., Rummele, P., Knosel, T., Herd, C., Stemple, D. L., Kettleborough, R., Brosnan, J. A., Li, A., Morgan, R., Knight, S., Yu, J., Stegeman, S., Collier, L. S., ten Hoeve, J. J., de Ridder, J., Klein, A. P., Goggins, M., Hruban, R. H., Chang, D. K., Biankin, A. V., Grimmond, S. M., Australian Pancreatic Cancer Genome, I., Wessels, L. F., Wood, S. A., Iacobuzio-Donahue, C. A., Pilarsky, C., Largaespada, D. A., Adams, D. J., and Tuveson, D. A. (2012) The deubiquitinase USP9X suppresses pancreatic ductal adenocarcinoma. Nature 486, 266–270
Lafon, I., Carballes, F., Brewer, G., Poiret, M., and Morello, D. (1998) Developmental expression of AUF1 and HuR, two c-myc mRNA binding proteins. Oncogene 16, 3413–3421
Ma, W. J., Chung, S., and Furneaux, H. (1997) The Elav-like proteins bind to AU-rich elements and to the poly(A) tail of mRNA. Nucleic Acids Res 25, 3564–3569
Navada, S. C., Steinmann, J., Lubbert, M., and Silverman, L. R. (2014) Clinical development of demethylating agents in hematology. J Clin Invest 124, 40–46
De Carvalho, D. D., Sharma, S., You, J. S., Su, S. F., Taberlay, P. C., Kelly, T. K., Yang, X., Liang, G., and Jones, P. A. (2012) DNA methylation screening identifies driver epigenetic events of cancer cell survival. Cancer Cell 21, 655–667
Chiappinelli, K. B., Strissel, P. L., Desrichard, A., Li, H., Henke, C., Akman, B., Hein, A., Rote, N. S., Cope, L. M., Snyder, A., Makarov, V., Budhu, S., Slamon, D. J., Wolchok, J. D., Pardoll, D. M., Beckmann, M. W., Zahnow, C. A., Merghoub, T., Chan, T. A., Baylin, S. B., and Strick, R. (2015) Inhibiting DNA Methylation Causes an Interferon Response in Cancer via dsRNA Including Endogenous Retroviruses. Cell 162, 974–986
Licht, J. D. (2015) DNA Methylation Inhibitors in Cancer Therapy: The Immunity Dimension. Cell 162, 938–939
Roulois, D., Loo Yau, H., Singhania, R., Wang, Y., Danesh, A., Shen, S. Y., Han, H., Liang, G., Jones, P. A., Pugh, T. J., O'Brien, C., and De Carvalho, D. D. (2015) DNA-Demethylating Agents Target Colorectal Cancer Cells by Inducing Viral Mimicry by Endogenous Transcripts. Cell 162, 961–973
Bentley, D. L., and Groudine, M. (1986) A block to elongation is largely responsible for decreased transcription of c-myc in differentiated HL60 cells. Nature 321, 702–706
Dean, M., Kent, R. B., and Sonenshein, G. E. (1983) Transcriptional activation of immunoglobulin alpha heavy-chain genes by translocation of the c-myc oncogene. Nature 305, 443–446
Kindy, M. S., McCormack, J. E., Buckler, A. J., Levine, R. A., and Sonenshein, G. E. (1987) Independent regulation of transcription of the two strands of the c-myc gene. Mol Cell Biol 7, 2857–2862
Spicer, D. B., and Sonenshein, G. E. (1992) An antisense promoter of the murine c-myc gene is localized within intron 2. Mol Cell Biol 12, 1324–1329
Napoli, S., Piccinelli, V., Mapelli, S. N., Pisignano, G., and Catapano, C. V. (2017) Natural antisense transcripts drive a regulatory cascade controlling c-MYC transcription. RNA Biol 14, 1742–1755
Vasudevan, S., and Steitz, J. A. (2007) AU-rich-element-mediated upregulation of translation by FXR1 and Argonaute 2. Cell 128, 1105–1118
Liu, L., Ouyang, M., Rao, J. N., Zou, T., Xiao, L., Chung, H. K., Wu, J., Donahue, J. M., Gorospe, M., and Wang, J. Y. (2015) Competition between RNA-binding proteins CELF1 and HuR modulates MYC translation and intestinal epithelium renewal. Mol Biol Cell 26, 1797–1810
Liu, L., Rao, J. N., Zou, T., Xiao, L., Wang, P. Y., Turner, D. J., Gorospe, M., and Wang, J. Y. (2009) Polyamines regulate c-Myc translation through Chk2-dependent HuR phosphorylation. Mol Biol Cell 20, 4885–4898

No competing interests reported.

Download PDF

Editorial decision: Revision requested
09 Oct, 2024
Reviews received at journal
04 Oct, 2024
Reviews received at journal
02 Oct, 2024
Reviewers agreed at journal
16 Sep, 2024
Reviewers agreed at journal
11 Sep, 2024
Reviewers invited by journal
21 Aug, 2024
Editor assigned by journal
21 Aug, 2024
Editor invited by journal
21 Aug, 2024
Submission checks completed at journal
17 Aug, 2024
First submitted to journal
14 Aug, 2024

You are reading this latest preprint version

A novel mechanism by which c-MYC is aberrantly activated by epigenetic silencing in cancer cells

Status:

Version 1

Abstract

Figures

Significance Statement

Introduction

Experimental procedures

Human tissue samples

Cell culture

Plasmid and constructs

Transfection

RNA Interference

Lentivirus packaging and transduction

Tumor models

RACE and cloning of full-length MYC-AS1

Northern blot

Coding potential analysis of MYC-AS1 antisense RNA

Flow cytometry assay

Colony formation assay

Cell viability assay

DNA demethylation treatment

Actinomycin D treatment

RNA isolation and reverse transcription

Quantitative PCR

DNA extraction and bisulfite treatment

DNA methylation pyrosequencing analysis

Protein extraction and immunoblotting

Immunofluorescence microscopy

RNA fluorescence in situ hybridization

RNA pull-down

RNA-Binding Protein Immunoprecipitation (RIP)

Statistical analyses

Ethics approval

Results

A set of proto-oncogenes possess antisense RNAs

MYC-AS1 inhibits cell proliferation and tumor growth

MYC-AS1 binds to HuR protein to enhance RNA stability

MYC-AS1 lncRNA inhibits expression of c-MYC-targeted gene LDHA

Discussion

Declarations

References

Additional Declarations

Status:

Version 1