Comparative analysis of bevacizumab and sorafenib on the survival of retinal ganglion cells in the treatment of retinal diseases

doi:10.21203/rs.3.rs-4925128/v1

Download PDF

Article

Comparative analysis of bevacizumab and sorafenib on the survival of retinal ganglion cells in the treatment of retinal diseases

https://doi.org/10.21203/rs.3.rs-4925128/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

This study investigates the effects of bevacizumab, a common vascular endothelial growth factor (VEGF) inhibitor, in treating ocular neovascular disorders, with a focus on its impact on retinal ganglion cell (RGC) survival. Given that bevacizumab has been associated with adverse effects on RGCs, we aimed to validate these reports, identify an alternative VEGF inhibitor with similar antiangiogenic efficacy but without detrimental effects on RGCs, and explore the underlying mechanisms. Using primary RGCs extracted from neonatal rats and human umbilical vascular endothelial cells (HUVECs), we compared the efficacy of bevacizumab with other VEGF inhibitors and assessed the apoptotic effects and cell survival pathways influenced by these treatments. Our results showed that while both sorafenib and bevacizumab exhibited potent VEGF-inhibitory effects in HUVECs, sorafenib led to significantly higher RGC survival rates compared to bevacizumab. Western blot analysis indicated that bevacizumab treatment resulted in lower Akt levels than sorafenib, and RNA sequencing revealed that the PI3K/AKT, Ras, and MAPK signaling pathways play crucial roles in RGC viability. These findings suggest that sorafenib may offer a safer and more effective alternative to bevacizumab for treating retinal diseases, with potential implications for the development of safer therapeutic approaches, particularly in conditions like glaucoma.

Health sciences/Diseases

Health sciences/Diseases/Eye diseases

Health sciences/Diseases/Eye diseases/Ocular hypertension

Health sciences/Diseases/Eye diseases/Optic nerve diseases

Health sciences/Diseases/Eye diseases/Retinal diseases

Retinal ganglion cell

vascular endothelial growth Factor

bevacizumab

sorafenib

glaucoma

Excessive expression of vascular endothelial growth factor (VEGF) contributes to several sight-threatening eye conditions, including age-related macular degeneration and diabetic retinopathy, both of which are leading causes of blindness.^1–6 Intravitreal VEGF-inhibitor injections have effectively managed these debilitating diseases.^6–8

In VEGF-inhibitor treatments, ophthalmologists have employed bevacizumab in an off-label capacity as an intravitreal agent for treating proliferative (neovascular) eye diseases.⁹ Administration of 1.25–2.5 mg bevacizumab into the vitreous cavity has long been a common practice.^9–11

However, the indiscriminate inhibition of VEGF throughout the retina, as typically achieved with VEGF-inhibitor therapy, may cause potential adverse effects.¹² Previous research has highlighted the multifaceted role of VEGF as a pro-survival factor in various cell types.^13–15

Glaucoma, a chronic eye disease characterized by optic nerve damage primarily associated with elevated intraocular pressure (IOP), affects over 64 million individuals worldwide.^16–18 This condition remains incurable, necessitating continuous treatment upon diagnosis. Although the reduction of IOP remains the primary therapeutic approach, interventions that effectively halt the progression of glaucoma are currently unavailable. Notably, the pathology of glaucoma persists even when IOP is adequately controlled.^19–21 Addressing this enigma requires the identification of neuroprotective mechanisms capable of safeguarding retinal ganglion cells (RGCs), which constitute the pivotal pathophysiological substrate of glaucoma.

Given the increased vulnerability of RGCs to various stressors, promoting the survival of these cells is an effective therapeutic approach. Key factors regulating survival mechanisms under stressful conditions include hypoxia-inducible factor-1α, VEGF, and nitric oxide synthase.^21–23 Specifically, the expression levels of these factors increase in response to hypoxia and glaucoma.^21–23

We have previously demonstrated the potential detrimental impact of VEGF-inhibitor therapy on RGC survival, particularly under stressful conditions.²³ Consequently, multiple rounds of VEGF-inhibitor treatments may inadvertently exacerbate glaucoma owing to excessive RGC loss.

The objectives of this study were to explore the effects of bevacizumab, a VEGF-inhibitor agent, on RGC survival and identify enhanced treatment strategies to promote RGC survival with similar antiangiogenic efficacy. The results of this study will help facilitate the development of novel therapeutic approaches for various retinal diseases, particularly those associated with glaucoma.

Animals

Sixty pregnant Sprague–Dawley rats were acquired from Orientbio Inc. (Seongnam, Korea). A total of 840 newborn rat pups (P2, P3 and P4) were humanely euthanized by decapitation to obtain sufficient RGC samples. Briefly, rat pups were leaved on ice covered with tissue paper for 30 minutes. Then rat pups were decapitated and eyes were pulled out and placed in HBSS. Eyes were dissected and obtain retina were used for experiments. Ethical approval for the study was obtained from the Institutional Animal Care and Use Committee of Yonsei University College of Medicine, Seoul, Korea (Approval Number: 2022-0053). All procedures involving rats were performed in accordance with the ethical guidelines outlined by the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. Extensive measures were taken to minimize the number of animals used and to alleviate potential suffering. The study is reported in accordance with ARRIVE guidelines.

Preparation of RGCs

RGCs were isolated using a two-step immunopanning method as previously described.^23–25 Briefly, retinal tissues were extracted from 1 to 4 day-old newborn Sprague–Dawley rats and combined to form a mixed suspension of retinal cells. The retinal cell suspension was incubated with a rabbit anti-rat macrophage antibody (dilution 1:50; Fitzgerald Industries International, Acton, MA, USA) for 5 min. Subsequently, the suspension was placed in a 10 cm Petri dish coated with goat anti-rabbit immunoglobulin G antibody (dilution 1:200; Southern Biotechnology Associates, Birmingham, AL, USA) for 30 min.

Non-adherent cells were transferred to a second 10 cm Petri dish coated with mouse anti-rat thymocyte differentiation antigen (Thy) 1.1 antibody (dilution 1:50; Bio-Rad, Hercules, CA, USA) for 1 h. The cells were then incubated with anti-biotin magnetic microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). Finally, the magnetically labeled RGCs were collected using a magnetic separation unit. All the procedures were performed simultaneously at room temperature (20–25°C) in a laminar flow hood.

The isolated cells were cultured in Dulbecco’s modified Eagle’s medium/nutrient mixture F-12 (DMEM/F-12; catalog no. SH30023.01; HyClone Laboratories, Logan, UT, USA) supplemented with 10% fetal bovine serum (Life Technologies, Grand Island, NY, USA), 100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies). These cells were seeded onto 12 mm glass coverslips pre-coated with poly-L-ornithine and laminin (Sigma-Aldrich, St. Louis, MO, USA). The cultures were maintained at 37°C in a humidified atmosphere containing 5% CO₂ and 95% air.

The authenticity of the cultured RGCs was validated through Brn3a (dilution 1:1,000, SC-8429, Santa Cruz Biotechnology, Paso Robles, CA, USA) immunostaining (Fig. 1).

Preparation of human umbilical vascular endothelial cells (HUVECs)

HUVECs (C2519A, LONZA, Walkersville, MD, USA) were cultured in a 10 cm dish containing endothelial growth medium (EGM)-2 (CC-3162, LONZA) with EGM^TM-2 Single-Quots^™ Supplements (CC-4176, LONZA) and incubated at 37°C with 5% CO₂ following the manufacturer’s instructions and as previously described.²⁶ The medium was changed every 3 days. The cells were harvested upon reaching 70–85% confluence.

Cell viability assay

Cell viability was evaluated using the cell counting kit-8 (CCK-8, Dojindo Laboratories, Kumamoto, Japan). RGCs and HUVECs were seeded onto a 96-well plate and incubated in the culture medium at 37°C in 5% CO₂ for 24 h. After the treatment, 10 µl CCK-8 solution was added to each well, and the plate was incubated for 2–4 h. Absorbance was measured using a spectrophotometer at a wavelength of 450 nm, within a spectral range of 420–480 nm, with a reference wavelength set at 600 nm.

Western blot

For the western blot, total cell lysates were obtained using a cell lysis buffer (Cell Signaling Technology, MA, USA). The lysates were incubated on ice for 5 min. Subsequently, the lysates were sonicated, and the resulting cell homogenates were centrifuged at 15,000 × g for 15 min at 4°C.

Following centrifugation, the protein concentration in the supernatants was quantified using the Pierce™ Bicinchoninic Acid Protein Assay Kit (Thermo Fisher Scientific, Foster City, CA, USA). Soluble proteins (10 µg per sample) were boiled for 5 min and separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Proteins were subsequently electrotransferred onto polyvinylidene fluoride membranes with a pore size of 0.45 µm. To prevent nonspecific binding, the membranes were blocked with 5% skim milk in Tris-buffered saline containing 0.1% Tween 20 (TBS-T) and incubated overnight with primary anti-Akt (9272S, Cell Signaling Technology) and anti-α-tubulin (T6199-100, MillporeSigma, Darmstadt, Germany) antibodies. These primary antibodies were diluted in a solution containing 0.1% bovine serum albumin and 0.01% sodium azide in TBS-T. The blots were washed three times with TBS-T and incubated with horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology) for 1 h at room temperature (20–25°C). After another three washes with TBS-T, immunoreactive bands were visualized using enhanced chemiluminescence. The relative intensities of the immunoreactive bands were measured after normalization against α-tubulin levels.

Flow cytometry

To detect apoptosis, we utilized an Annexin V-fluorescein isothiocyanate (FITC) apoptosis kit from BioVision (Milpitas, CA, USA) following the manufacturer’s instructions. Briefly, after collagenase digestion, isolated cells were prepared for analysis. The cells were stained with Annexin V-FITC and propidium iodide (BioVision). Flow cytometry was conducted using a FACS LSR II instrument (BD Biosciences, San Jose, CA, USA). The percentage of viable cells was determined based on the proportion of Annexin V- and propidium iodide-positive cells in the samples. Flow cytometric analysis enabled identifying and quantifying apoptotic cells within the population of interest.

Lactate dehydrogenase assay

A lactate dehydrogenase (LDH) cell cytotoxicity kit, specifically the CytoTox 96® Non-Radioactive Cytotoxicity Assay Kit from Promega Corporation (Madison, WI, USA), was utilized to assess cell survival quantitatively. Briefly, RGCs were cultured with various VEGF inhibitors. The cells were incubated with LDH detection buffer for 30 min at room temperature in the dark. A stop solution was added to terminate the reaction. Absorbance was measured at 490 nm using a microplate reader (Bio-Rad). LDH release, which indicates cytotoxicity, was calculated by dividing the experimental time point values by the maximum LDH release values and multiplying by 100. Maximum LDH release values were obtained by subjecting each culture to a freeze–thaw process, inducing nearly complete cell damage.

Cell counting

RGC death was induced by treatment with various VEGF inhibitors. The cells were fixed with 4% paraformaldehyde for 30 min and thoroughly washed with phosphate-buffered saline (PBS). At room temperature (20–25°C), the RGCs were stained with DAPI solution for visualization, incubated for 5 min, and washed three times with PBS. For each sample, five images of DAPI-stained RGCs were captured using a light microscope (Olympus IX73; Olympus Corp., Tokyo, Japan) at 100× magnification. The number of RGCs in the presence or absence of oxidative stress was counted manually in each image.

RNA sequencing

RNA library preparation and sequencing were performed by LAS Inc. (Gimpo, Korea; http://www.lascience.co.kr/) using the SMARTER Stranded Total RNA-seq kit-v2—Pico Input Mammalian (Takara Bio, Mountain View, CA, USA) in accordance with the manufacturer’s protocol. This process involved ligating RNAs with 3ʹ and 5ʹ adaptors and reverse transcribing them into cDNA. Polymerase chain reaction (PCR) was performed using different Illumina index primers to distinguish multiple time points after injury in both the proximal and distal segments. All libraries with 75 bp paired-end reads were sequenced on a NextSeq 500 System (Illumina, San Diego, CA, USA).

Quality control of the reads was conducted using FastQC v0.11.5, and any sequencing adapters and low-quality bases in the raw reads were trimmed using Skewer version 0.2.2. The resulting high-quality reads were mapped to the reference genome using STAR version 2.6 software.

The mapped reads were quantified as gene expression values relative to the reference genome using Cuffquant in Cufflinks version 2.2.1. Gene annotation from the reference genome rn6 (UCSC genome, https://genome.ucsc.edu) in GTF format was used for gene models, and expression values were calculated as fragments per kilobase of transcripts per million mapped reads (FPKM). Differential gene expression analysis among the four selected biological conditions (RGCs versus RGCs with VEGF treatment versus RGCs with Bevacizumab treatment versus RGCs with Sorafenib treatment) was conducted using Cuffdiff within the Cufflinks package. Genes with a fold change cutoff of 2 and a p-value cutoff of 0.05 were identified as differentially expressed. A few hundred differentially expressed genes (DEGs) normalized expression values were subjected to unsupervised clustering using R scripts provided by LAS Inc. to compare the expression profiles among samples. Scatter plots for gene expression values, volcano plots for expression fold changes, and p-values between two selected samples were also generated.

A gene set overlapping test between the analyzed DEGs and functionally categorized genes, encompassing the biological processes of Gene Ontology (GO), KEGG pathways, and other functional gene sets, was performed using g:Profiler2 version 0.2.0 to gain insights into the biological functional roles of the DEGs.

Network analysis and visualization

Functional analysis was conducted using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) bioinformatics platform (http://david.abcc.ncifcrf.gov) and Ingenuity Pathway Analysis. GO enrichment analysis explored the associations between significantly expressed genes and their respective cellular compartments, biological processes, and molecular functions. Statistical significance was determined within DAVID using LPEseq (Seoul, Korea)²⁷ to generate corrected q-values. Differential gene expression analysis was performed using the |log2FC| >1 criteria and q-value < 0.05. Only terms with a corrected q-value < 0.05 were considered statistically significant. The top list of DEGs was input into the STRING database to identify protein–protein interactions (PPIs) using a medium confidence threshold of 0.400. These interactions were subsequently visualized using Cytoscape 2.8.3 (http://www.cytoscape.org). Candidate genes were identified using MCODE to establish clusters. Key biological processes and pathways associated with the clusters of genes within a functionally grouped network were visualized using ClueGo/CluePedia and KEGGscape plugins.

Quantitative reverse-transcription polymerase chain reaction (RT-qPCR) and

RNA-Seq data validation

RNA was isolated using an RNeasy Micro Kit (Qiagen, Hilden, Germany) and reverse transcribed into complementary DNA (cDNA) using EcoDry™ Premix (Takara Bio). Real-time PCR was conducted utilizing SYBR® Premix Ex Taq™ (Takara Bio) and predesigned primers (Table 1) on the StepOnePlus™ Real-Time PCR System (Applied Biosystems/Thermo Fisher Scientific). Gene expression levels were quantified using the comparative cycle threshold method and normalized to β-actin as an internal control within the same sample.

Table 1

Primers for quantitative reverse-transcription polymerase chain reaction
Gene	Sequence (5′-3′)	Primers
rCar4	ATCTGCCCACCCAGTACAAG	F
rCar4	AGCCCTCGTTTACCTCGTTT	R
rLama2	TCACGCTGTCAAGGATTCAG	F
rLama2	TTGACTTCTGGCCTTGCTTT	R
rHgf	CGAGCTATCGCGGTAAAGAC	F
rHgf	TGTAGCTTTCACCGTTGCAG	R
rVegfc	AGCAGCCACAAACACCTTCT	F
rVegfc	TGCTGAGGTAACCTGTGCTG	R
rFgf2	GAACCGGTACCTGGCTATGA	F
rFgf2	CCGTTTTGGATCCGAGTTTA	R
rFgf4	AGGCTGCGGAGACTCTACTG	F
rFgf4	ACTCCGAAGATGCTCACCAC	R
rFgf7	GCTCTACAGACCGTGCTTCC	F
rFgf7	CCCCTCCTTCCATGTAGTCA	R
rScx	ACATTTCTCACCTGGGCAAC	F
rScx	CGTCTCTGGCCAGTGGTAGT	R
rPak2	GCTGTGCTGGATGTCTTGAA	F
rPak2	CTGACCCCTTGGTGTTCAGT	R
rGfap	AGAAAACCGCATCACCATTC	F
rGfap	TCCTTAATGACCTCGCCATC	R
rRtn4r	GGCTGCCAGTGACTTAGAGG	F
rRtn4r	TGAGTGCATTTCCAGCAGAC	R
rCdh17	CAAAGCAGAAAACCCTGAGC	F
rCdh17	GGGGAAATACAGGCACTTCA	R
rWt1	GCCTTCACCTTGCACTTCTC	F
rWt1	GACCGTGCTGTATCCTTGGT	R
rEwsr1	ACTTCGCCTGGAGAACAGAA	F
rEwsr1	TCCATGAGTCCACCTCTTCC	R

siRNA transfection

Cells were transiently transfected with 200 nM siRNA targeting Akt and non-targeting siRNA using Lipofectamine 2000 in accordance with the manufacturer's guidelines. Akt knockdown efficacy following siRNA transfection was assessed using a western blot. After a 48 h transfection period, the cells were harvested in six-well plates to evaluate Akt protein levels and their functional impact.

Statistical analysis

In adherence to rigorous scientific standards, all experiments were conducted in triplicate to ensure data accuracy and reliability, and their results are presented as the mean ± standard deviation. A robust statistical approach was employed to assess the significance of the observed differences between groups. Student’s t-test and one-way analysis of variance were used for initial group comparisons. A linear mixed model was employed to show statistically significant trends. All statistical analyses were performed using GraphPad Prism version 9.0 for Windows (GraphPad Software, San Diego, CA, USA), SPSS V22.0 software (SPSS, Chicago, IL, USA), SAS version 9.4 (SAS Institute Inc., Cary, NC, USA), and the R package (version 4.3.0, packages; survival; The R Project for Statistical Computing, Vienna, Austria). Statistical significance was considered at p < 0.05, ensuring the utmost reliability in our findings, in line with the highest standards of medical research.

Effects of VEGF and bevacizumab on RGC survival

An in vitro experiment was conducted to assess the effects of VEGF and bevacizumab on RGCs. RGCs were cultured with different concentrations of VEGF (0.1, 0.5, 1, 5, and 10 ng/mL) and bevacizumab (0.1, 1, 5, and 10 mg/mL) for 24 h, and their viability was subsequently compared with that of RGCs cultured without these agents (control group).

The viability of RGCs exposed to the various VEGF concentrations did not significantly differ from that of the control group (p > 0.05, Fig. 2A).

Although the viability of RGCs cultured with 0.1 mg/ml bevacizumab was not significantly altered compared with that of the control group, the viability of the cells cultured with 1, 5, and 10 mg/ml bevacizumab was significantly lower than that of the control group (p < 0.05; Fig. 2B). A linear mixed model was employed to analyze the dose effect of bevacizumab, revealing a statistically significant trend (p < 0.001; Fig. 2B).

These findings were corroborated through immunostaining for Brn3a, which revealed a similar trend. Compared with the control group, RGCs cultured with 1 and 2 mg/ml of bevacizumab had a lower cell count (Fig. 2C).

Effect of bevacizumab on the Akt pathway

To elucidate the mechanisms of action of bevacizumab on RGC survival, we examined the effects of 0.5, 1.0, and 2.0 mg/ml of bevacizumab on signaling molecules involved in pro-survival pathways, such as Akt. The Akt expression level was measured 24 h after bevacizumab treatment. Western blot analysis revealed that Akt levels gradually decreased with increasing bevacizumab concentrations (Fig. 3).

Effects of various VEGF inhibitors on RGC survival

To determine an alternative approach to inhibiting VEGF, we assessed the efficacy of various VEGF inhibitors, including sorafenib, regorafenib, trametinib, vemurafenib, selumetinib, and pazopanib, in promoting the survival of RGCs. To identify their optimal concentrations, we compared the apoptotic effects of these VEGF inhibitors on HUVECs with those of 2 mg/ml bevacizumab. Subsequently, we used the following concentrations of the VEGF inhibitors for HUVEC experiments: 0.5 µM sorafenib, 2 µM regorafenib, 0.5 µM trametinib, 1 µM vemurafenib, 10 µM selumetinib, and 10 µM pazopanib (data not shown). In the RGC viability experiment, sorafenib induced the highest RGC survival rate among the tested VEGF inhibitors and significantly surpassed bevacizumab (Fig. 4). Therefore, sorafenib was used in all subsequent comparative analyses with bevacizumab.

Effects of sorafenib and bevacizumab on RGC survival

We comprehensively assessed the effects of different concentrations of sorafenib (0.1, 0.5, 1.0, 2.0, 5.0, and 10.0 µM) and bevacizumab (0.1, 1.0, 2.0, 5.0, and 10.0 mg/mL) on RGC survival using cell viability and LDH assays. The viability of RGCs was significantly decreased following treatment with bevacizumab and sorafenib in a dose-dependent manner, starting at 1.0 mg/ml and 0.5 µM, respectively (p < 0.001; Fig. 5A). Consistently, LDH assay results revealed that LDH release was notably increased following treatment with bevacizumab and sorafenib in a dose-dependent manner, starting at 1.0 mg/ml and 2.0 µM, respectively (p < 0.001; Fig. 5B).

HUVEC survival

To investigate the effects of VEGF inhibitors on vascular cells, we assessed the effects of various concentrations of sorafenib (0.1–5.0 µM) and bevacizumab (0.1–10.0 mg/mL) on the viability of HUVECs. Cell viability assay results showed that the viability of HUVECs was significantly decreased by bevacizumab and sorafenib in a dose-dependent manner, starting at 2.0 mg/ml and 0.5 µM, respectively (Fig. 6A).

We assessed live and dead cells through flow cytometry to further validate these findings. The flow cytometry results confirmed those of the cell viability assay, and 0.5 µM sorafenib exhibited a similar or even superior apoptotic effect to 2.0 mg/ml bevacizumab on HUVECs (Fig. 6B). These results were also corroborated through immunostaining. Specifically, the cell count was lower after treatment with 0.5 µM sorafenib than 2.0 mg/ml bevacizumab (Fig. 6C).

Effects of sorafenib and bevacizumab on RGC Akt

We investigated the effects of 2.0 mg/ml bevacizumab and 0.5 µM sorafenib on signaling molecules associated with pro-survival pathways, specifically Akt, in RGCs. Western blot analysis revealed that Akt levels significantly increased after VEGF treatment. However, Akt levels were markedly lower after treatment with 2.0 mg/ml bevacizumab than with 0.5 µM sorafenib, indicating the differential effects of these agents on Akt signaling (Fig. 7A). We used the siRNA method to corroborate these findings and observed consistent results (Fig. 7B).

Effects of treatment with 0.5 µM sorafenib and 2 mg/ml bevacizumab on RGC survival

The effects of 2.0 mg/ml bevacizumab and 0.5 µM sorafenib on the survival of RGCs were evaluated. Results of advanced flow cytometry showed that the survival rate of RGCs substantially increased after VEGF treatment. However, the survival rate of RGCs was significantly lower after treatment with 2.0 mg/ml bevacizumab than with 0.5 µM sorafenib, indicating the distinct effects of these agents on RGC viability (Fig. 8A). The observed results were confirmed through a tunnel assay (Fig. 8B).

RNA sequencing results

We conducted comprehensive RNA sequencing to unravel gene expression discrepancies and delineate the specific cellular pathways influenced by VEGF-inhibitor treatment. After a 24 h stabilization period, isolated RGCs were subjected to four distinct conditions: control (RGCs only), VEGF treatment, 2.0 mg/ml bevacizumab treatment, and 0.5 µM sorafenib treatment. RNA sequencing was then performed. The initial analysis results showed that VEGF-inhibitor treatment modified the gene expression profiles of RGCs (Fig. 9A and B).

We focused on genes that were upregulated by VEGF treatment but downregulated by VEGF-inhibitor treatment compared with the control group or genes that were downregulated by VEGF treatment but upregulated by VEGF-inhibitor treatment compared with the control group (Fig. 9C). This stringent selection process yielded 14 genes with a greater than two-fold change and an adjusted p-value of less than 0.05 (Table 2). This value was confirmed with RT-qPCR (Fig. 9D).

Table 2

Genes that displayed a greater than two-fold change with an adjusted p-value of less than 0.05 in RNA sequencing
Gene symbol	Log2(FC)			Full descriptions of the gene
Gene symbol	VEGF	Bevacizumab	Sorafenib	Full descriptions of the gene
Gfap	7.314	4.170	3.937	Glial fibrillary acidic protein [Source: RGD Symbol; Acc:2679]
Vegfc	6.093	2.309	1.913	Vascular endothelial growth factor C [Source: RGD Symbol; Acc:619800]
Rtn4r	5.759	2.964	2.645	Reticulon 4 receptor [Source: RGD Symbol; Acc:620810]
Pak2	4.515	3.194	1.650	P21 (RAC1) activated kinase 2 [Source: RGD Symbol; Acc:61953]
Ewsr1	3.971	1.687	1.603	EWS RNA-binding protein 1 [Source: RGD Symbol; Acc:1307258]
Fgf4	3.196	0.000	0.000	Fibroblast growth factor 4 [Source: RGD Symbol; Acc:620127]
Wt1	3.101	1.228	1.153	WT1 transcription factor [Source: RGD Symbol; Acc:3974]
Fgf2	2.145	0.000	0.779	Fibroblast growth factor 2 [Source: RGD Symbol; Acc:2609]
Fgf7	1.501	1.375	0.772	Fibroblast growth factor 7 [Source: RGD Symbol; Acc:61805]
Scx	1.313	2.319	0.000	Scleraxis bHLH transcription factor [Source: RGD Symbol; Acc:1588254]
Car4	1.170	0.523	0.233	Carbonic anhydrase 4 [Source:RGD Symbol;Acc:2242]
Cdh17	1.141	2.436	0.525	Cadherin 17 [Source: RGD Symbol; Acc:619748]
Lama2	0.994	0.380	0.236	Laminin subunit alpha 2 [Source: RGD Symbol; Acc:1308889]
Hgf	0.947	2.313	0.390	Hepatocyte growth factor [Source: RGD Symbol; Acc:2794]

Pathway analysis

Functional analysis was conducted using the DAVID bioinformatics package to gain deeper insights into the biological relevance of the identified genes. GO enrichment analysis explored the associations between significantly expressed genes and their cellular compartments, biological processes, and molecular functions.

The top DEGs were then subjected to the STRING database to elucidate PPIs, employing a medium confidence threshold of 0.400. These interactions were subsequently visualized using Cytoscape software, wherein the genes were organized into functionally grouped networks.

In this network, the inner circles indicate the effects of the VEGF inhibitors on specific genes, with blue representing the effect of sorafenib, purple that of bevacizumab, and yellow that of both inhibitors (Fig. 10).

The outer circles denote common survival pathways, with orange highlighting the PI3-Akt signaling pathway, purple the Ras signaling pathway, red the MAPK signaling pathway, and green the JAK-STAT signaling pathway. Interestingly, our analysis revealed significant involvement of the PI3-Akt, Ras, and MAPK signaling pathways in the context of our study. However, genes associated with the JAK-STAT pathway showed no significant participation.

The present study investigated the effects of VEGF inhibitors, particularly bevacizumab and sorafenib, on the survival of RGCs and their mechanisms of action. First, our findings revealed that bevacizumab exhibited RGC toxicity, necessitating carefully considering its use. Second, administration of bevacizumab to RGCs disrupted the PI3-Akt pathway. Third, compared with bevacizumab, sorafenib exerted a milder effect on the PI3-Akt pathway and less toxicity to RGCs while maintaining a similar apoptotic effect on vascular endothelial cells. These results suggest the possibility of an alternative approach that preserves the effects of VEGF inhibitors on the retina while protecting RGCs.

Bevacizumab, a monoclonal antibody specifically designed to target VEGF, has attracted significant attention as a potential treatment modality for retinal diseases characterized by abnormal blood vessel growth.^9,11 These conditions include age-related macular degeneration (AMD), diabetic retinopathy, and retinal vein occlusion, all characterized by the pathological formation of blood vessels within the retina. One critical aspect of bevacizumab use in the context of retinal diseases is its potential effect on RGCs, which play a fundamental role in visual function. RGCs transmit visual information from the retina to the brain, making their health and survival pivotal for maintaining normal vision.^28,29 Several issues have been associated with using bevacizumab in relation to RGCs. For instance, the potential toxicity of bevacizumab to RGCs could jeopardize the health and proper functioning of RGCs, resulting in visual impairment or exacerbation of existing visual deficits.^30–33 This may be even more dangerous for patients with glaucoma.^34,35

Glaucoma encompasses a group of eye diseases characterized by their detrimental effects on the optic nerve, specifically targeting the RGCs responsible for transmitting crucial visual information from the eye to the brain.³⁶ The genesis of this damage is often attributed to elevated IOP, which exerts deleterious pressure on these RGCs, leading to their degeneration and consequential harm to the optic nerve. This process is typically insidious and progressive, initially manifesting as peripheral (side) vision impairment. If left untreated, it may culminate in complete blindness. Glaucoma is a chronic condition and a leading cause of blindness globally.^18,37 Regular eye examinations are indispensable, especially for individuals at risk or those with a family history of glaucoma, as they facilitate early detection and intervention. Timely management is crucial because it can effectively slow down or prevent vision loss from damage to the RGCs and optic nerve. Glaucoma is a non-reversible condition, making the preservation of RGCs a paramount concern in the management of this disease.³⁷ Evidence suggests that injecting VEGF inhibitors, particularly bevacizumab, can contribute to RGC damage in patients with glaucoma.^31,33–35 The vulnerability of RGCs in glaucoma is well established because these cells play a pivotal role in transmitting visual information from the eye to the brain. Elevated IOP, a hallmark of glaucoma, places significant stress on RGCs, ultimately leading to their degeneration and consequent damage to the optic nerve. Although effective in controlling abnormal blood vessel growth in various eye conditions, VEGF-inhibitor therapy may inadvertently exert adverse effects on RGCs. The potential RGC damage because of anti-VEGF injections, including bevacizumab, underscores the need for careful consideration when selecting treatment options for patients with glaucoma. Balancing the benefits of VEGF-inhibitor therapy in managing glaucoma with its potential impact on RGCs remains a critical aspect of glaucoma care and requires ongoing research and clinical vigilance.

RGC damage associated with anti-VEGF injections, particularly bevacizumab, appears to stem from multiple factors. First, IOP increases after VEGF-inhibitor injections.^38,39 This elevated IOP can place additional stress on RGCs, exacerbating their vulnerability and contributing to damage. Second, bevacizumab exhibits RGC toxicity.^30,31 The specific mechanisms underlying this toxicity are an area of ongoing research, but the direct impact of the drug on RGCs can lead to their impairment and potential degeneration. Collectively, these factors highlight the complex relationship between VEGF-inhibitor therapy and RGC damage. Although VEGF-inhibitor injections have shown efficacy in managing various eye conditions, their potential adverse effects on RGCs underscore the importance of careful patient monitoring and individualized treatment approaches to mitigate the risk of further harm to these critical retinal cells.

Numerous studies have investigated the molecules involved in promoting the survival of RGCs. Among these are nerve growth factor, brain-derived neurotrophic factor, ciliary neurotrophic factor, VEGF, and insulin-like growth factors.^23,40–42 VEGF is a glycoprotein with a molecular weight of 46 kDa that binds to receptors on the surface of vascular endothelial cells, stimulating their proliferation and increasing capillary permeability.^43,44 This factor promotes the development and maturation of neural tissues, including the retina.^4,45 During development, VEGF is expressed by various cell types in the retina, such as astrocytes in the RGC layer, inner nuclear layer cells, Müller cells, and retinal pigment epithelial cells.^4,46,47 Even in the mature retina, VEGF is expressed without active neovascularization and is implicated in the maintenance and function of adult retinal neuronal cells.⁴⁷ Moreover, VEGF exerts neuroprotective effects, particularly in safeguarding injured RGCs and slowing down their degeneration post-axotomy.⁴⁸ Our previous research confirmed that VEGF promotes the survival of RGCs under hypoxic conditions.²³ In this study, when VEGF activation was hindered with bevacizumab after 4 h of hypoxia, the RGC survival rate dose-dependently decreased.²³ Collectively, these findings emphasize the critical role of VEGF in supporting the survival of RGCs. An excessive reduction in VEGF levels because of bevacizumab treatment may result in unintended damage to RGCs. Hence, balancing the therapeutic benefits of VEGF modulation with its potential consequences for RGC health is a key consideration in managing retinal conditions.

Intravitreal injections of VEGF inhibitors, notably bevacizumab, have been used in clinical settings because of their cost-effectiveness. However, our study and previous studies raised concerns about the potential risks associated with repeated VEGF-inhibitor injections, particularly their interference with the neuroprotective actions of VEGF. Although some studies have suggested the safety of bevacizumab treatment for RGCs, future studies should explore the potential side effects, including serious eye conditions such as glaucoma, of multiple bevacizumab injections.

In light of these considerations, alternative treatments for ischemic retinal conditions, such as AMD, retinal vein occlusion, and proliferative diabetic retinopathy, must be developed. The present study evaluated the effects of various VEGF inhibitors to identify alternatives that might offer better safety profiles compared with bevacizumab. Our findings suggest that sorafenib, a multi-kinase inhibitor, can replace bevacizumab. Indeed, sorafenib demonstrated effective VEGF-inhibitor activity in vascular endothelial cells while causing less damage to RGCs. These promising results suggest that sorafenib could be a safe and viable alternative to bevacizumab for treating ischemic retinal conditions. Further research and clinical studies are warranted to validate these findings and determine the full scope of the efficacy and safety of sorafenib in the treatment of various retinal diseases. Such investigations will guide clinicians in making informed treatment decisions and providing better options for patients seeking optimal care for their eye conditions.

Sorafenib is a kinase inhibitor approved for the treatment of various conditions, including advanced renal cell carcinoma, hepatocellular carcinoma, certain types of acute myeloid leukemia, and advanced thyroid carcinoma that does not respond to radioactive iodine treatment.^49,50 This drug affects several protein kinases, including the VEGF receptor, platelet-derived growth factor (PDGF) receptor, and rapidly accelerated fibrosarcoma (RAF) kinases.^49,50 Initially identified as an RAF kinase inhibitor, sorafenib's action extends to inhibiting multiple receptor tyrosine kinases involved in angiogenesis, the new blood vessel formation process.^49,50 Its anti-proliferative and antiangiogenic properties are derived from its ability to block the RAF/mitogen-activated protein (MAP)/extracellular signal-regulated kinase (ERK) kinase cascade and its impact on receptor tyrosine kinases, including VEGF receptor 2 (VEGFR2), VEGFR3, PDGF receptor, FLT3, Ret, and c-Kit.^49,50 Additionally, sorafenib interacts with hypoxia-inducible factors 1 and 2, influencing the expression of growth factors such as VEGF and PDGF.^49,50

In the context of ocular health, a prior study examined the potential of sorafenib to counteract the overexpression of VEGF, PDGF, and PlGF in human retinal pigment epithelial cells subjected to light-induced stress.⁵¹ The authors presented the promising viability of sorafenib as an antiangiogenic treatment for AMD.⁵¹ Moreover, various in vitro studies have explored the effects of sorafenib. Sorafenib administration to primary human optic nerve head astrocytes and primary human retinal pigment epithelial cells under white light exposure can significantly reduce the light-induced overexpression of VEGF.^52,53 In the rat oxygen-induced retinopathy model, sorafenib could inhibit retinal neovascularization dose-dependently.⁵⁴ These findings strongly suggest sorafenib as a potentially effective therapeutic approach for patients with retinal diseases, specifically, AMD, aligning closely with the results of the current study. These findings offer hope for advancements in treatment options and improved outcomes in managing this complex and challenging retinal condition.

Nonetheless, further in-depth research and rigorous clinical trials are imperative to thoroughly validate the effectiveness and safety of sorafenib for this specific application. Additional investigations are critical to translating these promising preliminary findings into established treatments that can offer substantial benefits to individuals with retinal diseases, such as AMD.

We studied several candidate signaling molecules using RNA sequencing to better understand the signaling pathways downstream of VEGF. We conducted a comprehensive functional analysis using the DAVID bioinformatics package to investigate the biological significance of the identified genes. Using Cytoscape software, we also visualized the intricate web of gene interactions and relationships. This tool facilitates the organization of genes into functionally grouped networks, offering a clear and structured representation of how these genes collaborate and contribute to specific biological processes. Our investigation yielded intriguing insights into the PI3-Akt, Ras, MAPK, and JAK-STAT signaling pathways. These pathways are key components of the intricate network of signaling cascades activated by VEGF, shedding light on their critical involvement in RGC survival. Notably, our analysis unveiled the significant participation of the PI3-Akt, Ras, and MAPK signaling pathways in the context of our study. However, genes associated with the JAK-STAT pathway showed no significant involvement in our investigation. Interestingly, several genes were shared among the PI3-Akt, Ras, and MAPK pathways, whereas the JAK-STAT pathway exhibited a distinct genetic profile. This observation suggests that the JAK-STAT pathway may exhibit a comparatively independent response mechanism. Future investigations should investigate this phenomenon to understand its implications and mechanisms.

To our knowledge, studies exploring the complex interplay between VEGF-inhibitor therapies and RGC survival are limited. Therefore, our findings offer novel insights into the molecular mechanisms underlying RGC survival and may guide the development of efficacious treatments for retinal diseases, potentially improving the outcomes of individuals with these conditions.

This study has a few limitations that merit consideration. First, our in vitro model focused exclusively on RGCs, whereas in vivo, RGCs exist in a complex milieu alongside various other cell types, including astrocytes, Müller cells, and glial cells. Thus, this controlled environment may not accurately replicate the in vivo interactions that affect RGC survival. Second, the conditions in neonatal rat RGCs may not completely align with those observed in adult human RGCs. Third, numerous factors beyond VEGF may contribute to cell survival. Although our study examined the correlations with VEGF, a comprehensive analysis of all potential contributing factors was not performed. Additionally, our study was conducted over a relatively short incubation period (48 h) because of the various constraints of the in vitro primary RNA culture system. This limited duration may not fully capture the long-term effects and complexities of RGC survival and treatment responses. Lastly, rat RGCs may differ from human RGCs, limiting the direct extrapolation of our findings to clinical contexts. Despite these inherent limitations, our study introduces novel clinical perspectives, suggesting that sorafenib holds promise as a safe treatment option for patients.

However, further experimental and clinical investigations are required to validate and substantiate our in vitro findings in real-world clinical settings.

Our study indicated that sorafenib is a potentially more effective and safer treatment option than bevacizumab for various retinal diseases, uncovered new genes, and provided insights into the complex roles of multiple signaling pathways in this context. These findings will help facilitate the development of safe therapeutic approaches for managing retinal diseases associated with glaucoma. This study marks a significant advancement in the literature by improving the management and treatment outcomes for complex ocular conditions.

Conflict of Interest:

No conflicting relationships exist for any author.

Ethics Statements

Not applicable.

Funding Statement:

This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF- 2019R1I1A1A01061721 & 2022R1I1A1A01071919), Research Grant from Gangnam Severance Hospital (D-2023-0012), faculty research grant of Yonsei University College of Medicine (6-2020-0139), and by a new faculty research seed money grant of Yonsei University College of Medicine for 2023 (2023-32-0059). The funding organization had no role in the design or conduct of this research.

Author Contribution

W.C.: supervision, modeling, investigation, data analysis, and writing; J.C.: writing, data analysis, methodology, and validation; M.K.C.: data analysis and validation; M.S.K.: data analysis and validation; C.Y.K.: supervision, methodology, modeling, and validation. The authors jointly interpreted the findings and wrote, revised, and approved the final manuscript.

Data Availability

Data availability: The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.

Gilbert, R. E. et al. Vascular endothelial growth factor and its receptors in control and diabetic rat eyes. Lab. Invest. 78, 1017–1027 (1998).
Hammes, H. P., Lin, J., Bretzel, R. G., Brownlee, M. & Breier, G. Upregulation of the vascular endothelial growth factor/vascular endothelial growth factor receptor system in experimental background diabetic retinopathy of the rat. Diabetes. 47, 401–406 (1998).
Resnikoff, S. et al. Global data on visual impairment in the year 2002. Bull. World Health Organ. 82, 844–851 (2004).
Penn, J. S. et al. Vascular endothelial growth factor in eye disease. Prog. Retin. Eye Res. 27, 331–371 (2008).
Cheung, N., Mitchell, P. & Wong, T. Y. Diabetic retinopathy. Lancet (London England). 376, 124–136 (2010).
Lin, K. Y., Hsih, W. H., Lin, Y. B., Wen, C. Y. & Chang, T. J. Update in the epidemiology, risk factors, screening, and treatment of diabetic retinopathy. J. diabetes Invest. 12, 1322–1325 (2021).
Dugel, P. U. Ranibizumab treatment of patients with ocular diseases. Int. Ophthalmol. Clin. 46, 131–140 (2006).
Rosenfeld, P. J., Heier, J. S., Hantsbarger, G. & Shams, N. Tolerability and efficacy of multiple escalating doses of ranibizumab (Lucentis) for neovascular age-related macular degeneration. Ophthalmology. 113, 623e621 (2006).
Grisanti, S. & Ziemssen, F. Bevacizumab: off-label use in ophthalmology. Indian J. Ophthalmol. 55, 417–420 (2007).
Lee, D. K., Kim, S. H., You, Y. S. & Kwon, O. W. High Dose Intravitreal Bevacizumab for Refractory Pigment Epithelial Detachment in Age-related Macular Degeneration. Korean J. ophthalmology: KJO. 30, 265–271 (2016).
Arevalo, J. F. et al. Intravitreal bevacizumab (Avastin) for proliferative diabetic retinopathy: 6-months follow-up. Eye (London England). 23, 117–123 (2009).
Stewart, M. W. The expanding role of vascular endothelial growth factor inhibitors in ophthalmology. Mayo Clinic proceedings 87, 77–88 (2012).
Sanchez, A., Wadhwani, S. & Grammas, P. Multiple neurotrophic effects of VEGF on cultured neurons. Neuropeptides. 44, 323–331 (2010).
Falk, T., Gonzalez, R. T. & Sherman, S. J. The yin and yang of VEGF and PEDF: multifaceted neurotrophic factors and their potential in the treatment of Parkinson's Disease. Int. J. Mol. Sci. 11, 2875–2900 (2010).
Lv, B., Wang, R., Gao, X., Dong, X. & Ji, X. Effect of vascular endothelial growth factor on retinal ganglion cells of rats with chronic intraocular hypertension. Int. J. Clin. Exp. Pathol. 7, 5717–5724 (2014).
Quigley, H. A. Number of people with glaucoma worldwide. Br. J. Ophthalmol. 80, 389–393 (1996).
Quigley, H. A. & Broman, A. T. The number of people with glaucoma worldwide in 2010 and 2020. Br. J. Ophthalmol. 90, 262–267 (2006).
Tham, Y. C. et al. Global prevalence of glaucoma and projections of glaucoma burden through 2040: a systematic review and meta-analysis. Ophthalmology. 121, 2081–2090 (2014).
Anderson, D. R. Collaborative normal tension glaucoma study. Curr. Opin. Ophthalmol. 14, 86–90 (2003).
Kass, M. A. et al. The Ocular Hypertension Treatment Study: a randomized trial determines that topical ocular hypotensive medication delays or prevents the onset of primary open-angle glaucoma. Archives of ophthalmology (Chicago, Ill.: 120, 701–713; discussion 829 – 730 (2002). (1960).
Park, S. H., Kim, J. H., Kim, Y. H. & Park, C. K. Expression of neuronal nitric oxide synthase in the retina of a rat model of chronic glaucoma. Vision. Res. 47, 2732–2740 (2007).
Prass, K. et al. Hypoxia-induced stroke tolerance in the mouse is mediated by erythropoietin. Stroke. 34, 1981–1986 (2003).
Bae, H. W. et al. Effects of Hypoxic Preconditioning and Vascular Endothelial Growth Factor on the Survival of Isolated Primary Retinal Ganglion Cells. Biomolecules 11 (2021).
Hong, S., Iizuka, Y., Kim, C. Y. & Seong, G. J. Isolation of primary mouse retinal ganglion cells using immunopanning-magnetic separation. Mol. Vis. 18, 2922–2930 (2012).
Lee, K., Choi, J. O., Hwang, A., Bae, H. W. & Kim, C. Y. Ciliary Neurotrophic Factor Derived From Astrocytes Protects Retinal Ganglion Cells Through PI3K/AKT, JAK/STAT, and MAPK/ERK Pathways. Investig. Ophthalmol. Vis. Sci. 63, 4 (2022).
Marquez-Curtis, L. A., Eskandari, N., McGann, L. E. & Elliott, J. A. W. Protocol for Cryopreservation of Endothelial Monolayers. Methods Mol. biology (Clifton N J). 2180, 581–591 (2021).
Gim, J., Won, S., Park, T. & LPEseq Local-Pooled-Error Test for RNA Sequencing Experiments with a Small Number of Replicates. PloS one. 11, e0159182 (2016).
Langer, K. B. et al. Retinal Ganglion Cell Diversity and Subtype Specification from Human Pluripotent Stem Cells. Stem cell. Rep. 10, 1282–1293 (2018).
Soucy, J. R. et al. Retinal ganglion cell repopulation for vision restoration in optic neuropathy: a roadmap from the RReSTORe Consortium. Mol. neurodegeneration. 18, 64 (2023).
Brar, V. S., Sharma, R. K., Murthy, R. K. & Chalam, K. V. Bevacizumab neutralizes the protective effect of vascular endothelial growth factor on retinal ganglion cells. Mol. Vis. 16, 1848–1853 (2010).
Romano, M. R. et al. Effects of bevacizumab on neuronal viability of retinal ganglion cells in rats. Brain Res. 1478, 55–63 (2012).
Lee, W. J. et al. Rate of Macular Ganglion Cell-inner Plexiform Layer Thinning in Glaucomatous Eyes With Vascular Endothelial Growth Factor Inhibition. J. Glaucoma. 26, 980–986 (2017).
Beck, M., Munk, M. R., Ebneter, A., Wolf, S. & Zinkernagel, M. S. Retinal Ganglion Cell Layer Change in Patients Treated With Anti-Vascular Endothelial Growth Factor for Neovascular Age-related Macular Degeneration. Am. J. Ophthalmol. 167, 10–17 (2016).
de Vries, V. A., Bassil, F. L. & Ramdas, W. D. The effects of intravitreal injections on intraocular pressure and retinal nerve fiber layer: a systematic review and meta-analysis. Sci. Rep. 10, 13248 (2020).
Kopić, A. et al. Retinal Nerve Fiber Layer Thickness in Glaucoma Patients Treated with Multiple Intravitreal Anti-Vegf (Bevacizumab) Injections. Acta Clin. Croatica. 56, 406–414 (2017).
Mead, B. & Tomarev, S. Evaluating retinal ganglion cell loss and dysfunction. Exp. Eye Res. 151, 96–106 (2016).
Weinreb, R. N., Aung, T. & Medeiros, F. A. The pathophysiology and treatment of glaucoma: a review. Jama. 311, 1901–1911 (2014).
Levin, A. M., Chaya, C. J., Kahook, M. Y. & Wirostko, B. M. Intraocular Pressure Elevation Following Intravitreal Anti-VEGF Injections: Short- and Long-term Considerations. J. Glaucoma. 30, 1019–1026 (2021).
Kahook, M. Y. et al. Sustained elevation in intraocular pressure associated with intravitreal bevacizumab injections. Ophthalmic Surg. lasers imaging: official J. Int. Soc. Imaging Eye. 40, 293–295 (2009).
Ko, M. L., Hu, D. N., Ritch, R., Sharma, S. C. & Chen, C. F. Patterns of retinal ganglion cell survival after brain-derived neurotrophic factor administration in hypertensive eyes of rats. Neurosci. Lett. 305, 139–142 (2001).
Pease, M. E. et al. Effect of CNTF on retinal ganglion cell survival in experimental glaucoma. Investig. Ophthalmol. Vis. Sci. 50, 2194–2200 (2009).
Kermer, P., Klöcker, N., Labes, M. & Bähr, M. Insulin-Like Growth Factor-I Protects Axotomized Rat Retinal Ganglion Cells from Secondary Death via PI3-K-Dependent Akt Phosphorylation and Inhibition of Caspase-3 In Vivo (J Neurosci. ;20(2):722-8. doi: (2000). 10.1523/JNEUROSCI.20-02-00722.2000
Holmes, D. I. & Zachary, I. The vascular endothelial growth factor (VEGF) family: angiogenic factors in health and disease. Genome Biol. 6, 209 (2005).
Park, S. A., Jeong, M. S., Ha, K. T. & Jang, S. B. Structure and function of vascular endothelial growth factor and its receptor system. BMB Rep. 51, 73–78 (2018).
Rosenstein, J. M., Krum, J. M. & Ruhrberg, C. VEGF in the nervous system. Organogenesis. 6, 107–114 (2010).
Saint-Geniez, M. et al. Endogenous VEGF is required for visual function: evidence for a survival role on müller cells and photoreceptors. PloS one. 3, e3554 (2008).
Saint-Geniez, M. & Maldonado, A. E. D'Amore, P. A. VEGF expression and receptor activation in the choroid during development and in the adult. Investig. Ophthalmol. Vis. Sci. 47, 3135–3142 (2006).
Kilic, U. et al. Human vascular endothelial growth factor protects axotomized retinal ganglion cells in vivo by activating ERK-1/2 and Akt pathways. J. neuroscience: official J. Soc. Neurosci. 26, 12439–12446 (2006).
Hasskarl, J. Sorafenib: targeting multiple tyrosine kinases in cancer. Recent. results cancer Res. Fortschr. der Krebsforschung Progres dans les recherches sur le cancer. 201, 145–164 (2014).
Wilhelm, S. M. et al. Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling. Mol. Cancer Ther. 7, 3129–3140 (2008).
Kernt, M. et al. Sorafenib prevents human retinal pigment epithelium cells from light-induced overexpression of VEGF, PDGF and PlGF. Br. J. Ophthalmol. 94, 1533–1539 (2010).
Kernt, M. et al. Sorafenib protects human optic nerve head astrocytes from light-induced overexpression of vascular endothelial growth factor, platelet-derived growth factor, and placenta growth factor. Growth factors (Chur Switzerland). 28, 211–220 (2010).
Kernt, M. et al. Inhibitory activity of ranibizumab, sorafenib, and pazopanib on light-induced overexpression of platelet-derived growth factor and vascular endothelial growth factor A and the vascular endothelial growth factor A receptors 1 and 2 and neuropilin 1 and 2. Retina (Philadelphia Pa). 32, 1652–1663 (2012).
Tian, L. L. et al. Inhibition of retinopathy of prematurity in rat by intravitreal injection of sorafenib. Int. J. Ophthalmol. 7, 198–204 (2014).

No competing interests reported.

Download PDF

Reviewers invited by journal
11 Sep, 2024
Editor assigned by journal
05 Sep, 2024
Editor invited by journal
05 Sep, 2024
Submission checks completed at journal
05 Sep, 2024
First submitted to journal
16 Aug, 2024

You are reading this latest preprint version

Comparative analysis of bevacizumab and sorafenib on the survival of retinal ganglion cells in the treatment of retinal diseases

Status:

Version 1

Abstract

Figures

Introduction

Materials and methods

Animals

Preparation of RGCs

Preparation of human umbilical vascular endothelial cells (HUVECs)

Cell viability assay

Western blot

Flow cytometry

Lactate dehydrogenase assay

Cell counting

RNA sequencing

Network analysis and visualization

Quantitative reverse-transcription polymerase chain reaction (RT-qPCR) and

RNA-Seq data validation

siRNA transfection

Statistical analysis

Results

Effects of VEGF and bevacizumab on RGC survival

Effect of bevacizumab on the Akt pathway

Effects of various VEGF inhibitors on RGC survival

Effects of sorafenib and bevacizumab on RGC survival

HUVEC survival

Effects of sorafenib and bevacizumab on RGC Akt

Effects of treatment with 0.5 µM sorafenib and 2 mg/ml bevacizumab on RGC survival

RNA sequencing results

Pathway analysis

Discussion

Declarations

Ethics Statements

Funding Statement:

Author Contribution

Data Availability

References

Additional Declarations

Status:

Version 1